Herstellung von rAAV9 überexprimiert oder Sturz Gene in Mäuseherzen

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Steuern der Expression oder Aktivität von spezifischen Genen durch die myokardiale Abgabe von genetischem Material in murinen Modellen ermöglicht die Untersuchung von Gen-Funktionen. Ihr therapeutisches Potential im Herzen kann auch bestimmt werden. Es gibt nur begrenzte Ansätze für in vivo molekulare Intervention in der Maus Herz. Rekombinante Adeno-assoziierten Virus (rAAV) -basierte Genomtechnik wurde als ein wesentliches Instrument für die in - vivo - Herz Genmanipulation verwendet. Die spezifischen Vorteile dieser Technologie sind hohe Effizienz, hohe Spezifität, geringe genomische Integrationsrate, minimal Immunogenität und minimale Pathogenität. Hier wird ein detailliertes Verfahren zur Konstruktion, zur Verpackung und reinigen die rAAV9 Vektoren beschrieben. Subkutane Injektion von rAAV9 in neonatalen Welpen ergibt robust Expression oder effiziente Knockdown des Gens (e) von Interesse in der Maus Herz, aber nicht in der Leber und anderen Geweben. Mit Hilfe der Herz-spezific TNNT2-Promotor, eine hohe Expression von GFP-Gen im Herzen erhalten. Zusätzlich Ziel-mRNA im Herzen gehemmt wurde, wenn ein rAAV9-U6-shRNA genutzt wurde. Kenntnisse im Umgang mit rAAV9 Technologie kann für kardiovaskuläre Untersuchungen nützlich sein.

Introduction

Steuern Expression oder Aktivität von spezifischen Genen in verschiedenen biologischen Systemen ist eine wertvolle Strategie bei der Untersuchung der Genfunktion 1 geworden. Eine direkte Mittel, um dieses Ziel zu erreichen, ist zu Nukleotid-Sequenzen manipulieren und Mutantenallelen erzeugen. Obwohl machen präzise, ​​gezielte Veränderungen des Genoms von lebenden Zellen ist noch eine zeitaufwendige und arbeitsintensive Praxis, die Entwicklung der mächtigen TALEN und CRISPR / Cas9 Tools hat eine neue Ära der Genom Bearbeitung 2-5 geöffnet. Eine Routinelaborverfahren zur Genmanipulation hat sich auf die Einführung von genetischem Material (DNA und RNA - kodierenden Sequenzen oder siRNAs / shRNAs enthält) fokussiert in die Zellen , die das Gen (e) von Interesse 1,6 zum Ausdruck bringen oder Knockdown.

In vielen Fällen ist der Haupt Engpass für Genmanipulation die Abgabe von DNA, RNA oder Protein in die Zellen. Im Hinblick auf die in vitro - Studien, effiziente transfectiauf Systeme wurden in vielen kultivierten Zellinien etabliert. Im Mausmodell ist jedoch, insbesondere in vivo Genübertragung anspruchsvoller. Es gibt eine Reihe extra- und intrazelluläre Barrieren, um umgangen werden müssen effiziente zelluläre Aufnahme der exogenen Reagenzien zu erreichen. Weitere Hindernisse sind die schnelle Clearance und die kurze Dauer der 7,8 gelieferten Materialien. Eine Strategie , um diese Probleme zu umgehen , ist die virale Vektoren als "Träger" zu verwenden oder "Vehikel" für in vivo - Genübertragung. Die natürlich entwickelte Transduktionseigenschaften von Viren ermöglichen die effiziente Bereitstellung eines Gens von Interesse in Zellen 7,9,10. Zahlreiche Arten von viralen Vektoren wurden in vivo Genmanipulation in verschiedenen Zelltypen und Organe in Mäusen entwickelt und flexible ermöglichen.

Die am häufigsten verwendeten viralen Systeme umfassen Retrovirus, Lentivirus, Adenovirus und Adeno-assoziiertes Virus (AAV) 12-14 ihres genetischen Materials in die Wirtszellgenom einzuführen. Viele Arten von Retroviren jedoch infizieren nur sich teilende Zellen, und ihre Wirksamkeit in sich nicht teilende Zellen ist sehr gering 15. Dies schränkt ihre Nützlichkeit für den Gentransfer. Lentivirus ist eine Gattung der Retroviridae Familie. Unterscheidet sich von anderen Retroviren, Lentivirus kann infizieren sowohl Dividieren und nicht teilende Zellen und wurde für den Gentransfer in post-mitotische und hochdifferenzierten Zellen 16 verwendet. Der Lebenszyklus von Lentivirus beinhaltet auch die Integration von Vektor-DNA in das Wirtsgenom. Somit ermöglicht Lentivirus-vermittelte Genabgabe stabile und langzeitige Expression der transduzierten genetischen Elemente 16-18. Jedoch kann dieses Merkmal eine Doppel e darstellendged Schwert in der Verwendung dieser Viren die Genexpression zu manipulieren, da die Integration von Vektor-DNA zur Insertionsmutagenese führen in den Wirtszellen und können artifizielle Wirkungen verursachen. Adenovirus ist ein weiteres weit verbreitetes Genabgabesystem. Im Gegensatz zu Retroviren und Lentiviren, Adenoviren sind nicht integriert und nicht mit der genomischen Integrität von Wirtszellen 8,10,11,19 stören. Zusätzlich können Adenoviren DNA in viele Zelltypen zu transfizieren, und die Infektion ist nicht abhängig von aktiven Zellteilung 19. Ein weiteres wichtiges Merkmal von Adenoviren ist die Leichtigkeit der Vektor Reinigung, da die viralen Vektoren haben die Fähigkeit , 19,20 repliziert werden. Allerdings ist der Haupt Einschränkung dieses Systems , dass Adenovirus - Infektion 19 starke Immunantworten in Zielzellen und Organen auslösen können, deren Verwendung in vielen Untersuchungen beschränken, insbesondere in Gentherapiestudien.

Im Vergleich zu diesen anderen Typs von viralen Vektoren, rekombinante Adeno-assoziierte Virus (rAAV) scheint die ideale Genabgabesystem 21,22 sein. Es zeigt minimale Immunogenität und Pathogenität 23,24. Darüber hinaus infiziert rAAV ein breites Spektrum von Zelltypen, einschließlich sowohl Unterteilungs- und nicht teilende Zellen. In den meisten Fällen ist nicht rAAV in Wirtsgenome integriert; Somit ist die Gefahr einer unerwünschten genetischen oder genomischen Veränderungen in den Zielzellen gering 22.

In jüngster Zeit wurden rAAV - Systeme wurden für die in vivo Abgabe von DNA , die für Proteine, miRNAs, shRNAs und CRISPR-gRNAs in Maus Herzmuskel 23,25-29 erfolgreich eingesetzt. Diese Methodik hat erleichtert grundlegenden Untersuchungen und Gentherapie-Studien auf dem Gebiet der Herz-Kreislauf-Forschung. Hier wird die detaillierte Prozedur rAAV9 Vektoren zu erzeugen, die effizient überexprimiert oder die Gene von Interesse in Mäuseherzen Knockdown beschrieben wurde. Das Protokoll bietet eine einfache und effektive Methode,kardialen Genexpression in murine experimentelle Modelle manipulieren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle beschriebenen Schritte wurden unter Protokolle, die von der Kommission für Biosicherheit und der Institutional Animal Care und Use Committee von Boston Kinderkrankenhaus zugelassen durchgeführt. Boston Kinderkrankenhaus hat pathogen-freie Maus Einrichtungen mit geregelten Hell / Dunkel-Zyklen und Klimaanlagen. Veterinärwesen und Tierpflegepersonal Käfige ändern und die Gesundheit der Mäuse zu gewährleisten. Die Einrichtungen sind AAALAC zertifiziert und haben aktive Tierschutzsicherung Zertifizierung (AAALAC Akkreditierung erteilt am 1992.02.24 Animal Welfare Assurance Nummer:. A3303-01). Mäuse wurden durch CO 2 aus einer Druckgasquelle geliefert euthanasiert. Gewebeproben wurden gesammelt, nachdem dass die Herzfrequenz, Bewegung bestätigt, und die Atmung der Tiere aufgehört hatte. Neonatal Nagetiere sind resistent 2 Euthanasie zu CO und wurden durch Enthauptung mit einer scharfen Schere eingeschläfert. Diese Verfahren sind im Einklang mit den Empfehlungen des Gremiums für Euthanasie von der American Veterinary Medical Association.

1. Erzeugung von rAAV9 Konstrukten durch eine cDNA oder shRNA Expressionskassette in das Plasmid Backbone Cloning

HINWEIS: Das rAAV9 Plasmid, das invertierte terminale Wiederholungen (ITRs) von AAV 2 enthält, für Genüberexpression verwendet wurde modifiziert, um das Huhn TNNT2 zum Hafen Promotor (rAAV9.cTNT), die 25,26,29 Kardiomyozyten-spezifische Expression von transduzierten Genen ermöglicht. Einzigartige NheI und KpnI-Stellen wurden in das Plasmid stromabwärts des Promotors eingeführt. Die cDNA - Fragmente , die die Gene von Interesse kodieren , können in das rAAV9 Rückgrat diese beiden Restriktionsstellen 25,26,29 mit geklont werden. Hier wird als Beispiel die rAAV9 Vektor für die Überexpression des GFP-Gens in Mäuseherzen wurde erzeugt. Das resultierende Plasmid enthält das cTnT :: GFP - Kassette flankiert von zwei ITR Stellen (Abbildung 1). rAAV9.U6 :: shRNA Konstrukte wurden für Knock-Down 25 verwendet. Design-shRNAs mitOnline-shRNA-Design-Servern. rAAV9.U6 :: shRNA kann entweder durch Glühen und Ligieren DNA-Oligos haltigen shRNA-Sequenzen in die Restriktionsenzym-verdaute rAAV9 Vektoren beherbergen die U6-Promotor oder durch Langstrecken-PCR und intramolekulare Gibson Montage-basierte "nahtlos" erzeugt werden Bau 30. Das resultierende Plasmid sollte die U6-shRNA Kassette durch zwei ITR Seiten (Figur 2) flankiert enthalten. Hier wird als Beispiel die rAAV9.U6 :: shRNA Vektor wurde konstruiert TRBP mRNA (TRBP shRNA-Sequenz: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG) zum Knockdown. Ein Gerangel shRNA wurde als negative Kontrolle (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG) verwendet.

  1. Klonen Sie die cDNA oder shRNA Expressionskassette in das rAAV9 Plasmidbackbone. Wandeln Sie die DNA in kompetente E. coli - Zellen 25.
    HINWEIS: Verwenden Sie stbl2 oder stbl3 E. coli - Zellen für rAAV9 DNA - Transformation unerwünschte ITR Rekombination zu minimieren.
  2. Heb die ... Aufpositiver Klon aus den transformierten E. coli - Zellen. Amplify die Kultur in 500 ml Lilly-Barnett Medium und extrahieren Sie die rAAV9 Plasmid aus den Bakterienzellen 25-30.
    HINWEIS: Midi / Maxi prep die rAAV9 Plasmid, das eine hohe Menge an DNA (> 100 & mgr; g) zu erhalten. Bevor das Virus zu erzeugen, analysieren immer die Sequenzintegrität der AAV-Plasmide durch Restriktionsverdau und Agarose-Gelelektrophorese, wie zuvor beschrieben (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).

2. Transfektion von HEK293-Zellen mit rAAV9 Plasmiden

  1. Bereiten Sie 1 ug / ul von linearen Polyethylenimin (PEI) -Lösung. Auflösen PEI - Pulver in Endotoxin-freiem dH 2 O , das auf 70-80 ° C erwärmt wurde. Nach dem Abkühlen auf RT ab, neutralisiert die Lösung auf pH 7,0 mit 1 M HCl. Filter zu sterilisieren (0,22 & mgr; m) wurde die Lösung. Aliquot der 1 ug / ul PEI-Stammlösung (1400 ul / Röhrchen) und speichern Sie die solutIon bei -20 ° C.
  2. Kultur HEK293-Zellen in Dulbeccos modifiziertem Eagle Medium (DMEM) mit 10% fötalem Rinderserum (FBS) und 1% Penicillin / Streptomycin. Kultur der Zellen in einem 37 ° C Inkubator mit 5 ± 0,5% Kohlendioxid (CO 2).
  3. Am Tag 0, Platte HEK293 Zellen in zehn 150 mm-Schalen von 18-20 Stunden vor der Transfektion durch Spaltung> 90% konfluenten Zellen in einer 1: 2 Verdünnung.
    HINWEIS: Am Tag 1 sollten die Zellen 90% Konfluenz erreichen.
  4. Am Tag 1, transfizieren HEK293 - Zellen mit dem rAAV9 Plasmid (zB rAAV9.cTNT :: GFP oder rAAV6.U6 :: shRNA Konstrukte), Ad-Helferplasmid und AAV-Rep / Cap - Plasmid unter Verwendung von PEI 25,26,29.
    1. Für 10 Gerichte der Zellen bei 90% Konfluenz, 70 & mgr; g in einem 50-ml-Zentrifugenröhrchen AAV-Rep / Cap-Plasmid, 70 & mgr; g pf rAAV9 Plasmid und 200 ug Ad-Helferplasmid mischen.
    2. Wenn die Zellen weniger konfluent sind, proportional angepasst werden die DNA-Menge. Zum Beispiel, wenn die Zellen bei 75% konfluent sind, reduzieren dieDNA-Menge proportional (75/90 der Menge in Schritt gezeigt 2.4.1): mix 70 x 75/90 = 58,3 ug AAV-Rep / Cap Plasmid, 70 x 75/90 = 58,3 ug rAAV9 Plasmid und 200 x 75/90 = 166,7 & mgr; g Ad-Helferplasmid in einer 50-ml-Zentrifugenröhrchen.
    3. In 49 ml RT DMEM (ohne FBS) auf die 50-ml-Tube und gut mischen.
    4. In 1360 ul PEI-Lösung, um das PEI machen: DNA-Verhältnis (v / w) sein 4: 1. Gut mischen. bei RT inkubieren 15 - 30 min.
    5. 5 ml des Gemisches hergestellt in Schritt 2.4.4 auf jede 150-mm-Schale (50 ml des Gemisches für zehn 150 mm-Schalen).
  5. Kultur der Zellen in einem 37 ° C Inkubator mit 5 ± 0,5% CO 2 für 60-72 Std.

3. Ernte von HEK293 Zellen und Reinigung von rAAV9 Vektoren

  1. Ernten Sie die Zellen 60-72 h nach der Transfektion. Vertreiben und die Zellen in den Gerichten aussetzen durch Auf- und Abpipettieren mit dem Kulturmedium. Übertragen Sie alle Zellsuspensionen in sterile50-ml-Röhrchen.
  2. Zentrifugieren der Zellen bei 500 xg für 5 min. Zellpellet mit 5 ml PBS in jedes Röhrchen und kombinieren die alle Zellsuspensionen in ein 50-ml-Tube.
  3. Zentrifugieren der Zellen bei 500 xg für 5 min. Überstand verwerfen. Bei diesem Schritt speichert das Zellpellet bei -80 ° C oder unmittelbar die AAV aus dem Pellet zu reinigen, wie 3,4 bis 3,15 in Schritten beschrieben.
  4. Vorbereitung der Lysepuffer: 150 mM NaCl und 20 mM Tris-HCl, pH 8,0. Filter zu sterilisieren (0,22 uM). Lagern Sie den Puffer bei 4 ° C.
  5. Das Pellet mit 10 ml Lyse-Puffer.
  6. Frieren Sie das Lysat bei -80 ° C oder in Trockeneis / Ethanol-Bad, dann Tauwetter es bei 37 ° C. Vortex für 1 min. Einfrieren und Auftauen des Lysats 3 mal.
  7. In MgCl2 Lösung des aufgetauten Lysats (machen die endgültige Konzentration von MgCl 2 in dem Lysat sein 1 mM). Fügen Sie die Nuklease zu einer Endkonzentration von 250 U / ml. für 15 min bei 37 ° C inkubieren, um die DNA / Protein aggr aufzulösenegation.
    HINWEIS: Wenn die DNA / Protein-Aggregation nicht nach Nuklease oder Endonuklease Behandlung gelöst bekommt, Dounce homogenisieren die Lysate 20-mal.
  8. Zentrifugieren Sie die Probe bei 4.800 × g für 20 min bei 4 ° C. Sammeln Sie den Überstand.
  9. Unterdessen bereiten die Iodixanol Gradienten-Lösung:
    1. Bereiten Sie die 17% des Gradienten durch Mischen von 5 ml 10 × PBS, 0,05 ml 1 M MgCl 2, 0,125 ml 1 M KCl, 10 ml 5 M NaCl und 12,5 ml ofdensity Gradienten Medium. Einstellen das Gesamtvolumen auf 50 ml mit H 2 O.
    2. Bereiten Sie die 25% ige Lösung durch Mischen von 5 ml 10 × PBS, 0,05 ml 1 M MgCl 2, 0,125 ml 1 M KCl, 20 ml Dichtegradientenmedium, und 0,2 ml von 0,5% (w / v) Phenol Red. Einstellen das Gesamtvolumen auf 50 ml mit H 2 O.
    3. Bereiten Sie die 40% ige Lösung durch Mischen von 5 ml 10 × PBS, 0,05 ml 1 M MgCl 2, 0,125 ml 1 M KCl, und 33,3 ml Dichtegradientenmedium. Einstellen das Gesamtvolumen auf 50 ml unter Verwendung vonH 2 O.
    4. Bereiten Sie die 60% ige Lösung durch Mischen von 0,05 ml von 1 M MgCl 2, 0,125 ml 1 M KCl, 50 ml Dichtegradientenmedium, und 0,1 ml von 0,5% (w / v) Phenol Red.
  10. Mit einer Nadel und Spritze, laden die Iodixanol Gradientenlösung in die Polypropylenröhrchen in der Größenordnung von 5 ml von 17%, 5 ml von 25%, 5 ml 40% und 5 ml von 60%, von unten beginnend. Laden Sie alle aus Schritt erhaltenen Lysat 3,8 (14-16 ml) auf der Oberseite des Gradienten. Der Gradient, von unten nach oben aufgelistet, 60%, 40%, 25%, 17%, und das Lysat Schicht. Füllen Sie das Rohr mit Lysepuffer und decken Sie es mit dem Korken.
  11. Zentrifuge bei 185.000 xg für 90 min bei 16 ° C.
  12. Ernte der viralen Fraktion (40% Schicht) mit einer Spritze. Führen Sie die Nadel (21 Gauge) in die Kreuzung zwischen den 40% und 60% Fraktionen, nur die 40% Schicht abgesaugt.
    HINWEIS: Vermeiden Sie die 25% Schicht abgesaugt.
  13. Mischen Sie die Virus-Fraktion mit sterilisierten Polyoxyethylen-polyoxypropropylen-Blockcopolymer PBS-Lösung (10% Polyoxyethylen-Polyoxypropylen-Blockcopolymer Lager 1: 10.000 in PBS) bis zu einem Gesamtvolumen von 15 ml. Legen Sie die Mischung in das Filterrohr (cut-off MW = 100 kD). Zentrifuge bei 2.000 xg für 30 min bei 4 ° C.
  14. Entsorgen Sie die Lösung an der Unterseite. Nachfüllen des Filterrohr mit Polyoxyethylen-Polyoxypropylen-Blockcopolymer-PBS-Lösung auf ein Gesamtvolumen von 15 ml. Zentrifuge bei 2.000 xg für 20 min bei 4 ° C. Wiederholen Sie diesen Schritt zwei weitere Male. Sammeln Sie die gereinigte rAAV9-Virus (die Fraktion über dem Filter).
  15. Übertragen Sie das gereinigte rAAV9 im Filterrohr auf 1,7-ml-Röhrchen. Aliquot der gereinigten rAAV9 (100-400 & mgr; l / Röhrchen in Abhängigkeit von dem Volumen und Titer des AAV) und Speichern des Virus bei -80 ° C.
    HINWEIS: Vermeiden Sie wiederholte Gefrier-taut.

4. Messung der Titer von rAAV9

  1. Bereiten Sie Standard - DNA - Proben.
    1. Entwerfen Sie spezifische und effiziente PCRPrimer für rAAV9 Vektoren und Optimierung der PCR-Bedingungen.
      HINWEIS: Die Primer, die in dieser Studie verwendet werden, sind "Forward: TCGGGATAAAAGCAGTCTGG; Reverse: TCGGACGGAGATACGTGAGT". Die PCR-Reaktion wurde mit den folgenden Bedingungen durchgeführt: anfängliche Denaturierung bei 95 ° C für 3 min; 35 Zyklen von 95 ° C für 20 sec, 60 ° C für 15 sec, und 72 ° C für 10 sec; und die abschließende Extension bei 72 ° C für 10 min. Jedoch sind die optimierten Primer und PCR - Bedingungen plasmid-spezifisch, da die eingesetzte Sequenz in der rAAV9 Vektor , der die Spezifität und Effizienz der PCR 31 beeinflussen können.
    2. Führen Sie die PCR-Reaktion mit den in Schritt 4.1.1 gezeigten Bedingungen. Reinige das PCR-Produkt mit einem Gel-Extraktions-Kits.
    3. Messen der Konzentration von gereinigter DNA unter Verwendung eines Spektrophotometers. Berechnen der Konzentration der DNA-Molekülzahlen bezogen auf das Molekulargewicht / Länge des PCR-Produkts.
      1. Berechnen Sie die molekulare Konzentration der folgenden Gleichung: momolekulare Konzentration (DNA - Moleküle oder Fragmente / ml) = 6,23 x 10 23 mol -1 x Con. x 10 -6 / MW. Anmerkung: (6.23 x 10 23 mol -1 ist Avogadroschen Number; Con .: DNA - Konzentration in & mgr; g / ml; MW .: Molekulargewicht in g / mol). wenn die erhaltene Konzentration des PCR-Produkts von 100 & mgr; g / ml zum Beispiel ist und seine Länge ist 200 bp, das Molekulargewicht des doppelsträngigen DNA 2 x 200 x 310 = 124000 (das mittlere Molekulargewicht jedes Nukleotid in der einzelsträngige DNA ist etwa 310 g / mol). Die molekulare Konzentration (DNA - Moleküle / ml) = 6,23 X 10 23 mol -1 x 100 & mgr; g / ml x 10 -6 / 124.000 g / mol = 5,18 x 10 14 DNA - Moleküle / ml.
      2. Durchführen einer Verdünnungsreihe des DNA - Fragments und Herstellung der Standardproben mit Konzentrationen von 10 13 Molekülen / ml, 10 12 Molekülen / ml, 10 11 Molekülen / ml, 10 10 Molekülen / ml, 10 9 Moleküle / ml, 10 sup7 ; Moleküle / ml. Verwenden Sie 1 ul Lösung für jede Standardprobe für die quantitative PCR (qPCR, in Schritt 4.6).
  2. Mix 5 & mgr; l gereinigtem rAAV9 Lösung mit 5 ul 10fach DNAse - Puffer, 1 & mgr; l DNAse (10.000 U / ml) und 39 & mgr; l ddH 2 O. Das Gesamtvolumen 50 & mgr; l sein sollte.
  3. Inkubiere die Phiole bei 37 ° C für 30 min Restunverpackten Plasmid-DNA zu entfernen.
  4. Inaktivieren der DNAse bei 95 ° C für 10 min. Die Lösung wird nach unten, fügen Sie 44 ul H 2 O, 5 ul 10x DNAse Puffer und 1 ul Proteinase K Lager (10 mg / ml).
  5. Inkubieren der Lösung bei 50 ° C für 2 Stunden. Stoppen Sie die Reaktion und inaktivieren die Proteinase K bei 95 ° C für 10 min.
  6. Verwenden Sie 1 ul der Probe für die quantitative PCR (qPCR) Assay. Berechnen Sie den Titer.
    1. Führen quantitative PCR (qPCR) mit den entworfenen Primer in Schritt 4.1.1 die Proben fr mitom Schritt 4.1.4 (Standardproben) und aus Schritt 4.5 (Proben gemessen werden).
      1. Für jede Reaktion, Mischungs 10 ul 2x Grün Mastermix (enthaltend Taq - Polymerase, dNTP - Mix, Puffer, MgCl 2 und Grün - Farbstoff), 0,5 & mgr; l Vorwärts - Primer (5 & mgr; M), 0,5 & mgr; l Rückwärts - Primer (5 & mgr; M), 8 & mgr; l H 2 O und 1 ul der Probe gemessen werden. Führen qPCR mit den folgenden Bedingungen: Halten der Proben bei 50 ° C für 2 min und 95 ° C für 10 min; 40 Zyklen bei 95 ° C durchzuführen für 15 sec und bei 60 ° C für 1 min; für die Schmelzstufe, Inkubation der Proben bei 95 ° C für 30 sec und 60 ° C für 15 sec. Generieren Sie die Standardkurve auf der Basis der C T - Nummern der Standardproben (Abbildung 3).
    2. Berechnen Sie die molekulare Konzentration / Titer der AAV Probe gegen die Standardkurve. Die rAAV9 hat einen Einzelstrang-DNA-Genom, so dass die molekulare Konzentration wird 2-fach höher als dieberechneter Wert (2x Leistung (10, y), 3B). Darüber hinaus wird der Titer des gereinigten rAAV9 sein 20-fach höher als das, was bei der Berechnung aufgrund der 1:20 Verdünnung des Virus in DNAse und Proteinase K-Reaktionen (5 & mgr; l in 100 & mgr; l insgesamt) erhalten.

5. rAAV9 Injektion in neugeborenen Mäusen und Gene Expression Assays im Herzen

  1. Bereiten Sie rAAV9 Arbeitslösungen in Polyoxyethylen-Polyoxypropylen-Blockcopolymer PBS-Lösung. Machen Sie den Virusstamm mit den Titern von 1-7 x 10 12 Partikel / ml.
    HINWEIS: 50-70 ul rAAV9 Lösung in jedes postnatalen Tag 0,5-1,5 Maus durch subkutane Injektion liefern. Um eine effiziente Genüberexpression oder Zuschlags zu erreichen, ist es empfehlenswert, einen Pilotversuch für jede Studie durchzuführen, um die Menge des injizierten AAV zu optimieren. Verwenden Sie die gleiche Menge an rAAV9.cTNT :: Luc oder rAAV9.U6 :: Gerangel Kontrollen für jede Studie die Vorspannung zu minimieren.
    HINWEIS: Wir haben 1-1,5x 10 11 Partikel / pup zur Überexpression und 2,5-5 x 10 11 Partikel / Welpe für Zuschlag in postnatalen Tag 0,5-1,5 mi ce).
  2. Behandeln neugeborenen Mäusen mit rAAV9 bei P0.5-P2.5 durch subkutane Injektion.
    1. Vorfüllen eine 29G1 / 2, 0,33 x 12,7 mm Insulinspritze mit der rAAV9 Lösung. Seien Sie vorsichtig, um Luftblasen zu entfernen.
    2. Halten Sie die Kryo-narkotisierten Welpen in einer Hand mit Daumen und Zeigefinger. Vor der Injektion bewegen, um die Rückenhaut des Welpen mit einem Stock Tupfer mit 70% Isopropylalkohol gesättigt, um die sterile Zustand zu halten. Legen Sie die Spritzennadel in die anterior-dorsalen Subkutis des Tieres in einem Winkel von 5 bis 10 °. Injizieren 50-70 ul der rAAV9 Lösung, um die Insulin-Spritze.
      HINWEIS: rAAV9 kann auch über intraperitoneale oder intravenöse Injektion 26,27 an der Maus geliefert werden. Effiziente Expression der gelieferten Gene im Herzen erhalten werden. Allerdings intraperitoneale InjectIonen manchmal in leaky-Expression in der Leber führen. Nach der Injektion wurde der Zustand der Welpen täglich überwacht.
  3. Die Ebene der Genexpression im Herzen kann mit qPCR, Immunofluoreszenz oder Western - Blot überwacht werden 25,26 (repräsentative Ergebnisse sind in den Abbildungen 4 und 5 gezeigt).
    HINWEIS: Die Mäuse wurden durch CO 2 aus einer Druckgasquelle geliefert euthanasiert. Gewebeproben wurden gesammelt, nachdem bestätigt, dass die Herzfrequenz, Bewegung und Atmung der Tiere aufgehört hatte. Neonatal Nagetiere sind resistent 2 Euthanasie zu CO und wurden durch Enthauptung mit einer scharfen Schere eingeschläfert. Das Verfahren ist mit den Empfehlungen des Gremiums für Euthanasie von der American Veterinary Medical Association konsistent.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Die Strategien für die Konstruktion von rAAV9 rAAV9.cTNT :: GFP oder rAAV9.U6 :: shRNA Plasmide sind in den 1 und 2 gezeigt. Wie die Beispiele wurde die rAAV9 Vektor erzeugt, um das GFP-Gen in der Maus Herzen zu überexprimieren. Das resultierende Plasmid enthält das cTnT :: GFP - Kassette flankiert von zwei ITR Stellen (Abbildung 1). Die rAAV9.U6 :: shRNA Vektor wurde konstruiert TRBP mRNA (Figur 2) zu Knockdown

Die Standardkurve für rAAV9 Titration wurde mit dem qPCR Daten durch lineare Regression erzeugt. Die Stellgröße y die Log 10 - Wert von DNA - Molekülkonzentration jeder Standardprobe und die entsprechende Variable x den C T - Wert. Die Log 10 (Konzentration) -Werte (y) und C T Zahlen (x) zeigen eine schöne lineare Korrelation (R 2 = 0,9971) und Sitz mit der Gleichung y = -0.2832x + 14,616 (3A). Titern von rAAV9 Proben wurden auf der Basis der linearen Gleichung (3B) berechnet. Mit dem Verfahren in dem Protokoll beschrieben (Schritt 4.6.2 und 3B), einen hohen Titer von rAAV9 Vektoren (50-200 ul,> 6 x 10 13 Partikel / ml) wurde in der repräsentativen Studie erhalten.

Zu überwachen , wurden die Effizienz und die Gewebespezifität der Vektoren rAAV9.cTNT, P0.5 Welpen mit derselben Menge behandelt (1 x 10 11 Partikel / Pup) von rAAV9.cTNT :: Luciferase (AAV-Luc) oder rAAV9.cTNT :: GFP (AAV-GFP) durch subkutane Injektion. Zwei Wochen nach der Injektion wurde das GFP-Signal in verschiedenen Geweben der Mäuse überwacht. Robust Expression von GFP wurde im Herzen festgestellt, aber nicht in anderen Organen (4, n> 3). So effizient und herzspezifische Genexpression wurde mit dem rAAV9.cTNT Vektor erreicht.

jove_content "fo: keep-together.within-page =" 1 "> Um die Zuschlags Effizienz und Gewebespezifität von rAAV9.U6 Vektoren überwachen, P0.5 - Mäuse wurden mit der gleichen Menge behandelt (3 x 10 11 Partikel / Welpe) von rAAV9 .U6 :: Scramble (AAV-Scramble) oder rAAV9.U6 :: TRBP shRNA (AAV-shTrbp) durch subkutane Injektion. Zwei Wochen nach der Injektion, die Expression von TRBP in verschiedenen Geweben von durch qPCR (Abbildung 5 überwacht wurde, n = 3 ). die mRNA - Spiegel von TRBP im Herzen verringert wurde im wesentlichen durch rAAV9.U6 :: shTrbp (68% Herunterregulieren, P = 0,0004452). Herunterregulierung der TRBP auch in Lebergewebe von rAAV9.U6 erkannt wurde :: shTrbp behandelter Mäusen. jedoch ist die Veränderung wesentlich geringer.

Abbildung 1
Abbildung 1: Die Strategien zum Aufbau des rAAV9.cTNT :: GFP Plasmid. (A) Die Regelung der GFP Kassette :: cTnT. (B TNNT2 Promotor (rAAV9.cTNT) durch die beiden einzigartigen Restriktionsstellen (NheI und KpnI) gefolgt zu beherbergen. Die GFP offene Leserahmen wurde durch Restriktionsstelle vermittelte Ligation in den rAAV9.cTNT Vektor kloniert, um das rAAV9.cTNT :: GFP-Plasmid zu erzeugen. (B) Die rAAV9.cTNT :: GFP-Plasmid kann durch Gibson Montage konstruiert werden. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2: Die Strategien zum Aufbau des rAAV9.U6 :: shRNA Plasmid. (A) Die Regelung der U6 :: shRNA Kassette dargestellt. Die Expression von shRNA wird von der U6-Promotor (blau) angetrieben. (B) rAAV9-U6-shRNA Kassetten können durch Glühen und Ligieren DNA - Oligos erzeugt werden enthaltening shRNA Sequenzen in die Restriktionsenzym-verdaute rAAV9 Vektoren beherbergen die U6-Promotor. (C) rAAV9.U6 :: shRNA Kassetten können durch Langstrecken - PCR und intramolekulare Gibson Montage-basierte "nahtlose" Konstruktion erzeugt werden. Der 5'-Arm, Schleife und 3 'Arm von shRNA sind grün, orange und rot gezeigt. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3: Die Berechnung der rAAV9 Titer. (A) Die Standardkurve für rAAV9 Titration wurde durch lineare Aggression mit der qPCR - Daten erzeugt. Die Stellgröße y die Log 10 - Wert von DNA - Molekülkonzentration jeder Standardprobe und die entsprechende Variable xstellt den C T - Wert. (B) Die Titer von rAAV9 Proben werden auf der Basis der linearen Gleichung der Standardkurve berechnet. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Abbildung 4
Abbildung 4: Expressionsmuster von rAAV9.cTNT :: GFP in Mäusen Gewebe. P0.5 Welpen wurden mit derselben Menge (1 x 10 11 Partikel / Pup) von rAAV9.cTNT :: Luciferase (AAV-Luc, negative Kontrolle) oder rAAV9.cTNT :: GFP (AAV-GFP) durch subkutane Injektion behandelt. Zwei Wochen nach der Injektion wurden die Gewebeproben geerntet. Die Expression von GFP wurde unter einem Fluoreszenz-dissection Rahmen überwacht. Sowohl Hellfeld und Fluoreszenzbilder werden vorgestellt. Die Experimente wurden mehr als 3-mal wiederholt (n> 3).Maßstabsbalken = 2,0 mm. SkM, Skelettmuskel. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Abbildung 5
Abbildung 5: Preissturz Genexpression mit AAV-shRNA. P0.5 - Mäuse wurden mit der gleichen Menge (3 x 10 11 Teilchen / Pup) von rAAV9.U6 :: Scramble (AAV-Scramble) oder rAAV9.U6 :: TRBP shRNA (AAV-shTrbp) durch subkutane Injektion behandelt. Zwei Wochen nach der Injektion, wobei die mRNA-Spiegel von TRBP in verschiedenen Geweben wurden durch qPCR überwacht (n = 3). Daten sind als Mittelwert ± SEM dargestellt. Der Cut-off-P-Wert beträgt 0,05. NS, P> 0,05 ist, nicht signifikant. ** P <0,01. SkM, Skelettmuskel. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Es ist wichtig, unerwünschte ITR Rekombination während der Plasmidkonstruktion zu minimieren. Bevor das Virus zu erzeugen, muss man immer die ITR Integrität der AAV-Plasmiden überwachen durch Restriktionsverdau und Agarose-Gelelektrophorese. Es ist unmöglich, 100% intakte Plasmide zu erhalten, aber die Rekombination Verhältnis sollte so weit wie möglich minimiert werden. Weniger als 20% ist akzeptabel für erfolgreiche rAAV9 Verpackung. Bemerkenswert ist, bei einer niedrigeren Temperatur die Bakterien Kultivierung (30 ° C) mit einer niedrigeren Schüttelgeschwindigkeit (180-200 Umdrehungen pro Minute) kann die Wahrscheinlichkeit der ITR Rekombination reduzieren.

Es ist unbedingt darauf zu achten, dass die HEK293-Zellen gesund sind für eine erfolgreiche Transfektion und rAAV9 Verpackung. "Gesunde" Zellen sind in der Regel hoch proliferativen und schnell wachsen. Allerdings ist eine schnelle Vermehrung und das Wachstum von HEK293-Zellen nicht notwendigerweise die hohe Effizienz rAAV9 Verpackung garantieren. Somit ist es wichtig, die Experimente mit frischen Zellen zu starten. Esempfohlen Nieder Passage HEK293-Zellen zu verwenden, um rAAV9 Verpackung (<10 Passagen, die Zellen alle 2-3 Tage passagiert). Zu beachten ist , andere Serotypen von rAAV benötigen 32 unter Verwendung verschiedener Verfahren gereinigt werden.

Der Prüfer ist Flexibilität bei der Erzeugung von rAAV9 Plasmide gewährt. Entweder Restriktionsstelle vermittelte Ligatur oder Gibson Baugruppe kann 30 verwendet werden. Für die rAAV9.U6 :: shRNA Konstruktion, die intramolekulare Gibson Montage-basierte Strategie ist eine wirksame Methode (Abbildungen 1 und 2). Mehrere AAV-shRNA Plasmide oder gepoolte AAV-shRNAs schnell aufgebaut werden kann. Überexprimiert Gene mit rAAV9, gibt es eine Größenbeschränkung für inserierten cDNA-Sequenzen. Im Allgemeinen muss die Größe Fragment zwischen ITRs , um kleiner als 5 kb 33. Intein-katalysierte Protein - Splicing können die Verpackungsgrößenbeschränkung von rAAV9 Vektoren 34 zu umgehen , verwendet werden.

Andere virale Systems, einschließlich Retrovirus, Lentivirus, Adenovirus und haben auch flexible Genmanipulation entwickelt und ermöglicht worden. Verglichen mit diesen verschiedenen Arten von viralen Vektoren, hat rAAV spezifische Vorteile: hohe Effizienz, hohe Spezifität, geringe genomische Integrationsrate, minimal Immunogenität und minimale Pathogenität. So rAAV-basierte Genomtechnik zeichnet sich als ein ideales Werkzeug für die in - vivo - Gen - Manipulation.

Frühere Studien haben gezeigt , dass die rAAV9 System die effiziente Expression von Genen in vivo geliefert ermöglicht. Mit dem cTnT (Huhn TNNT2) -Promotor, herzspezifische Genexpression erhalten (Abbildung 4) 25,26. Obwohl der U6 - Promotor ubiquitär aktiv in Mausgeweben ist, eine auffallendste Hemmung der Ziel - mRNA (TRBP) durch rAAV9.U6 :: shRNA wurde im Herzen beobachtet, aber nicht in anderen Organen (Abbildung 5). Die Leber ist das am häufigsten organ transduziert von verschiedenen SerotypenrAAV 35,36. Allerdings ist die Zuschlags Effizienz (36% ige Reduktion der mRNA-Ebene) in der Leber deutlich geringer als die im Herzen (68% ige Reduktion der mRNA-Ebene). Dies steht im Einklang mit der früheren Studie , dass zeigt trotz höherer viralen Genoms Anwesenheit in der Leber, die systemische Verabreichung von shRNA von rAAV9 effizienter Gen liefert 35 im Herzen Knockdown. Es ist möglich, dass Hepatozyten mehr proliferative sind als Kardiomyozyten und mehr aktiv Zellteilung nach rAAV9 Verabreichung an den Neugeborenenalter unterziehen, die im Lebergewebe im wesentlichen Vektorgenom Verdünnung führt. Aber auch dies legt nahe, dass der Serotyp rAAV9 effizienter Kardiomyozyten im Vergleich zu anderen Zelltypen transduzieren kann. Wie von Lovric et al., In differenzierten Myocyten werden die DNA - Schadensantwort MRN komplexe Proteine reprimiert. MRN-Komplex-Proteine ​​binden AAV-Genome und AAV-Transduktion durch Transkriptions Silencing hemmen. Somit permissivity zu AAV - Transduktion kann durch die terminale Differenzierung von Kardiomyozyten 36, so dass die rAAV9 System im Vergleich zu anderen viralen Vektoren, sehr geeignet für Genmanipulation im Herzen induziert werden. Um die unerwünschten Effekte Knockdown in andere Organe zu minimieren (zB die Leber), man kann auch herzspezifischen Promotor cTnT getriebenen miR-30a-basierte shmiR verwenden , um die Gene von Interesse in das Herz 29 zu unterdrücken . Dieses Manuskript gibt dem Leser die spezifischen Techniken für die kardiovaskuläre Untersuchungen über die rAAV9 Technologie kapitalisieren.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Polyethylenimine, Linear (MW 25,000) Polysciences, Inc.  #23966-2
Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56) Beckman Coulter, Inc # 362183
Nuclease, ultrapure SIGMA #E8263-25KU
Density Gradient Medium(Iodixanol) SIGMA #D1556-250ML
Centrifugal Filter Unit with Ultracel-100 membrane EMD Millipore Corporation #UFC910008
Laboratory pipetting needle with 90° blunt ends,gauge 14, L 6 in., nickel plated hub SIGMA #CAD7942-12EA
Poloxamer 188 solution (Pluronic® F-68 solution) SIGMA P5556-100ML
Proteinase K SIGMA 3115828001
DNase I Roche 10104159001
Centrifuge machine Thermo Scientific 75004260
Centrifuge System Beckman Coulter 363118
Ultracentrifuge Beckman Coulter
DMEM medium Fisher Scientific SH30243FS
Fetal Bovine Serum  Atlanta Biologicals               S11150
rAAV9 vector Penn Vector Core P1967

DOWNLOAD MATERIALS LIST

References

  1. Primrose, S. B., Twyman, R. Principles of gene manipulation and genomics. John Wiley & Sons. (2013).
  2. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, 1258096 (2014).
  3. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  4. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  5. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355 (2014).
  6. Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. A versatile tool for conditional gene expression and knockdown. Nat. Methods. 3, 109-116 (2006).
  7. Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. Advances in Gene Delivery Systems. BioMed Res. Int. 2015, 610342 (2015).
  8. Kamimura, K., Suda, T., Zhang, G., Liu, D. Advances in gene delivery systems. Pharm. Med. 25, 293-306 (2011).
  9. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  10. Giacca, M., Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J. Control Release. 161, 377-388 (2012).
  11. Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. Evolving gene therapy approaches for osteosarcoma using viral vectors: review. Bone. 40, 797-812 (2007).
  12. De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).
  13. Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. Retrovirus-mediated gene delivery into male germ line stem cells. FEBS Lett. 475, 7-10 (2000).
  14. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).
  15. Katz, R. A., Greger, J. G., Skalka, A. M. Effects of cell cycle status on early events in retroviral replication. J. Cell. Biochem. 94, 880-889 (2005).
  16. Escors, D., Breckpot, K. Lentiviral vectors in gene therapy: their current status and future potential. Arch. Immunol. Ther. Exp. 58, 107-119 (2010).
  17. Mátrai, J., Chuah, M. K., VandenDriessche, T. Recent advances in lentiviral vector development and applications. Mol. Ther. 18, 477-490 (2010).
  18. Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. Structural dynamics of retroviral genome and the packaging. Front. Microbiol. 2, 1-9 (2011).
  19. Douglas, J. T. Adenovirus-Mediated Gene Delivery. Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. 3-14 (2004).
  20. Armendáriz-Borunda, J., et al. Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration. J. Biosci. Bioeng. 112, 415-421 (2011).
  21. Snyder, R. O. Adeno-associated virus-mediated gene delivery. J Gene Med. 1, 166-175 (1999).
  22. Samulski, R. J., Muzyczka, N. AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014).
  23. Kaplitt, M. G., et al. Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector. Ann. Thorac. Surg. 62, 1669-1676 (1996).
  24. Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. J. Gene. Med. 7, 316-324 (2005).
  25. Ding, J., et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776-783 (2015).
  26. Lin, Z., et al. Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Circ. Res. 115, 354-363 (2014).
  27. Wahlquist, C., et al. Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508, 531-535 (2014).
  28. Carroll, K. J., et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).
  29. Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342, 111-114 (2013).
  30. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  31. Rychlik, W., Spencer, W., Rhoads, R. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Allocca, M., et al. Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J. Clin. Invest. 118, 1955-1964 (2008).
  33. Wu, Z., Yang, H., Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
  34. Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum. Gene Ther. 19, 958-964 (2008).
  35. Piras, B. A., O'Connor, D. M., French, B. A. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver. PLoS One. 8, e75894 (2013).
  36. Lovric, J., et al. Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins. Mol. Ther. 20, 2087-2097 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics