Fremstilling af rAAV9 at overudtrykke eller Knockdown gener i mus Hearts

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Styring af ekspressionen eller aktiviteten af ​​specifikke gener gennem myocardial levering af genetisk materiale i murine modeller tillader undersøgelse af genfunktioner. Deres terapeutiske potentiale i hjertet kan også bestemmes. Der er begrænsede tilgange til in vivo molekylær intervention i muse hjerte. Rekombinant adenoassocieret virus (rAAV) -baseret genom engineering er blevet udnyttet som et vigtigt redskab til in vivo cardiac genmanipulation. De specifikke fordele ved denne teknologi omfatter høj effektivitet, høj specificitet, lav genomisk integration sats, minimal immunogenicitet, og minimal patogenicitet. Her er en detaljeret procedure til at konstruere, pakke, og rense rAAV9 vektorer beskrevet. Subkutan injektion af rAAV9 i neonatale hvalpe resulterer i robust ekspression eller effektiv knockdown af genet (er) af interesse i muse hjertet, men ikke i leveren og andre væv. Brug af hjerte--specic TnnT2 promotor, høj ekspression af GFP-genet i hjertet blev opnået. Derudover mål-mRNA blev inhiberet i hjertet, når en rAAV9-U6-shRNA blev anvendt. Arbejde viden om rAAV9 teknologi kan være nyttige for hjerte-kar-undersøgelser.

Introduction

Controlling ekspression eller aktivitet af specifikke gener i forskellige biologiske systemer er blevet en værdifuld strategi i studiet af genfunktion 1. Et direkte middel til at opnå dette mål er at manipulere nukleotidsekvenser og generere mutant alleler. Selv lave præcise, målrettede ændringer til genomet af levende celler er stadig en tidskrævende og arbejdskrævende praksis, har udviklingen af de magtfulde Talen og CRISPR / Cas9 værktøjer åbnet en ny æra af genom-redigering 2-5. En mere rutine laboratorium metode til genmanipulation har fokuseret på at indføre genetisk materiale (DNA og RNA, som indeholder kodende sekvenser eller siRNA'erne / shRNAs) ind i cellerne til at udtrykke eller knockdown genet (r) af interesse 1,6.

I mange tilfælde, de store hindringer for genmanipulation er levering af DNA, RNA eller protein i cellerne. Med hensyn til in vitro studier, effektiv transfectipå systemer er blevet etableret i mange dyrkede cellelinier. Men i musemodellen især in vivo genlevering er mere udfordrende. Der er en serie af ekstra- og intracellulære barrierer, der skal udkobles for at opnå en effektiv cellulær optagelse af de eksogene reagenser. Yderligere hindringer omfatter den hurtige clearance og den korte varighed af den leverede materialer 7,8. En strategi til at omgå disse problemer er at anvende virusvektorer som "bærere" eller "vehikler" til in vivo-genadministration. De naturligt udviklede transduktion egenskaber vira tillader effektiv levering af et gen af interesse i celler 7,9,10. Talrige typer af virale vektorer er blevet udviklet og muliggøre fleksibel in vivo genmanipulation i forskellige celletyper og organer i mus.

De mest almindeligt anvendte virale systemer indbefatter retrovirus, lentivirus, adenovirus og adeno-associeret virus (AAV) 12-14. Men mange typer af retrovira kun inficere delende celler, og deres effektivitet i ikke-delende celler er meget lav 15. Dette begrænser deres anvendelighed til gen-levering. Lentivirus er en slægt af Retroviridae familien. Forskellige fra andre retrovira, kan lentivirus inficere både delende og ikke-delende celler og har været meget anvendt til genoverførsel til post-mitotiske og højt differentierede celler 16. Livscyklus lentivirus involverer også integrationen af ​​vektor-DNA i værtsgenomet. Således lentivirus-medieret genlevering muliggør stabil og langvarig ekspression af de transducerede genetiske elementer 16-18. Imidlertid kan denne funktion repræsenterer en dobbelt-edged sværd i brugen af ​​disse vira til at manipulere genekspressionen, som integration af vektor-DNA kan føre til insertionsmutagenese i værtscellerne og kan forårsage kulturgenstandsspor virkninger. Adenovirus er en anden udbredt gentildelingssystem. I modsætning retrovira og lentivirus, adenovirus er ikke-integreret og ikke forstyrrer det genomiske integritet værtsceller 8,10,11,19. Desuden kan Adenovira transficere DNA i mange celletyper, og infektion er ikke afhængig af aktiv celledeling 19. En anden vigtig egenskab ved Adenovira er den lethed af vektor oprensning som de virale vektorer har evnen til at blive gentaget 19,20. , De store forbehold ved dette system er, at adenovirus infektion kan udløse kraftige immunreaktioner i target celler og organer 19, der begrænser dens anvendelse i mange undersøgelser, især i genterapi undersøgelser.

Sammenlignet med disse anden types af virale vektorer, rekombinant Adenoassocieret virus (rAAV) synes at være den ideelle gentildelingssystem 21,22. Det udstiller minimal immunogenicitet og patogenicitet 23,24. Desuden rAAV inficerer en bred vifte af celletyper, herunder både delende og ikke-delende celler. I de fleste tilfælde har rAAV ikke integreres i værts-genomer; således, at risikoen for uønskede genetiske eller genomiske ændringer i målcellerne er lav 22.

For nylig er rAAV-systemer succes blevet brugt til in vivo levering af DNA, der koder proteiner, miRNA, shRNAs, og CRISPR-gRNAs i muse hjertemuskel 23,25-29. Denne metode har lettet fundamentale undersøgelser og genterapi undersøgelser inden for hjerte-kar-forskning. Her til den detaljerede procedure generere rAAV9 vektorer der effektivt overekspression eller knockdown generne af interesse i mus hjerter blev beskrevet. Protokollen giver en enkel og effektiv metode tilmanipulere kardial genekspression i murine forsøgsmodeller.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

blev udført Alle beskrevne trin under protokoller godkendt af biosikkerhed udvalget og Institutional Animal Care og brug Udvalg for Boston Børnehospital. Boston Børnehospital har patogenfrie mus faciliteter med regulerede lys / mørke cyklus og klimaanlæg. Veterinær- og dyr plejepersonalet ændre bure og sikre sundheden for de mus. Faciliteterne er AAALAC certificeret og har aktiv dyrevelfærd Assurance certificering (AAALAC Akkreditering Indrømmet på 1992/02/24 dyrevelfærd Assurance nummer:. A3303-01). Mus blev aflivet ved CO2 leveret fra en komprimeret gaskilde. Vævsprøver blev opsamlet efter bekræftelse af, at pulsen, bevægelse og vejrtrækning dyr var ophørt. Neonatale gnavere er resistente over for CO 2 eutanasi og blev aflivet ved halshugning hjælp skarp saks. Disse metoder er i overensstemmelse med anbefalingerne fra panelet om Eutanasi af den amerikanske Veterinary Medical Association.

1. Generering af rAAV9 konstrukter ved kloning af et cDNA eller shRNA ekspressionskassetten i plasmidskelettet

BEMÆRK: rAAV9 plasmid, der indeholder de inverterede terminale gentagelser (ITR'er) i AAV2, anvendes til gen-overekspression er blevet modificeret til at havnen kyllingen TNNT2 promotor (rAAV9.cTNT), som gør det muligt cardiomyocyte-specifik ekspression af transducerede gener 25,26,29. Unik Nhel og KpnI steder er blevet indført i plasmidet, nedstrøms for promotoren. CDNA-fragmenter, der koder generne af interesse kan klones ind i rAAV9 rygraden ved hjælp af disse to restriktionssites 25,26,29. Her, som et eksempel, blev rAAV9 vektor til overekspression af GFP-genet i mus hjerter genereret. Det resulterende plasmid indeholder cTnT :: GFP-kassette flankeret af to ITR steder (figur 1). rAAV9.U6 :: shRNA konstruktioner blev anvendt til gen knockdown 25. Design shRNAs hjælponline shRNA design servere. rAAV9.U6 :: shRNA kan genereres enten ved udglødning og ligere DNA oligo'er-holdige shRNA sekvenser i restriktionsenzymet-fordøjet rAAV9 vektorer huser U6 promotor, eller ved langtrækkende PCR og intra-molekylær Gibson montage-baserede "seamless" konstruktion 30. Det resulterende plasmid bør indeholde U6-shRNA kassette flankeret af to ITR sites (figur 2). Her, som et eksempel, blev rAAV9.U6 :: shRNA vektor konstrueret til knockdown Trbp mRNA (Trbp shRNA sekvens: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG). En scramble shRNA blev anvendt som en negativ kontrol (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG).

  1. Klone cDNA eller shRNA ekspressionskassetten i rAAV9 plasmidskelet. Omdan DNA'et i kompetente E. coli-celler 25.
    BEMÆRK: Brug STBL2 eller stbl3 E. coli celler for rAAV9 DNA transformation for at minimere uønsket ITR rekombination.
  2. Løftpositiv klon fra de transformerede E. coli-celler. Forstærke kultur i 500 ml Lilly-Barnett medium og udtrække rAAV9 plasmid fra bakteriecellerne 25-30.
    BEMÆRK: Midi / Maxi prep rAAV9 plasmid for at opnå en høj mængde DNA (> 100 ug). Før generering af virus, altid analysere sekvensen integritet AAV plasmider ved restriktionsspaltning og agarosegelelektroforese, som tidligere beskrevet (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).

2. Transfektion af HEK293 celler med rAAV9 plasmider

  1. Forberede 1 pg / pl af lineær polyethylenimin (PEI) opløsning. PEI Pulveret opløses i endotoksin-frit dH2O som er blevet opvarmet til 70-80 ° C. Efterkøling ned til stuetemperatur, neutraliseres opløsningen til pH 7,0 med 1 M HCI. Filtersteriliser (0,22 um) opløsningen. Alikvot 1 pg / pl PEI stamopløsning (1400 pi / rør) og gemme solution ved -20 ° C.
  2. Kultur HEK293-celler i Dulbeccos modificerede Eagle-medium (DMEM) med 10% kalvefosterserum (FBS) og 1% penicillin / streptomycin. Dyrke cellerne i et 37 ° C inkubator med 5 ± 0,5% carbondioxid (CO 2).
  3. På dag 0, plade HEK293-celler i ti 150 mm skåle 18-20 timer før transfektion ved at opdele> 90% konfluerende celler i en 1: 2 fortynding.
    BEMÆRK: På dag 1, bør cellerne når 90% konfluens.
  4. På dag 1, transfektion HEK293 celler med rAAV9 plasmidet (f.eks rAAV9.cTNT :: GFP eller rAAV6.U6 :: shRNA konstruerer), Ad-Hjælper-plasmid, og AAV-Rep / Cap-plasmidet ved hjælp PEI 25,26,29.
    1. For 10 retter af celler ved 90% konfluens, bland 70 ug AAV-Rep / Cap plasmid, 70 ug pf rAAV9 plasmid, og 200 ug af Ad-hjælpe-plasmid i et 50-ml centrifugerør.
    2. Hvis cellerne er mindre sammenflydende, justere DNA beløb proportionalt. For eksempel, hvis cellerne er ved 75% sammenflydende, reducereDNA beløb proportionalt (75/90 af det beløb, der er vist i trin 2.4.1): bland 70 x 75/90 = 58,3 ug AAV-Rep / Cap-plasmid, 70 x 75/90 = 58,3 ug rAAV9 plasmid, og 200 x 75/90 = 166,7 ug Ad-hjælpe-plasmid i et 50-ml centrifugerør.
    3. Tilsættes 49 ml RT DMEM (uden FBS) til 50-ml rør og bland godt.
    4. Tilføj 1.360 pi PEI-opløsning for at gøre PEI: DNA-forhold (volumen / vægt) være 4: 1. Bland godt. Inkuber ved stuetemperatur i 15 - 30 min.
    5. Der tilsættes 5 ml af blandingen fremstillet i trin 2.4.4 til hver 150-mm-skål (50 ml af blandingen i ti 150 mm skåle).
  5. Dyrke cellerne i et 37 ° C inkubator med 5 ± 0,5% CO2 i 60-72 timer.

3. Høst af transficerede HEK293 Celler og oprensning af rAAV9 Vektorer

  1. Cellerne høstes 60-72 timer efter transfektion. Løsne og suspendere cellerne i skålene ved pipettering op og ned med dyrkningsmediet. Overføre alle cellesuspensionerne til sterile50-ml rør.
  2. Centrifugeres cellerne ved 500 x g i 5 min. Resuspender cellepelleten med 5 ml PBS i hvert rør og kombinere alle cellesuspensionerne i én 50 ml rør.
  3. Centrifugeres cellerne ved 500 x g i 5 min. Supernatanten kasseres. I dette trin opbevares cellepelleten ved -80 ° C eller umiddelbart oprense AAV fra pelleten, som beskrevet i trin 3.4-3.15.
  4. Forbered lysisbuffer: 150 mM NaCl og 20 mM Tris-HCI, pH 8,0. Filtersteriliser (0,22 uM). Opbevar buffer ved 4 ° C.
  5. Pellet resuspenderes med 10 ml lysepuffer.
  6. Frys lysatet ved -80 ° C eller i tøris / ethanol-bad, derefter tø det ved 37 ° C. Vortex i 1 min. Frys og tø lysatet 3 gange.
  7. Tilføj MgCl2-opløsning til den optøede lysat (foretage den endelige koncentration af MgCl2 i lysatet være 1 mM). Tilsæt nuclease til en slutkoncentration på 250 U / ml. Der inkuberes ved 37 ° C i 15 minutter for at opløse DNA / protein AGGRdelegeringsaftaler.
    BEMÆRK: Hvis DNA / protein sammenlægning ikke bliver opløst efter nuklease eller endonuklease behandling, Dounce homogenisere lysaterne 20 gange.
  8. Centrifugeres prøven ved 4.800 xg i 20 minutter ved 4 ° C. Opsaml supernatanten.
  9. I mellemtiden forbereder iodixanol gradient løsning:
    1. Forbered 17% af gradienten ved at blande 5 ml 10x PBS, 0,05 ml 1 M MgCl2, 0,125 ml 1 M KCI, 10 ml 5 M NaCl og 12,5 ml ofdensity gradient medium. Juster det samlede volumen til 50 ml ved anvendelse H 2 O.
    2. Forbered 25% opløsning ved at blande 5 ml 10x PBS, 0,05 ml 1 M MgCl2, 0,125 ml 1 M KCI, 20 ml densitetsgradient medium, og 0,2 ml 0,5% (vægt / volumen) Phenol Red. Juster det samlede volumen til 50 ml ved anvendelse H 2 O.
    3. Forbered 40% opløsning ved at blande 5 ml 10x PBS, 0,05 ml 1 M MgCl2, 0,125 ml 1 M KCI, og 33,3 ml af densitetsgradient-medium. Juster det samlede volumen til 50 ml under anvendelse afH 2 O.
    4. Forbered 60% opløsning ved at blande 0,05 ml 1 M MgCl2, 0,125 ml 1 M KCl, 50 ml densitetsgradient medium og 0,1 ml 0,5% (vægt / volumen) phenolrødt.
  10. Med en nål og sprøjte, indlæse iodixanol gradient opløsning ind polypropylenrøret i størrelsesordenen 5 ml 17%, 5 ml 25%, 5 ml 40% og 5 ml 60%, startende fra bunden. Indlæse alle lysatet opnået fra trin 3.8 (14-16 ml) på toppen af ​​gradienten. Gradienten, opført fra bunden til toppen, er 60%, 40%, 25%, 17%, og lysatet lag. Fyld glasset med lysisbuffer og dække det med proppen.
  11. Centrifuger ved 185.000 xg i 90 min ved 16 ° C.
  12. Høst den virale fraktion (40% layer) med en sprøjte. Stik nålen (21 gauge) i skæringspunktet mellem 40% og 60% fraktioner, kun opsugning af 40% laget.
    BEMÆRK: Undgå opsugning NOGEN af de 25% lag.
  13. Bland den virale fraktion med steriliseret polyoxyethylen-polyoxypropropylen-blokcopolymer PBS-opløsning (10% polyoxyethylen-polyoxypropylen-blokcopolymer stamopløsning 1: 10.000 fortyndet i PBS) op til et samlet volumen på 15 ml. Indlæse blandingen i filterrøret (cut-off MW = 100 kD). Centrifuger ved 2.000 xg i 30 minutter ved 4 ° C.
  14. Kassér opløsningen ved bunden. Refill filterrøret med polyoxyethylen-polyoxypropylenblokcopolymer PBS-opløsning til et samlet volumen på 15 ml. Centrifuger ved 2.000 xg i 20 min ved 4 ° C. Gentag dette trin to gange mere. Opsaml oprenset rAAV9 virus (fraktionen over filter).
  15. Overfør oprenset rAAV9 i filterrøret til 1,7-ml rør. Alikvot det oprensede rAAV9 (100 - 400 pl / rør, afhængigt af mængden og titer af AAV) og opbevares virus ved -80 ° C.
    BEMÆRK: Undgå gentagne fryse-thaws.

4. Måling af titeren af ​​rAAV9

  1. Forbered standard DNA-prøver.
    1. Design specifik og effektiv PCRprimere til rAAV9 vektorer og optimere PCR tilstand.
      BEMÆRK: De primere, der anvendes i denne undersøgelse, er "Fremad: TCGGGATAAAAGCAGTCTGG; Reverse: TCGGACGGAGATACGTGAGT". PCR-reaktionen blev udført med følgende betingelser: indledende denaturering ved 95 ° C i 3 min; 35 cykler ved 95 ° C i 20 sek, 60 ° C i 15 sek og 72 ° C i 10 sek; og den endelige forlængelse ved 72 ° C i 10 min. Men de optimerede primere og PCR-betingelserne er plasmid-specifikke, som det indsatte sekvens i rAAV9 vektor kan påvirke specificiteten og effektiviteten af PCR 31.
    2. Udfør PCR-reaktion med de i trin 4.1.1 betingelser. Oprense PCR-produktet med en gelekstraktionskit.
    3. Måle koncentrationen af ​​oprenset DNA ved anvendelse af et spektrofotometer. Beregn koncentrationen DNA molekylære tal baseret på molekylvægten / længde af PCR-produktet.
      1. Beregn den molekylære koncentration ved hjælp af følgende ligning: molecular koncentration (DNA-molekyler eller fragmenter / ml) = 6.23 x 10 23 mol -1 x Con. x 10 -6 / MW. Bemærk: (6.23 x 10 23 mol -1 er Avagadro nummer, Con .: DNA-koncentration i mg / ml; MW .: molekylvægt i g / mol). For eksempel, hvis den opnåede koncentration af PCR-produktet er 100 ug / ml og dens længde er 200 bp, molekylvægten af ​​det dobbeltstrengede DNA er 2 x 200 x 310 = 124.000 (den gennemsnitlige molekylvægt af hvert nukleotid i enkeltstrenget DNA er ca. 310 g / mol). Den molekylære koncentration (DNA-molekyler / ml) = 6.23 x 10 23 mol -1 x 100 ug / ml x 10 -6 / 124.000 g / mol = 5,18 x 10 14 DNA molekyler / ml.
      2. Udfør en fortyndingsrække af DNA-fragmentet og forberede standardprøver, med koncentrationer på 10 13 molekyler / ml, 10 12 molekyler / ml, 10 11 molekyler / ml, 10 10 molekyler / ml, 10 9 molekyler / ml, 10 7 molekyler / ml. Brug 1 pi løsning for hver standard prøve til kvantitativ PCR (qPCR, i trin 4.6).
  2. Bland 5 pi oprenset rAAV9 opløsning med 5 eliter 10X DNAse-buffer, 1 pi DNAse (10.000 U / ml), og 39 pi Hedeselskabet 2 O. Det samlede rumfang bør være 50 pi.
  3. Inkuber hætteglasset ved 37 ° C i 30 minutter for at fjerne resterende uemballeret plasmid-DNA.
  4. Inaktivere DNAse ved 95 ° C i 10 min. Afkøle opløsningen, tilsættes 44 pi H2O, 5 pi 10x DNAse buffer og 1 pi proteinase K bestand (10 mg / ml).
  5. Inkuber opløsningen ved 50 ° C i 2 timer. Reaktionen standses og inaktivere proteinase K ved 95 ° C i 10 min.
  6. Brug 1 ml af prøven til kvantitativ PCR (qPCR) assay. Beregn titeren.
    1. Kør kvantitativ PCR (qPCR) med primere designet i trin 4.1.1 ved hjælp af prøver from trin 4.1.4 (standard prøver) og fra trin 4.5 (prøver, der skal måles).
      1. For hver reaktion, blande 10 pi 2x Green mester mix (indeholdende Taq-polymerase, dNTP-blanding, puffer, MgCl2, og grønt farvestof), 0,5 pi fremadrettet primer (5 pM), 0,5 pi revers primer (5 pM), 8 pi H2O, og 1 pi af prøven, der skal måles. Udfør qPCR med følgende betingelser: Hold prøverne ved 50 ° C i 2 minutter og 95 ° C i 10 min; udføre 40 cykler ved 95 ° C i 15 sekunder og ved 60 ° C i 1 min; for smelten fase, inkuberes prøverne ved 95 ° C i 30 sek og 60 ° C i 15 sek. Generer standardkurven baseret på C T numrene på de standard prøver (Figur 3).
    2. Beregn den molekylære koncentration / titer af AAV prøven mod standardkurven. Den rAAV9 har en enkeltstrenget DNA-genom, så den molekylære koncentration vil være 2 gange højere end denberegnet værdi (2x effekt (10, y), figur 3B). Desuden vil titeren af ​​det oprensede rAAV9 være 20 gange højere end det, der opnås fra beregningen grundet fortyndet 1:20 viruset i DNAse og proteinase K-reaktioner (5 pi i 100 pi alt).

5. rAAV9 Injektion i neonatale mus og Gene Expression Analyser i hjertet

  1. Forbered rAAV9 arbejder løsninger i polyoxyethylen-polyoxypropylenblokcopolymer PBS løsning. Gør virusstamopløsningen med titere på 1-7 x 10 12 partikler / ml.
    BEMÆRK: Lever 50-70 pi rAAV9 EDTA i hvert postnatal dag 0,5-1,5 mus ved subkutan injektion. For at opnå en effektiv gen overekspression eller knockdown, anbefales det at udføre en pilottest for hver undersøgelse for at optimere mængden af ​​indsprøjtet AAV. Brug den samme mængde rAAV9.cTNT :: Luc eller rAAV9.U6 :: kapløbet kontroller for hver undersøgelse for at minimere bias.
    BEMÆRK: Vi brugte 1-1,5x 10 11 partikler / pup til overekspression og 2.5 - 5 x 10 11 partikler / pup for knockdown i postnatal dag 0,5-1,5 mi ce).
  2. Forkæl neonatale mus med rAAV9 på P0.5-P2.5 ved subkutan injektion.
    1. Pre-fylde en 29G1 / 2, 0,33 x 12,7 mm insulinsprøjte med rAAV9 løsning. Vær omhyggelig med at fjerne luftbobler.
    2. Hold kryo-bedøvet pup i den ene hånd med tommel og pegefinger. Før injektion stryge bagsiden hud pup med en vatpind mættet med 70% isopropylalkohol til at opretholde den sterile tilstand. Stik kanylen ind i anterior-dorsale underhud af dyret i en vinkel på 5 til 10 °. Injicer 50-70 pi af rAAV9 opløsning under anvendelse af insulinsprøjte.
      BEMÆRK: rAAV9 kan også leveres til mus via intraperitoneal eller intravenøs injektion 26,27. kan opnås effektiv ekspression af de leverede gener i hjertet. Imidlertid intraperitoneal injicereion undertiden kan resultere i utætte ekspression i leveren. Efter injektion blev tilstanden af ​​ungerne overvåget hver dag.
  3. Kan overvåges niveauet af genekspression i hjertet med qPCR, immunofluorescens eller Western blot (repræsentative resultater er vist i figur 4 og 5) 25,26.
    BEMÆRK: Mus blev aflivet ved CO2 leveret fra en komprimeret gaskilde. Vævsprøver blev opsamlet efter bekræftelse af, at pulsen, bevægelse og vejrtrækning af dyrene var ophørt. Neonatale gnavere er resistente over for CO 2 eutanasi og blev aflivet ved halshugning hjælp skarp saks. Metoden er i overensstemmelse med anbefalingerne fra Panel om Eutanasi af American Veterinary Medical Association.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Strategierne for rAAV9 konstruktion af rAAV9.cTNT :: GFP eller rAAV9.U6 :: shRNA plasmider er vist i figur 1 og 2, henholdsvis. Som eksemplerne blev rAAV9 vektor genereret til at overudtrykke GFP-genet i mus hjerter. Det resulterende plasmid indeholder cTnT :: GFP-kassette flankeret af to ITR steder (figur 1). Den rAAV9.U6 :: shRNA vektoren blev konstrueret til knockdown Trbp mRNA (figur 2)

Standardkurven for rAAV9 titrering er blevet til med qPCR data ved lineær regression. Det manipulerede variable y repræsenterer log 10 -værdien af DNA molekylær koncentration af hver standard prøve, og den tilsvarende variabel x er den C-værdien. Log10 (koncentration) værdier (y) og C T numre (x) udviser en pæn lineær korrelation (R 2 = 0,9971) og passer med ligningen y = -0.2832x + 14,616 (figur 3A). Titere af rAAV9 prøver blev beregnet baseret på lineære ligning (figur 3B). Med den beskrevet i protokollen (trin 4.6.2 og figur 3B) metode, en høj titer af rAAV9 vektorer (50-200 pi,> 6 x 10 13 partikler / ml) blev opnået i den repræsentative undersøgelse.

For at overvåge effektiviteten og væv specificitet rAAV9.cTNT vektorer blev P0.5 hvalpe behandlet med samme mængde (1 x 10 11 partikler / pup) af rAAV9.cTNT :: Luciferase (AAV-Luc) eller rAAV9.cTNT :: GFP (AAV-GFP) ved subkutan injektion. To uger efter injektion blev GFP signal overvåges i forskellige væv fra musene. Robust ekspression af GFP blev påvist i hjertet, men ikke i andre organer (figur 4, n> 3). Således blev effektiv og hjerte-specifik genekspression opnået med rAAV9.cTNT vektoren.

jove_content "fo: holde-together.within-side =" 1 "> For at overvåge knockdown effektivitet og væv specificitet rAAV9.U6 vektorer blev P0.5 mus behandlet med samme mængde (3 x 10 11 partikler / pup) af rAAV9 .U6 :: Scramble (AAV-Scramble) eller rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) ved subkutan injektion. To uger efter injektion, ekspression af Trbp i forskellige væv blev overvåget ved qPCR (figur 5, n = 3 ). mRNA niveauet Trbp i hjertet blev væsentligt reduceret med rAAV9.U6 :: shTrbp (68% nedregulering, P = 0,0004452). nedregulering af Trbp blev også påvist i levervæv fra rAAV9.U6 :: shTrbp-behandlet mus. Men ændringen er meget lavere.

figur 1
Figur 1: Strategier til Konstruer rAAV9.cTNT :: GFP plasmid. (A) Ordningen af cTnT :: GFP-kassette. (B TNNT2 promoteren (rAAV9.cTNT) efterfulgt af de to unikke restriktionssteder (Nhel og Kpnl). GFP åbne læseramme blev klonet i rAAV9.cTNT vektoren ved restriktionssite-medieret ligering for at generere rAAV9.cTNT :: GFP plasmid. (B) The rAAV9.cTNT :: GFP plasmid kan konstrueres ved Gibson samling. Klik her for at se en større version af dette tal.

Figur 2
Figur 2: Strategier til Konstruer rAAV9.U6 :: shRNA plasmid. (A) Ordningen af U6 :: vises shRNA kassette. Ekspression af shRNA drives af U6 promotoren (blå). (B) rAAV9-U6-shRNA kassetter kan genereres ved annealing og ligering DNA oligoer indeholderING shRNA sekvenser i restriktionsenzymet-fordøjet rAAV9 vektorer indeholdende U6 promotoren. (C) rAAV9.U6 :: shRNA kassetter kan genereres af langtrækkende PCR og intra-molekylær Gibson montage-baserede "sømløs" konstruktion. 5'-armen, loop, og 3'-armen af ​​shRNA er vist i grøn, orange og rød, hhv. Klik her for at se en større version af dette tal.

Figur 3
Figur 3: Beregning af rAAV9 titer. (A) Standardkurven for rAAV9 titrering blev genereret ved lineær aggression hjælp af qPCR data. Det manipulerede variable y repræsenterer log 10 -værdien af DNA molekylær koncentration af hver standard prøve, og den tilsvarende variabel xrepræsenterer C-værdien. (B) Titre på rAAV9 prøver beregnes baseret på den lineære ligning af standardkurven. Klik her for at se en større version af dette tal.

Figur 4
Figur 4: Ekspression Mønster af rAAV9.cTNT :: GFP i mus Væv. P0.5 unger blev behandlet med samme mængde (1 x 10 11 partikler / pup) af rAAV9.cTNT :: Luciferase (AAV-Luc, negativ kontrol) eller rAAV9.cTNT :: GFP (AAV-GFP) ved subkutan injektion. To uger efter injektion blev Vævsprøverne høstet. Ekspression af GFP blev overvåget under en fluorescerende dissektion anvendelsesområde. Både lyse felt og fluorescens billeder præsenteres. Forsøgene er blevet gentaget mere end 3 gange (n> 3).Scale bar = 2,0 mm. SKM, skeletmuskel. Klik her for at se en større version af dette tal.

Figur 5
Figur 5: Knockdown Gene Expression med AAV-shRNA. P0.5 mus blev behandlet med den samme mængde (3 x 10 11 partikler / pup) af rAAV9.U6 :: scramble (AAV-Scramble) eller rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) ved subkutan injektion. To uger efter injektion blev mRNA-niveauer af Trbp i forskellige væv overvåget ved qPCR (n = 3). Data er præsenteret som middelværdi ± SEM. Cut-off P-værdi er 0,05. NS, P> 0,05, ikke signifikant. **, P <0,01. SKM, skeletmuskel. Klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Det er vigtigt at minimere uønsket ITR rekombination under plasmidkonstruktion. Før generering viruset, skal man altid overvåge ITR integritet AAV plasmider ved hjælp restriktionsfordøjelse og agarosegelelektroforese. Det er umuligt at opnå 100% intakte plasmider, men rekombinationen forholdet bør minimeres så meget som muligt. Mindre end 20% er acceptabel for en vellykket rAAV9 emballage. Af note, kan dyrkning af bakterierne ved lavere temperatur (30 ° C) med en lavere rystehastighed (180-200 rpm) reducere risikoen for ITR rekombination.

Det er vigtigt at sikre, at de HEK293-celler er sunde for vellykket transfektion og rAAV9 emballage. "Sund" celler er normalt meget proliferativ og vokser hurtigt. Men hurtig spredning og vækst af HEK293 celler ikke nødvendigvis sikre den høje effektivitet rAAV9 emballage. Således er det vigtigt at starte eksperimenterne med friske celler. Detanbefales at bruge lav-passage HEK293-celler (<10 passager cellerne passeret hver 2-3 dage) for rAAV9 emballage. Af note, kan andre serotyper af rAAV skal oprenses ved anvendelse af forskellige procedurer 32.

Investigator gives fleksibilitet i frembringelsen af ​​rAAV9 plasmider. Enten restriktionssite-medieret ligering eller Gibson samling kan anvendes 30. På rAAV9.U6 :: shRNA konstruktion, intra-molekylære Gibson montage-baseret strategi er en effektiv metode (figur 1 og 2). Flere AAV-shRNA plasmider eller fælles AAV-shRNAs hurtigt kan konstrueres. At overudtrykke gener ved anvendelse rAAV9 eksisterer der et størrelse begrænsning for indsatte cDNA-sekvenser. Generelt størrelsen fragmentet mellem ITR'erne skal være mindre end 5 kb 33. Intein-katalyseret protein splejsning kan bruges til at omgå emballage størrelse grænse på rAAV9 vektorer 34.

Andre virale ordnings, herunder retrovirus, lentivirus og adenovirus, er også blevet udviklet og muliggøre fleksibel genmanipulation. Sammenlignet med disse forskellige typer af virale vektorer, rAAV har specifikke fordele: høj effektivitet, høj specificitet, lav genomisk integration sats, minimal immunogenicitet, og minimal patogenicitet. Således er rAAV-baserede genom engineering fremstår som et ideelt værktøj til in vivo genmanipulation.

Tidligere undersøgelser har vist, at rAAV9 system muliggør effektiv ekspression af leverede gener in vivo. Med cTnT (kylling TnnT2) promotor, blev hjerte-specifik genekspression opnået (figur 4) 25,26. Selv U6 promotoren er ubikvitært aktive i musevæv, en mest slående inhibering af mål-mRNA (Trbp) ved rAAV9.U6 :: shRNA blev observeret i hjertet, men ikke i andre organer (figur 5). Leveren er det mest almindelige organ transduceres af forskellige serotyper afrAAV 35,36. Men den knockdown effektivitet (36% reduktion af mRNA-niveau) i leveren er meget lavere end i hjertet (68% reduktion af mRNA-niveau). Dette er i overensstemmelse med den tidligere undersøgelse, der viser, at der trods højere virale genom tilstedeværelse i leveren, systemisk levering af shRNA af rAAV9 giver mere effektiv gen knockdown i hjertet 35. Det er muligt, at hepatocytter er mere proliferative end cardiomyocytter og er mere aktivt undergår celledeling efter rAAV9 administration på de neonatale aldre, hvilket resulterer i væsentlig vektorgenom fortynding i levervævet. dette tyder imidlertid også, at serotype rAAV9 mere effektivt kan transducere cardiomyocytter i forhold til andre celletyper. Som påvist ved Lovric et al., I differentierede myocytter, er DNA beskadigelse respons MRN komplekse proteiner undertrykt. MRN komplekse proteiner binder AAV genomer og hæmme AAV transduktion gennem transkriptionel lyddæmpning. Således permissivity mod AAV transduktion kan induceres ved den terminale differentiering af cardiomyocytter 36, hvilket gør rAAV9 systemet, sammenligne med andre virale vektorer, meget velegnet til genmanipulation i hjertet. For yderligere at minimere de uønskede Knockdown effekter i andre organer (f.eks leveren), man også kan bruge hjerte-specifikke cTnT promotor-drevet miR-30a-baserede shmiR at undertrykke generne af interesse i hjertet 29. Dette håndskrift giver læseren de specifikke teknikker til at udnytte på rAAV9 teknologi i hjerte-kar-undersøgelser.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Polyethylenimine, Linear (MW 25,000) Polysciences, Inc.  #23966-2
Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56) Beckman Coulter, Inc # 362183
Nuclease, ultrapure SIGMA #E8263-25KU
Density Gradient Medium(Iodixanol) SIGMA #D1556-250ML
Centrifugal Filter Unit with Ultracel-100 membrane EMD Millipore Corporation #UFC910008
Laboratory pipetting needle with 90° blunt ends,gauge 14, L 6 in., nickel plated hub SIGMA #CAD7942-12EA
Poloxamer 188 solution (Pluronic® F-68 solution) SIGMA P5556-100ML
Proteinase K SIGMA 3115828001
DNase I Roche 10104159001
Centrifuge machine Thermo Scientific 75004260
Centrifuge System Beckman Coulter 363118
Ultracentrifuge Beckman Coulter
DMEM medium Fisher Scientific SH30243FS
Fetal Bovine Serum  Atlanta Biologicals               S11150
rAAV9 vector Penn Vector Core P1967

DOWNLOAD MATERIALS LIST

References

  1. Primrose, S. B., Twyman, R. Principles of gene manipulation and genomics. John Wiley & Sons. (2013).
  2. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, 1258096 (2014).
  3. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  4. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  5. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355 (2014).
  6. Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. A versatile tool for conditional gene expression and knockdown. Nat. Methods. 3, 109-116 (2006).
  7. Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. Advances in Gene Delivery Systems. BioMed Res. Int. 2015, 610342 (2015).
  8. Kamimura, K., Suda, T., Zhang, G., Liu, D. Advances in gene delivery systems. Pharm. Med. 25, 293-306 (2011).
  9. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  10. Giacca, M., Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J. Control Release. 161, 377-388 (2012).
  11. Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. Evolving gene therapy approaches for osteosarcoma using viral vectors: review. Bone. 40, 797-812 (2007).
  12. De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).
  13. Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. Retrovirus-mediated gene delivery into male germ line stem cells. FEBS Lett. 475, 7-10 (2000).
  14. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).
  15. Katz, R. A., Greger, J. G., Skalka, A. M. Effects of cell cycle status on early events in retroviral replication. J. Cell. Biochem. 94, 880-889 (2005).
  16. Escors, D., Breckpot, K. Lentiviral vectors in gene therapy: their current status and future potential. Arch. Immunol. Ther. Exp. 58, 107-119 (2010).
  17. Mátrai, J., Chuah, M. K., VandenDriessche, T. Recent advances in lentiviral vector development and applications. Mol. Ther. 18, 477-490 (2010).
  18. Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. Structural dynamics of retroviral genome and the packaging. Front. Microbiol. 2, 1-9 (2011).
  19. Douglas, J. T. Adenovirus-Mediated Gene Delivery. Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. 3-14 (2004).
  20. Armendáriz-Borunda, J., et al. Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration. J. Biosci. Bioeng. 112, 415-421 (2011).
  21. Snyder, R. O. Adeno-associated virus-mediated gene delivery. J Gene Med. 1, 166-175 (1999).
  22. Samulski, R. J., Muzyczka, N. AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014).
  23. Kaplitt, M. G., et al. Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector. Ann. Thorac. Surg. 62, 1669-1676 (1996).
  24. Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. J. Gene. Med. 7, 316-324 (2005).
  25. Ding, J., et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776-783 (2015).
  26. Lin, Z., et al. Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Circ. Res. 115, 354-363 (2014).
  27. Wahlquist, C., et al. Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508, 531-535 (2014).
  28. Carroll, K. J., et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).
  29. Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342, 111-114 (2013).
  30. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  31. Rychlik, W., Spencer, W., Rhoads, R. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Allocca, M., et al. Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J. Clin. Invest. 118, 1955-1964 (2008).
  33. Wu, Z., Yang, H., Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
  34. Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum. Gene Ther. 19, 958-964 (2008).
  35. Piras, B. A., O'Connor, D. M., French, B. A. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver. PLoS One. 8, e75894 (2013).
  36. Lovric, J., et al. Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins. Mol. Ther. 20, 2087-2097 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics