Framställning av rAAV9 att överuttrycker eller Knockdown gener i Mus Hearts

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Kontrollera uttrycket eller aktiviteten av specifika gener genom hjärtmuskel leverans av genetiskt material i murina modeller medger undersökning av genfunktioner. Deras terapeutiska potential i hjärtat kan också bestämmas. Det finns begränsade metoder för in vivo molekylära ingrepp i musen hjärta. Rekombinant adenoassocierat virus (rAAV) -baserad genomet teknik har använts som ett viktigt verktyg för in vivo hjärt genmanipulation. De specifika fördelarna med denna teknik innefattar hög effektivitet, hög specificitet, låg genomisk takt integration, minimal immunogenicitet, och minimal patogenicitet. Här är en detaljerad beskrivning att konstruera, paket, och rena rAAV9 vektorer beskrivna. Subkutan injektion av rAAV9 in i neonatala valpar resulterar i robusta uttryck eller effektiv knockdown av genen (er) av intresse i mus hjärta, men inte i levern och andra vävnader. Med användning av hjärt-specific TnnT2 promotor, högt uttryck av GFP-genen i hjärtat erhölls. Dessutom riktar mRNA inhiberades i hjärtat när en rAAV9-U6-shRNA användes. Praktisk erfarenhet av rAAV9 teknik kan vara användbar för kardiovaskulära undersökningar.

Introduction

Styra uttryck eller aktivitet av specifika gener i olika biologiska system har blivit en värdefull strategi för att studera geners funktion 1. Ett direkt sätt att uppnå detta mål är att manipulera nukleotidsekvenser och generera mutanta alleler. Även göra exakta, målinriktade ändringar i genomet hos levande celler är fortfarande en tidsödande och arbetsintensiv praktiken har utvecklingen av kraftfulla talen och crispr / Cas9 verktyg öppnat en ny era av genomet redigering 2-5. En mer rutinlaboratoriemetod för genmanipulation har fokuserat på införandet av genetiska material (DNA och RNA som innehåller kodande sekvenser eller siRNA / shRNAs) in i cellerna för att uttrycka eller Knockdown genen (s) av intresse 1,6.

I många fall är det främsta hindret för genmanipulering är leverans av DNA, RNA eller protein i cellerna. När det gäller in vitro-studier, effektiv transfectipå system har etablerats i många odlade cellinjer. Men i musmodellen i synnerhet, är in vivo genavgivning mer utmanande. Det finns en serie av extra- och intracellulära barriärer som måste passeras för att uppnå effektiv cellulära upptaget av de exogena reagens. Ytterligare hinder är den snabba clearance och den korta varaktigheten av levererade material 7,8. En strategi för att kringgå dessa problem är att använda virala vektorer som "bärare" eller "fordon" för in vivo genleverans. De naturligt evolved transduktion egenskaper hos virus tillåta effektiv leverans av en gen av intresse in i celler 7,9,10. Många typer av virala vektorer har utvecklats och möjliggör en flexibel in vivo genmanipulation i olika celltyper och organ hos möss.

De mest allmänt använda virala system innefattar retrovirus, lentivirus, adenovirus och adeno-associerat virus (AAV) 12-14. Men många typer av retrovirus endast infekterar delande celler, och deras effektivitet i icke-delande celler är mycket låg 15. Detta begränsar deras användbarhet för genleverans. Lentivirus är ett släkte av Retroviridae familjen. Skiljer sig från andra retrovirus, lentivirus kan infektera både delande och icke-delande celler och har använts i stor utsträckning för genöverföring in efter mitotiska och högt differentierade celler 16. Livscykeln för Lentivirus även innebär integrering av vektor-DNA i värdgenomet. Således Lentivirus-medierad gentillförsel möjliggör stabil och långvarig uttryck av transducerade genetiska element 16-18. Emellertid kan denna funktion utgör en dubbel-edged svärd i användningen av dessa virus för att manipulera genuttryck, som integration av vektor-DNA kan leda till insertionsmutationer i värdcellerna och kan orsaka artefactual effekter. Adenovirus är en annan allmänt använd genavgivningssystemet. Till skillnad från retrovirus och lentivirus, Adenovirus är icke-integrerade och stör inte den genomiska integritet värdceller 8,10,11,19. Dessutom kan Adenovirus transfektera DNA i många celltyper, och infektion är inte beroende av aktiv celldelning 19. En annan viktig egenskap hos Adenovirus är den lätthet av vektor rening, i de virala vektorerna har förmågan att replikeras 19,20. Dock är den största nackdel med detta system att adenovirus-infektion kan utlösa starka immunsvar hos målceller och organ 19, som begränsar dess användning i många undersökningar, särskilt i genterapistudier.

Jämfört med dessa olika typs från virala vektorer, förefaller rekombinant adenoassocierat virus (rAAV) för att vara den idealiska genavgivningssystemet 21,22. Den uppvisar minimal immunogenicitet och patogenicitet 23,24. Dessutom rAAV infekterar ett brett spektrum av celltyper, inbegripet både delande och icke-delande celler. I de flesta fall, inte rAAV inte integreras i värdgenom; sålunda är risken för oönskade genetiska eller genomiska förändringar i målceller låg 22.

Nyligen har rAAV system med framgång använts för leverans av DNA som kodar för proteiner, miRNA, shRNAs och crispr-gRNAs in i mus-hjärtmuskeln 23,25-29 in vivo. Denna metod har underlättat grundläggande undersökningar och genterapistudier inom kardiovaskulär forskning. Här, till den detaljerade proceduren generera rAAV9 vektorer som effektivt överuttrycker eller Knockdown generna av intresse i mus hjärtan beskrevs. Protokollet ger en enkel och effektiv metod förmanipulera hjärt genuttryck i murina experimentella modeller.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alla beskrivna steg utfördes under protokoll som godkänts av Biosäkerhetskommittén och Institutional Animal Care och användning kommittén i Boston Barnsjukhus. Boston barnsjukhus har patogenfria mus anläggningar med reglerade ljus / mörker-cykler och klimatreglering. Veterinära och djurvårds personal förändring burar och säkerställa hälsa av mössen. Anläggningarna är AAALAC certifierad och har aktiv djurskydds Assurance certifiering (AAALAC Ackreditering beviljades den 1992/02/24 djurskydds Assurance nummer. A3303-01). Möss avlivades genom COa 2 levereras från en komprimerad gaskälla. Vävnadsprover uppsamlades efter att ha bekräftat att hjärtfrekvens, rörelse, och andning av djur hade upphört. Neonatal gnagare är resistenta mot CO2 eutanasi och avlivades genom halshuggning med vass sax. Dessa metoder är förenliga med rekommendationerna från panelen om avlivning av American Veterinary Medical Association.

1. Generering av rAAV9 Konstrukt genom kloning av ett cDNA eller shRNA-expressionskassetten i plasmiden Backbone

OBS: rAAV9 plasmiden, som innehåller de omvända terminala upprepningarna (ITR) hos AAV2, som används för gen överuttryck har modifierats för att hysa kycklingen TNNT2 promotor (rAAV9.cTNT), som gör det möjligt cardiomyocyte specifika uttryck av transducerade gener 25,26,29. Unikt Nhel och Kpnl-ställena har introducerats in i plasmiden, nedströms om promotorn. CDNA-fragment som kodar för generna av intresse kan klonas in i rAAV9 ryggraden med användning av dessa två restriktionsställen 25,26,29. Här, som ett exempel, var rAAV9 vektor för överuttryck av GFP-genen i mus-hjärtan genereras. Den resulterande plasmiden innehåller den cTnT :: GFP kassett flankeras av två ITR ställen (Figur 1). rAAV9.U6 :: shRNA konstruktioner användes för gen knockdown 25. Design shRNAs med användningnätet shRNA konstruktions servrar. rAAV9.U6 :: shRNA kan genereras antingen genom hybridisering och ligering DNA oligos-innehållande shRNA sekvenser i restriktionsenzymdiger rAAV9 vektorer hyser U6 promotor eller genom långväga PCR och intramolekylär Gibson montering baserade "sömlös" konstruktion 30. Den resulterande plasmiden bör innehålla den U6-shRNA kassetten flankerad av två ITR ställen (Figur 2). Här, som ett exempel, var rAAV9.U6 :: shRNA vektor konstrueras för att knockdown Trbp mRNA (Trbp shRNA sekvens: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG). En rusning shRNA användes som en negativ kontroll (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG).

  1. Klona cDNA eller shRNA expressionskassett i rAAV9 plasmidryggraden. Omvandla DNA in i kompetenta E. coli-celler 25.
    OBS: Använd stbl2 eller stbl3 E. coli celler för rAAV9 DNA-transformation för att minimera oönskad ITR rekombination.
  2. Plocka upppositiv klon från de transformerade E. coli-celler. Amplifiera kulturen i 500 ml Lilly-Barnett medium och extrahera rAAV9 plasmiden från bakteriecellerna 25-30.
    OBS: Midi / Maxi prep rAAV9 plasmiden för att erhålla en hög mängd DNA (> 100 | ig). Innan generering av virus, alltid analysera sekvensintegritet av de AAV-plasmider genom restriktionsdigerering och agarosgelelektrofores, såsom tidigare beskrivits (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).

2. Transfektion av HEK293-celler med rAAV9 Plasmider

  1. Förbereda en ug / ul av linjär polyetylenimin (PEI) -lösning. Lös upp PEI pulver i endotoxinfri dH 2 O som har upphettats till 70-80 ° C. Efterkylning ned till RT, neutralisera lösningen till pH 7,0 med 1 M HCl. Filtrera sterilisera (0,22 ^ m) av lösningen. Alikvotera 1 mikrogram / l PEI stamlösning (1400 l / rör) och lagra solutjon vid -20 ° C.
  2. Kultur HEK293-celler i Dulbeccos modifierade Eagles medium (DMEM) med 10% fetalt bovint serum (FBS) och 1% penicillin / streptomycin. Odla cellerna i en 37 ° C inkubator med 5 ± 0,5% koldioxid (CO 2).
  3. Vid dag 0, plattan HEK293-celler i tio 150-mm skålar 18-20 h före transfektion genom att dela upp> 90% sammanflytande celler i en 1: 2 utspädning.
    OBS: Vid dag ett, bör cellerna når 90% konfluens.
  4. Vid dag 1, transfektera HEK293 celler med rAAV9 plasmiden (t.ex. rAAV9.cTNT :: GFP eller rAAV6.U6 :: shRNA konstruktioner), Ad-Helper plasmid och AAV-Rep / Cap-plasmid med användning av PEI 25,26,29.
    1. För 10 rätter av celler vid 90% sammanflytning, blanda 70 | j, g av AAV-Rep / Cap-plasmid, 70 | j, g pf rAAV9 plasmid och 200 pg av Ad-Helper plasmid i ett 50-ml centrifugrör.
    2. Om cellerna är mindre sammanflytande, justera DNA belopp proportionellt. Till exempel, om cellerna är vid 75% sammanflytande, minskaDNA belopp proportionellt (75/90 av det belopp som anges i steg 2.4.1): blanda 70 x 75/90 = 58,3 mikrogram av AAV-Rep / Cap plasmid, 70 x 75/90 = 58,3 mikrogram av rAAV9 plasmid och 200 x 75/90 = 166,7 pg av Ad-Helper plasmid i ett 50-ml centrifugrör.
    3. Lägg 49 ml RT DMEM (utan FBS) till 50-ml rör och blanda väl.
    4. Lägga 1,360 pl av PEI-lösning för att göra den PEI: DNA-förhållande (v / v) vara 4: 1. Blanda väl. Inkubera vid RT i 15 till 30 min.
    5. Tillsätt 5 ml av blandningen framställd i steg 2.4.4 till varje 150-mm skål (50 ml av blandningen i tio 150-mm skålar).
  5. Odla cellerna i en 37 ° C inkubator med 5 ± 0,5% CO2 under 60-72 h.

3. Skörd av transfekterade HEK293-celler och rening av rAAV9 vektorer

  1. Skörda cellerna 60-72 h efter transfektion. Rubba och suspendera cellerna i disken genom att pipettera upp och ned med odlingsmediet. Överför alla cellsuspensioner till sterila50-ml rör.
  2. Centrifugera cellerna vid 500 xg under 5 min. Resuspendera cellpelleten med 5 ml PBS i varje rör och kombinera samtliga cellsuspensioner till en 50 ml-rör.
  3. Centrifugera cellerna vid 500 xg under 5 min. Kassera supernatanten. I detta steg, lagra cellpelleten vid -80 ° C eller omedelbart rena AAV från pelleten, som beskrivs i steg 3.4-3.15.
  4. Förbered lysbuffert: 150 mM NaCl och 20 mM Tris-HCl, pH 8,0. Filtrera sterilisera (0,22 | iM). Lagra bufferten vid 4 ° C.
  5. Suspendera pelleten med 10 ml lyseringsbuffert.
  6. Frysa lysatet vid -80 ° C eller i torris / etanol-bad och sedan tina den vid 37 ° C. Vortex under 1 minut. Frysa och tina lysatet 3 gånger.
  7. Lägga MgCl2-lösning till den tinade lysatet (göra den slutliga koncentrationen av MgCl 2 i lysatet vara ett mM). Tillsätt nukleas till en slutkoncentration av 250 E / ml. Inkubera vid 37 ° C under 15 min för att upplösa DNA / protein aggrom delegering.
    OBS: Om DNA / protein aggregation inte blir löst efter nukleas eller endonukleas behandling, Dounce homogenisera lysaten 20 gånger.
  8. Centrifugera provet vid 4800 xg under 20 min vid 4 ° C. Samla in supernatanten.
  9. Samtidigt förbereder Jodixanol gradient lösning:
    1. Förbered 17% av gradienten lösning genom att blanda 5 ml av 10x PBS, 0,05 ml av 1 M MgCl2, 0,125 ml av 1 M KCl, 10 ml av 5 M NaCl, och 12,5 ml ofdensity gradient medium. Justera den totala volymen till 50 ml med användning av H 2 O.
    2. Bered 25% lösning genom att blanda 5 ml av 10x PBS, 0,05 ml av 1 M MgCl2, 0,125 ml av 1 M KCl, 20 ml av densitetsgradient-medium, och 0,2 ml av 0,5% (vikt / vol) fenolrött. Justera den totala volymen till 50 ml med användning av H 2 O.
    3. Bered 40% lösning genom att blanda 5 ml av 10x PBS, 0,05 ml av 1 M MgCl2, 0,125 ml av 1 M KCl, och 33,3 ml av densitetsgradient-medium. Justera den totala volymen till 50 ml med användning avH2O
    4. Bered 60% lösning genom blandning av 0,05 ml 1 M MgCl2, 0,125 ml 1 M KCl, 50 ml av densitetsgradient-medium, och 0,1 ml av 0,5% (vikt / vol) fenolrött.
  10. Med en nål och spruta, ladda Jodixanol gradienten lösning i polypropenrör i storleksordningen 5 ml 17%, 5 ml av 25%, 5 ml av 40% och 5 ml av 60%, med början från botten. Ladda alla lysatet som erhållits från steg 3,8 (14-16 ml) på toppen av gradienten. Gradienten, noterat från botten till toppen, är 60%, 40%, 25%, 17%, och lysatet skiktet. Fyll röret med lysbuffert och täck den med korken.
  11. Centrifugera vid 185.000 xg under 90 min vid 16 ° C.
  12. Skörda det virala fraktionen (40% skikt) med en spruta. In nålen (21 gauge) i skärningspunkten mellan fraktionerna 40% och 60%, endast aspirera 40% skiktet.
    OBS: Undvik aspire NÅGOT av 25% skiktet.
  13. Blanda det virala fraktionen med steriliserat polyoxietylen-polyoxypropropylen-segmentsampolymer PBS-lösning (10% polyoxietylen-polyoxipropylen-blocksampolymer lager 1: 10000 utspädd i PBS) upp till en total volym av 15 ml. Fyll blandningen i filterröret (cut-off MW = 100 kD). Centrifugera vid 2000 xg under 30 min vid 4 ° C.
  14. Kassera lösningen i botten. Fylla på filterröret med polyoxietylen-polyoxipropylen-blocksampolymer PBS-lösning till en total volym av 15 ml. Centrifugera vid 2000 xg under 20 min vid 4 ° C. Upprepa detta steg två gånger. Uppsamla det renade rAAV9 virus (den fraktion ovanför filtret).
  15. Överföra den renade rAAV9 i filterröret till 1,7-ml rör. Alikvotera det renade rAAV9 (100-400 | il / rör, beroende på volymen och titern av AAV) och lagra viruset vid -80 ° C.
    OBS: Undvik upprepad frysning-tinar.

4. Mätning av titern av rAAV9

  1. Bered standard DNA-prover.
    1. Utforma specifik och effektiv PCRprimrar för rAAV9 vektorer och optimera PCR-tillståndet.
      OBS: De primers som användes i denna studie är "Forward: TCGGGATAAAAGCAGTCTGG; Reverse: TCGGACGGAGATACGTGAGT". PCR-reaktionen utfördes med följande betingelser: initial denaturering vid 95 ° C under 3 min; 35 cykler av 95 ° C under 20 sek, 60 ° C under 15 sek, och 72 ° C under 10 sek; och slutlig förlängning vid 72 ° C under 10 min. De optimerade primers och PCR-betingelser är plasmid-specifika, eftersom insatsen sekvens i rAAV9 vektorn kan påverka specificiteten och effektiviteten av PCR 31.
    2. Utför PCR-reaktionen med de villkor som anges i steg 4.1.1. Rena PCR-produkten med ett gelextraktionskit.
    3. Mäta koncentrationen av renad DNA med användning av en spektrofotometer. Beräkna koncentrationen i DNA-molekylnummer baserat på molekylvikten / längd av PCR-produkten.
      1. Beräkna molekylkoncentration med användning av följande ekvation: molecular koncentration (DNA-molekyler eller fragment / ml) = 6,23 x 10 23 mol -1 x Con. x 10 -6 / MW. Notera: (6,23 x 10 23 mol -1 är Avagadro s tal; Con .: DNA-koncentration i pg / ml; MW .: molekylvikt i g / mol). Till exempel, om den erhållna koncentrationen av PCR-produkten är 100 | ig / ml och dess längd är 200 bp, är molekylvikten av den dubbelsträngade DNA: t 2 x 200 x 310 = 124000 (den genomsnittliga molekylvikten för varje nukleotid i enkelsträngat DNA är ca 310 g / mol). Den molekylära koncentration (DNA-molekyler / ml) = 6,23 x 10 23 mol -1 x 100 | j, g / ml x 10 -6 / 124,000 g / mol = 5,18 x 10 14 DNA-molekyler / ml.
      2. Utför en utspädningsserie av DNA-fragment och förbereda standardprover, med koncentrationer av 10 13 molekyler / ml, 10 12 molekyler / ml, 10 11 molekyler / ml, 10 10 molekyler / ml, 10 9 molekyler / ml, 10 7 molekyler / ml. Använd 1 pl lösning för varje standardprov för kvantitativ PCR (qPCR, i steg 4,6).
  2. Blanda 5 | j, l av renat rAAV9 lösning med 5 ^ il 10 x DNAs-buffert, 1 | il av DNAs (10.000 U / ml), och 39 | il av DDH 2 O. Den totala volymen bör vara 50 ^.
  3. Inkubera ampullen vid 37 ° C under 30 min för att avlägsna kvarvarande oförpackade plasmid-DNA.
  4. Inaktivera DNAs vid 95 ° C under 10 min. Kyla ned lösningen, tillsätt 44 | il H2O, 5 ^ il 10 x DNAs-buffert, och 1 | il proteinas K-lager (10 mg / ml).
  5. Inkubera lösningen vid 50 ° C under 2 h. Stoppa reaktionen och inaktivera proteinas K vid 95 ° C under 10 min.
  6. Använd 1 pl av provet för kvantitativ PCR (qPCR) -analys. Beräkna titer.
    1. Kör kvantitativ PCR (qPCR) med primers utformade i steg 4.1.1 med hjälp av prover frOm steg 4.1.4 (standardprov) och från steg 4,5 (prover som skall mätas).
      1. För varje reaktion, blanda 10 | il av 2x Grön huvudblandning (innehållande Taq-polymeras, dNTP-blandning, buffert, MgCl2, och grönt färgämne), 0,5 pl av framåtriktad primer (5 pM), 0,5 | il omvänd primer (5 ^ M), 8 pl H2O, och 1 pl av provet som skall mätas. Utför qPCR med följande villkor: hålla proverna vid 50 ° C under 2 minuter och 95 ° C under 10 minuter; utföra 40 cykler vid 95 ° C under 15 sek och vid 60 ° C under 1 min; för smältsteget, inkubera proverna vid 95 ° C under 30 sekunder och 60 ° C under 15 sek. Generera standardkurvan baserad på de C T numren på de standardprover (Figur 3).
    2. Beräkna molekyl koncentration / titer av AAV provet mot standardkurvan. Den rAAV9 har ett enkelsträngat DNA-genom, så molekylkoncentrationen kommer att vara två gånger högre än denberäknat värde (2x effekt (10, y), figur 3B). Dessutom kommer titern av den renade rAAV9 vara 20 gånger högre än vad som erhålls från beräkningen på grund av den 1:20 utspädning av viruset i DNAs och proteinas K-reaktioner (5 ul i 100 | il totalt).

5. rAAV9 Injektion i neonatala möss och Gene Expression Analyser i hjärtat

  1. Förbered rAAV9 arbetslösningar i polyoxietylen-polyoxipropylensegmentsampolymer PBS-lösning. Gör virus lager med halter av 1-7 x 10 12 partiklar / ml.
    OBS: Leverera 50-70 pl rAAV9 lösning i varje postnatal dag 0,5-1,5 musen genom subkutan injektion. För att uppnå en effektiv gen uttryck eller knockdown, är det rekommenderat att utföra en pilottest för varje undersökning för att optimera mängden insprutat AAV. Använd samma mängd rAAV9.cTNT :: Luc eller rAAV9.U6 :: scramble kontroller för varje undersökning för att minimera partiskhet.
    OBS: Vi använde 1-1,5x 10 11 partiklar / valp för överuttryck och 2,5-5 x 10 11 partiklar / valp för knockdown i postnatal dag 0,5-1,5 mi ce).
  2. Behandla neonatala möss med rAAV9 på P0.5-P2.5 genom subkutan injektion.
    1. Pre-fylla en 29G1 2, 0,33 x 12,7 spruta / mm insulin med rAAV9 lösning. Var noga med att ta bort luftbubblor.
    2. Håll Cryo-sövda valp i ena handen med tummen och pekfingret. Före injektion, dra tillbaka huden på valpen med en svabb pinne mättad med 70% isopropylalkohol för att bibehålla den sterila tillstånd. För in injektionsnålen i den främre-dorsal huden djuret vid en vinkel av 5 till 10 °. Injicera 50-70 pl av rAAV9 lösning sprutan insulin.
      OBS: rAAV9 kan också levereras till musen via intraperitoneal eller intravenös injektion 26,27. Effektiv expression av de levererade generna i hjärtat kan erhållas. Emellertid intraperitoneal injiceraion ibland kan resultera i läckande expression i levern. Efter injektionen var villkoret av valparna kontrolleras varje dag.
  3. Nivån av genuttryck i hjärtat kan övervakas med qPCR, immunofluorescens, eller Western blöt (representativa resultat visas i figurerna 4 och 5) 25,26.
    OBS: Möss avlivades genom COa 2 levereras från en komprimerad gaskälla. Vävnadsprover uppsamlades efter att ha bekräftat att hjärtfrekvens, rörelse, och andning av djuren hade upphört. Neonatal gnagare är resistenta mot CO2 eutanasi och avlivades genom halshuggning med vass sax. Metoden är i linje med rekommendationerna från panelen för avlivning av American Veterinary Medical Association.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Strategierna för rAAV9 konstruktion av rAAV9.cTNT :: GFP eller rAAV9.U6 :: shRNA plasmider visas i figurerna 1 och 2, respektive. Som exemplen, var rAAV9 vektorn genereras för att överuttrycka GFP-genen i mus-hjärtan. Den resulterande plasmiden innehåller den cTnT :: GFP kassett flankeras av två ITR ställen (Figur 1). Den rAAV9.U6 :: shRNA vektor konstrue att knockdown Trbp mRNA (Figur 2)

Standardkurvan för rAAV9 titrering genererades med qPCR data genom linjär regression. Den manipulerade variabeln y representerar Log 10 värde av DNA molekylära koncentrationen av varje standardprov och motsvarande variabeln x representerar C T-värde. Logg 10 (koncentration) värden (y) och C T-nummer (x) uppvisar en fin linjär korrelation (R 2 = 0,9971) och passar med ekvationen y = -0.2832x + 14,616 (figur 3A). Titrar av rAAV9 prover beräknades baserat på den linjära ekvationen (Figur 3B). Med den metod som beskrivs i protokollet (steg 4.6.2 och figur 3B), en hög titer av rAAV9 vektorer (50-200 | il,> 6 x 10 13 partiklar / ml) erhölls under den representativa studie.

Att övervaka effektiviteten och vävnads specificitet rAAV9.cTNT vektorer, var P0.5 valpar behandlades med samma mängd (1 x 10 11 partiklar / valp) av rAAV9.cTNT :: luciferas (AAV-Luc) eller rAAV9.cTNT :: GFP (AAV-GFP) genom subkutan injektion. Två veckor efter injektion, var GFP-signal övervakas i olika vävnader hos mössen. Robust uttryck av GFP detekterades i hjärtat, men inte i andra organ (Figur 4, n> 3). Således var effektiv och hjärtspecifika genuttryck uppnås med rAAV9.cTNT vektorn.

jove_content "fo: keep-together.within-page =" 1 "> Att övervaka knockdown effektivitet och vävnads specificitet rAAV9.U6 vektorer, var P0.5 möss som behandlats med samma mängd (3 x 10 11 partiklar / valp) av rAAV9 .U6 :: Scramble (AAV-Scramble) eller rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) genom subkutan injektion. Två veckor efter injektion, uttryck av Trbp i olika vävnader i övervakades av qPCR (Figur 5, n = 3 ). mRNA nivå Trbp i hjärtat var kraftigt minskat med rAAV9.U6 :: shTrbp (68% nedreglering, P = 0,0004452). nedreglering av Trbp detekterades också i levervävnad från rAAV9.U6 :: shTrbp behandlade möss. emellertid är förändringen mycket lägre.

Figur 1
Figur 1: Strategier för att Konstruera rAAV9.cTNT :: GFP plasmid. (A) Systemet för cTnT :: GFP kassett. (B TNNT2 promotorn (rAAV9.cTNT) följt av två unika restriktionsställen (Nhel och Kpnl). GFP öppna läsramen klenades in i rAAV9.cTNT vektorn genom restriktionsställe-medierad ligering för att generera den rAAV9.cTNT :: GFP plasmid. (B) Den rAAV9.cTNT :: GFP plasmid kan konstrueras genom Gibson montering. Klicka här för att se en större version av denna siffra.

figur 2
Figur 2: Strategier för att Konstruera rAAV9.U6 :: shRNA Plasmid. (A) Systemet för U6 :: shRNA kassetten visas. Expression av shRNA drivs av U6 promotorn (blått). (B) rAAV9-U6-shRNA kassetter kan genereras genom glödgning och ligerande DNA-oligos innehållerIng shRNA sekvenser i de restriktionsenzymdigere rAAV9 vektorer som härbärgerar U6 promotorn. (C) rAAV9.U6 :: shRNA kassetter kan genereras av långväga PCR och intramolekylär Gibson aggregatet-baserade "sömlös" -konstruktion. 5 'arm, slinga, och 3' arm shRNA visas i grönt, orange och rött, respektive. Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3: Beräkning av rAAV9 titer. (A) Standardkurvan för rAAV9 titrering genererades genom linjär aggression hjälp av qPCR data. Styrvariabeln y representerar Log 10 värde av DNA molekylära koncentrationen av varje standardprov och motsvarande variabeln xrepresenterar C T-värde. (B) Titrar av rAAV9 proverna beräknas utifrån den linjära ekvationen för standardkurvan. Klicka här för att se en större version av denna siffra.

figur 4
Figur 4: Expression Mönster av rAAV9.cTNT :: GFP i möss vävnader. P0.5 pups behandlades med samma mängd (1 x 10 11 partiklar / pup) av rAAV9.cTNT :: Luciferase (AAV-Luc, negativ kontroll) eller rAAV9.cTNT :: GFP (AAV-GFP) genom subkutan injektion. Två veckor efter injektionen togs vävnadsproverna skördas. Uttryck av GFP övervakades under ett fluorescerande dissektion omfattning. Både ljusa fält och fluorescens bilder presenteras. Försöken har upprepats mer än 3 gånger (n> 3).Skalstreck = 2,0 mm. SkM, skelettmuskel. Klicka här för att se en större version av denna siffra.

figur 5
Figur 5: Knockdown genuttryck med AAV-shRNA. P0.5 möss behandlades med samma mängd (3 x 10 11 partiklar / pup) av rAAV9.U6 :: rusning (AAV-rusning) eller rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) genom subkutan injektion. Två veckor efter injektion, var mRNA-nivåer av Trbp i olika vävnader övervakas av qPCR (n = 3). Data presenteras som medelvärde ± SEM. Cut-off P-värde är 0,05. NS, P> 0,05, inte signifikant. **, P <0,01. SkM, skelettmuskel. Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Det är viktigt att minimera oönskad ITR rekombination under plasmidkonstruktion. Innan generering viruset, måste en alltid övervaka ITR integritet AAV-plasmider med användning av restriktionsdigerering och agarosgelelektrofores. Det är omöjligt att få 100% intakta plasmider, men rekombination förhållandet bör minimeras så mycket som möjligt. Mindre än 20% är acceptabel för framgångsrik rAAV9 förpackning. Notera kan odla bakterierna vid lägre temperatur (30 ° C) med en lägre skaka hastighet (180-200 rpm) minska risken för ITR rekombination.

Det är viktigt att se till att de HEK293-celler är hälsosamt för framgångsrik transfektion och rAAV9 förpackning. "Friska" celler är vanligtvis mycket proliferativ och växa snabbt. Emellertid snabb proliferation och tillväxt av HEK293-celler inte nödvändigtvis garanterar den höga effektiviteten i rAAV9 förpackning. Således är det viktigt att börja experimenten med färska celler. Detrekommenderas att använda låg-passage HEK293-celler (<10 passager cellerna passe var 2-3 dagar) för rAAV9 förpackning. Notera kan andra serotyper av rAAV måste renas med hjälp av olika förfaranden 32.

Utredaren beviljas flexibilitet i generation av rAAV9 plasmider. Antingen restriktionsställe-medierad ligation eller Gibson montering kan användas 30. För rAAV9.U6 :: shRNA konstruktion är Gibson löpande band-baserade strategi intramolekylär en effektiv metod (figur 1 och 2). Flera AAV-shRNA plasmider eller sammanställd kan AAV-shRNAs snabbt konstrueras. Att överuttrycka gener som använder rAAV9 existerar det ett storleksbegränsning för isatta cDNA-sekvenser. Allmänhet, storleken fragmentet mellan ITR måste vara mindre än 5 kb 33. Intein katalyserade proteinsplitsning kan användas för att kringgå förpackningens storlek gränsen rAAV9 vektorer 34.

Andra viralt systems, inklusive retrovirus, lentivirus och adenovirus har också utvecklats och möjliggör flexibel genmanipulation. Jämfört med dessa olika typer av virala vektorer, har rAAV specifika fördelar: hög effektivitet, hög specificitet, låg genomisk takt integration, minimala immunogenicitet, och minimal patogenicitet. Således är rAAV-baserad genomet teknik framstår som ett idealiskt verktyg för in vivo genmanipulation.

Tidigare studier har visat att rAAV9 systemet möjliggör effektiv expression av levererade gener in vivo. Med cTnT (kyckling TnnT2) promotorn, hjärtspecifika genuttryck erhölls (figur 4) 25,26. Även om U6 promotorn är ubiquitously aktiv i mus vävnader, en mest slående hämning av mål-mRNA (Trbp) av rAAV9.U6 :: shRNA observerades i hjärtat, men inte i andra organ (Figur 5). Levern är den vanligaste organet omvandlas av olika serotyper avrAAV 35,36. Emellertid är knockdown verkningsgrad (36% minskning av mRNA-nivån) i levern mycket lägre än den i hjärtat (68% minskning av mRNA-nivån). Detta ligger i linje med den tidigare studien visar att trots högre virusgenom närvaro i levern, ger systemisk tillförsel av shRNA av rAAV9 effektivare gen knockdown i hjärtat 35. Det är möjligt att hepatocyter är mer proliferativ än kardiomyocyter och mer aktivt genomgår celldelning efter rAAV9 administration på neonatal åldrar, vilket resulterar i betydande vektorgenomet utspädning i levervävnad. Emellertid antyder detta också att den serotyp av rAAV9 kan mer effektivt transducera kardiomyocyter i jämförelse med andra celltyper. Såsom demonstreras av Lovric et al., I differentierade myocyter är de DNA-skada respons MRN komplexa proteiner undertryckt. MRN komplexa proteiner binder AAV-genom och hämmar AAV transduktion genom transkriptionstystande. Således permissivity mot AAV-transduktion kan induceras av den terminala differentieringen av kardiomyocyter 36, vilket gör rAAV9 systemet, jämför med andra virala vektorer, mycket lämplig för genmanipulation i hjärtat. För att ytterligare minimera oönskade knockdown effekter i andra organ (t.ex. lever), en även kan använda hjärtspecifika cTnT promotor drivna MIR-30a-baserade shmiR att undertrycka gener av intresse i hjärtat 29. Detta manuskript ger läsaren med de specifika tekniker för kapitalisera på den rAAV9 teknik i kardiovaskulära undersökningar.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Polyethylenimine, Linear (MW 25,000) Polysciences, Inc.  #23966-2
Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56) Beckman Coulter, Inc # 362183
Nuclease, ultrapure SIGMA #E8263-25KU
Density Gradient Medium(Iodixanol) SIGMA #D1556-250ML
Centrifugal Filter Unit with Ultracel-100 membrane EMD Millipore Corporation #UFC910008
Laboratory pipetting needle with 90° blunt ends,gauge 14, L 6 in., nickel plated hub SIGMA #CAD7942-12EA
Poloxamer 188 solution (Pluronic® F-68 solution) SIGMA P5556-100ML
Proteinase K SIGMA 3115828001
DNase I Roche 10104159001
Centrifuge machine Thermo Scientific 75004260
Centrifuge System Beckman Coulter 363118
Ultracentrifuge Beckman Coulter
DMEM medium Fisher Scientific SH30243FS
Fetal Bovine Serum  Atlanta Biologicals               S11150
rAAV9 vector Penn Vector Core P1967

DOWNLOAD MATERIALS LIST

References

  1. Primrose, S. B., Twyman, R. Principles of gene manipulation and genomics. John Wiley & Sons. (2013).
  2. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, 1258096 (2014).
  3. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  4. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  5. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355 (2014).
  6. Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. A versatile tool for conditional gene expression and knockdown. Nat. Methods. 3, 109-116 (2006).
  7. Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. Advances in Gene Delivery Systems. BioMed Res. Int. 2015, 610342 (2015).
  8. Kamimura, K., Suda, T., Zhang, G., Liu, D. Advances in gene delivery systems. Pharm. Med. 25, 293-306 (2011).
  9. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  10. Giacca, M., Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J. Control Release. 161, 377-388 (2012).
  11. Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. Evolving gene therapy approaches for osteosarcoma using viral vectors: review. Bone. 40, 797-812 (2007).
  12. De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).
  13. Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. Retrovirus-mediated gene delivery into male germ line stem cells. FEBS Lett. 475, 7-10 (2000).
  14. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).
  15. Katz, R. A., Greger, J. G., Skalka, A. M. Effects of cell cycle status on early events in retroviral replication. J. Cell. Biochem. 94, 880-889 (2005).
  16. Escors, D., Breckpot, K. Lentiviral vectors in gene therapy: their current status and future potential. Arch. Immunol. Ther. Exp. 58, 107-119 (2010).
  17. Mátrai, J., Chuah, M. K., VandenDriessche, T. Recent advances in lentiviral vector development and applications. Mol. Ther. 18, 477-490 (2010).
  18. Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. Structural dynamics of retroviral genome and the packaging. Front. Microbiol. 2, 1-9 (2011).
  19. Douglas, J. T. Adenovirus-Mediated Gene Delivery. Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. 3-14 (2004).
  20. Armendáriz-Borunda, J., et al. Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration. J. Biosci. Bioeng. 112, 415-421 (2011).
  21. Snyder, R. O. Adeno-associated virus-mediated gene delivery. J Gene Med. 1, 166-175 (1999).
  22. Samulski, R. J., Muzyczka, N. AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014).
  23. Kaplitt, M. G., et al. Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector. Ann. Thorac. Surg. 62, 1669-1676 (1996).
  24. Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. J. Gene. Med. 7, 316-324 (2005).
  25. Ding, J., et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776-783 (2015).
  26. Lin, Z., et al. Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Circ. Res. 115, 354-363 (2014).
  27. Wahlquist, C., et al. Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508, 531-535 (2014).
  28. Carroll, K. J., et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).
  29. Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342, 111-114 (2013).
  30. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  31. Rychlik, W., Spencer, W., Rhoads, R. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Allocca, M., et al. Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J. Clin. Invest. 118, 1955-1964 (2008).
  33. Wu, Z., Yang, H., Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
  34. Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum. Gene Ther. 19, 958-964 (2008).
  35. Piras, B. A., O'Connor, D. M., French, B. A. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver. PLoS One. 8, e75894 (2013).
  36. Lovric, J., et al. Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins. Mol. Ther. 20, 2087-2097 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics