Voorbereiding van de rAAV9 tot overexpressie of Knockdown Genes in Mouse Hearts

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ding, J., Lin, Z. Q., Jiang, J. M., Seidman, C. E., Seidman, J. G., Pu, W. T., Wang, D. Z. Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts. J. Vis. Exp. (118), e54787, doi:10.3791/54787 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Die de expressie of activiteit van specifieke genen door myocardiale afgifte van genetisch materiaal in muriene modellen maakt het onderzoek van genfuncties. Hun therapeutisch potentieel in het hart kan worden bepaald. Er zijn beperkte benadering voor in vivo moleculaire interventie in het muizenhart. Recombinant adeno-geassocieerd virus (rAAV) gebaseerde genoom techniek is gebruikt als een essentieel instrument voor in vivo cardiale genmanipulatie. De specifieke voordelen van deze technologie zijn onder andere een hoge efficiëntie, hoge specificiteit, lage genomische integratie rate, minimale immunogeniciteit en weinig pathogeniciteit. Hier wordt een gedetailleerde procedure voor de bouw, verpakking, en zuiveren het rAAV9 vectoren beschreven. Subcutane injectie van rAAV9 in neonatale pups resulteert in robuuste expressie of efficiënte knockdown van het gen (en) van belang in het muizenhart, maar niet in de lever en andere weefsels. Met de cardiale specific TNNT2 promotor, hoge expressie van GFP-gen in het hart werd verkregen. Daarnaast richten mRNA werd geremd in het hart wanneer een rAAV9-U6-shRNA werd gebruikt. Praktische kennis van rAAV9 technologie kunnen nuttig zijn voor hart- en onderzoeken zijn.

Introduction

Regelen expressie of activiteit van specifieke genen in verschillende biologische systemen is een waardevol strategie het onderzoek van genfunctie 1. Een directe manier van de verwezenlijking van dit doel is om nucleotidesequenties te manipuleren en het genereren van mutante allelen. Hoewel het maken van nauwkeurige, doelgerichte wijzigingen aan het genoom van levende cellen nog een tijdrovend en arbeidsintensief praktijk, de ontwikkeling van de machtige TALEN en CRISPR / Cas9 gereedschap heeft een nieuw tijdperk van het genoom bewerken 2-5 geopend. Een routine laboratorium methode voor genetische manipulatie heeft zich gericht op de introductie van genetisch materiaal (DNA en RNA's die coderende sequenties of siRNA / shRNAs) in de cellen uit te drukken of knockdown het gen (s) van belang 1,6.

In veel gevallen, de belangrijke hinderpaal voor genmanipulatie is de afgifte van DNA, RNA of eiwit in de cellen. Wat in vitro studies, efficiënt transfectiop systemen zijn vastgesteld in veel gekweekte cellijnen. In het muismodel met name in vivo genafgifte is moeilijker. Er zijn een aantal extra- en intracellulaire barrières die moeten worden gepasseerd om efficiënte cellulaire opname van exogeen reagens bereiken. Extra obstakels onder meer de snelle klaring en de korte duur van de geleverde materialen 7,8. Een strategie om deze problemen te omzeilen is om virale vectoren als "dragers" of "auto" in vivo genafgifte. De natuur geëvolueerd transductie eigenschappen van virussen mogelijk maken de efficiënte levering van een gen van belang in cellen 7,9,10. Talrijke types van virale vectoren zijn ontwikkeld en maken flexibele in vivo genmanipulatie in verschillende organen en cellen in muizen.

De meest gebruikte virale systemen omvatten Retrovirus, Lentivirus, adenovirus en adeno-geassocieerde virus (AAV) 12-14. Veel soorten retrovirussen alleen delende cellen infecteren en hun doeltreffendheid in niet-delende cellen zeer laag 15. Dit beperkt hun nut voor gen-levering. Lentivirus is een geslacht van de familie Retroviridae. Anders dan andere retrovirussen, Lentivirus kan zowel delende als niet-delende cellen infecteren en is op grote schaal gebruikt voor genoverdracht in post-mitotisch en zeer gedifferentieerde cellen 16. De levenscyclus van Lentivirus omvat ook de integratie van vector DNA in het gastheergenoom. Aldus Lentivirus-gemedieerde genafgifte worden stabiele en langdurige expressie van het getransduceerde genetische elementen 16-18. Dit kan echter voorzien van een double-e vertegenwoordigendged zwaard in het gebruik van deze virussen om genexpressie te manipuleren, de integratie van vector DNA kan leiden tot mutagenese in de gastheercellen en kunnen artefact veroorzaken. Adenovirus andere veelgebruikte genafgiftesysteem. Anders dan retrovirussen en lentivirussen, adenovirussen zijn niet geïntegreerd en niet interfereren met de genomische integriteit van gastheercellen 8,10,11,19. Bovendien kunnen adenovirussen transfecteren DNA in vele celtypen, en infectie niet afhankelijk actieve celdeling 19. Een ander belangrijk kenmerk van adenovirussen is het gemak van vector zuivering als virale vectoren de mogelijkheid te repliceren 19,20. De belangrijkste nadeel van dit systeem is dat adenovirus infectie kan leiden tot sterke immuunresponsen in doelwitcellen en organen 19, beperkt het gebruik ervan in verschillende onderzoeken, in het bijzonder bij gentherapie studies.

Vergeleken met deze verschillende typens van virale vectoren, wordt recombinant adeno-geassocieerd virus (rAAV) naar het ideale genafgiftesysteem 21,22 zijn. Het vertoont een minimale immunogeniciteit en pathogeniciteit 23,24. Bovendien rAAV infecteert een breed scala aan celtypen, waaronder zowel verdelen en niet-delende cellen. In de meeste gevallen is rAAV niet te integreren in ontvangst genomen; waardoor het risico van ongewenste genetische of genomische veranderingen in de doelcellen laag 22.

Recentelijk rAAV systemen met succes gebruikt voor de in vivo afgifte van DNA coderend voor eiwitten, miRNAs, shRNAs en CRISPR-gRNAs in muis hartspier 23,25-29. Deze methode heeft fundamenteel onderzoek en gentherapie studies vergemakkelijkt het gebied van cardiovasculair onderzoek. Hier, de gedetailleerde procedure om rAAV9 vectoren die efficiënt overexpressie of knockdown de genen van belang in muisharten werd beschreven te genereren. Het protocol voorziet in een eenvoudige en effectieve methodemanipuleren van cardiale genexpressie in muizen experimentele modellen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle beschreven stappen werden uitgevoerd in het kader van protocollen door de bioveiligheid Comite en de Institutional Animal Care en gebruik Comite van Boston Children's Hospital goedgekeurd. Boston Children's Hospital heeft pathogenen vrije muis faciliteiten met gereguleerde licht / donker cycli en klimaatregeling. Veterinaire en dierenverzorgers verandering kooien en zorgen voor de gezondheid van de muizen. De faciliteiten zijn AAALAC gecertificeerd en hebben actief Dierenwelzijn Assurance certificering (AAALAC erkenning heeft verleend op 1992/02/24 Dierenwelzijn Assurance nummer:. A3303-01). De muizen werden gedood door CO 2 geleverd vanuit een gecomprimeerde gasbron. Weefselmonsters werden verzameld na de bevestiging dat de hartslag, beweging, en de ademhaling van de dieren had opgehouden. Neonatale knaagdieren resistent zijn tegen 2 euthanasie CO en werden gedood door onthoofding met een scherpe schaar. Deze methoden zijn in overeenstemming met de aanbevelingen van het panel voor euthanasie van de American Veterinary Medical Association.

1. Generatie van rAAV9 constructen door klonen van een cDNA of shRNA expressiecassette in het plasmide Backbone

OPMERKING: De rAAV9 plasmide met het omgekeerde eindstandige herhalingen (ITR's) van AAV2, voor genoverexpressie is aangepast om de kip TNNT2 haven promoter (rAAV9.cTNT), die cardiomyocyt-specifieke expressie van getransduceerde genen 25,26,29 mogelijk maakt. Unieke Nhel en Kpnl-sites geïntroduceerd in het plasmide, stroomafwaarts van de promoter. De cDNA-fragmenten die coderen voor de genen van belang worden gekloneerd in de hoofdketen rAAV9 gebruik van deze twee restrictieplaatsen 25,26,29. Hier, als voorbeeld, de rAAV9 vector voor overmatige expressie van het GFP-gen in muisharten gegenereerd. Het resulterende plasmide bevat de cTnT :: GFP geflankeerd door twee ITR plaatsen (Figuur 1). rAAV9.U6 :: shRNA constructen werden gebruikt voor gentherapie knockdown 25. Ontwerp shRNAs gebruikonline shRNA ontwerp servers. rAAV9.U6 :: shRNA kan worden gegenereerd, hetzij door gloeien en ligeren van DNA-oligo-bevattende shRNA sequenties in het restrictie-enzym verteerd rAAV9 vectoren herbergen van het U6 promotor, of door lange-afstands PCR en intra-moleculaire Gibson assemblage-based "naadloos" constructie 30. Het resulterende plasmide moet de U6-shRNA geflankeerd door twee ITR plaatsen (Figuur 2) bevatten. Hier, als voorbeeld, werd de rAAV9.U6 :: shRNA vector geconstrueerd knockdown Trbp mRNA (Trbp shRNA sequentie: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG). Een scramble shRNA werd gebruikt als een negatieve controle (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG).

  1. Kloon het cDNA of shRNA expressiecassette in de rAAV9 plasmideskelet. Transformeer de DNA in competente E. coli-cellen 25.
    LET OP: Gebruik STBL2 of stbl3 E. coli cellen voor rAAV9 DNA transformatie naar ongewenste ITR recombinatie te minimaliseren.
  2. Haal de oppositieve kloon uit de getransformeerde E. Coli cellen. Versterken van de cultuur in 500 ml van Lilly-Barnett medium en haal de rAAV9 plasmide uit de bacteriële cellen 25-30.
    OPMERKING: Midi / Maxi prep de rAAV9 plasmide een grote hoeveelheid DNA (> 100 mg) te verkrijgen. Vóór het genereren van het virus, altijd analyseren de sequentie integriteit van de AAV plasmiden door middel van restrictie digestie en agarose gel elektroforese, zoals eerder beschreven (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html).

2. Transfectie van HEK293 cellen met plasmiden rAAV9

  1. Bereid 1 ug / ul lineaire polyethyleenimine (PEI) oplossing. Ontbinden PEI poeder in endotoxine-vrij dH 2 O, dat is tot 70-80 ° C is opgewarmd. Nakoeling beneden tot KT, neutraliseren tot pH 7,0 met 1 M HCl. Filter steriliseren (0,22 pm) de oplossing. Aliquot de 1 ug / ul PEI stock-oplossing (1400 pl / buis) en bewaar de solution bij -20 ° C.
  2. Cultuur HEK293 cellen in Dulbecco's Gemodificeerd Eagle Medium (DMEM) met 10% foetaal runderserum (FBS) en 1% penicilline / streptomycine. Cultuur van de cellen in een 37 ° C incubator met 5 ± 0,5% kooldioxide (CO2).
  3. Op dag 0, plaat HEK293 cellen in tien 150-mm schaaltjes 18-20 uur voor transfectie door splitsen> 90% confluente cellen in een 1: 2 verdunning.
    OPMERKING: Op dag 1, de cellen moeten 90% confluentie bereiken.
  4. Op dag 1, transfecteren HEK293 cellen met het rAAV9 plasmide (bijv rAAV9.cTNT :: GFP of rAAV6.U6 :: shRNA construeert), Ad-Helper plasmide, en AAV-Rep / Cap plasmide met behulp van PEI 25,26,29.
    1. Voor 10 schotels van cellen bij 90% confluentie, meng 70 ug AAV-Rep / Cap plasmide, 70 ug pf rAAV9 plasmide en 200 ug Ad-helper-plasmide in een 50 ml centrifugebuis.
    2. Als de cellen minder confluent, past u de DNA bedrag proportioneel. Bijvoorbeeld, als de cellen 75% confluent, verminderenDNA hoeveelheid proportioneel (75/90 van de in stap 2.4.1 hoeveelheid): meng 70 x 75/90 = 58,3 ug van AAV-Rep / Cap plasmide, 70 x 75/90 = 58,3 ug rAAV9 plasmide, en 200 x 75/90 = 166,7 ug Ad-helper-plasmide in een 50 ml centrifugebuis.
    3. Voeg 49 ml RT DMEM (zonder FBS) tot de 50 ml buis en meng.
    4. Voeg 1360 ul van PEI oplossing van het PEI maken: DNA-verhouding (v / w) zijn 4: 1. Goed mengen. Incubeer bij kamertemperatuur gedurende 15-30 min.
    5. Voeg 5 ml van het mengsel bereid in stap 2.4.4 elke 150 mm schotel (50 ml mengsel tien 150 mm schalen).
  5. Cultuur van de cellen in een 37 ° C incubator met 5 ± 0,5% CO2 gedurende 60-72 uur.

3. Oogst van getransfecteerde HEK293 cellen en zuivering van rAAV9 Vectors

  1. Oogst de cellen 60-72 uur na transfectie. Verjagen en schorten de cellen in de gerechten door pipetteren op en neer met het kweekmedium. Transfer alle celsuspensies steriel50 ml buizen.
  2. Centrifugeer de cellen bij 500 xg gedurende 5 minuten. Resuspendeer de celpellet met 5 ml PBS in elke buis en combineren alle celsuspensies in een 50 ml buis.
  3. Centrifugeer de cellen bij 500 xg gedurende 5 minuten. Verwijder het supernatant. Bij deze stap, slaan de celpellet bij -80 ° C of onmiddellijk zuiveren AAV van de pellet, zoals beschreven in stap 3,4-3,15.
  4. Bereid de lysis buffer: 150 mM NaCl en 20 mM Tris-HCl, pH 8,0. Filter steriliseren (0,22 uM). Bewaar de buffer bij 4 ° C.
  5. Resuspendeer de pellet met 10 ml lysisbuffer.
  6. Bevries de lysaat bij -80 ° C of in droogijs / ethanol bad, vervolgens ontdooien in bij 37 ° C. Vortex gedurende 1 min. Bevriezen en ontdooien het lysaat 3 keer.
  7. Voeg MgCl2 oplossing van het ontdooide lysaat (de uiteindelijke concentratie van MgCl2 in het lysaat worden 1 mM). Voeg het nuclease een eindconcentratie van 250 U / ml. Incubeer bij 37 ° C gedurende 15 minuten om het DNA / eiwit aggr oplossendelegatieovereenkomsten.
    OPMERKING: Als de DNA / proteïne aggregatie niet wordt ontbonden na nuclease of endonuclease behandeling, dounce homogeniseren de lysaten 20 keer.
  8. Centrifugeer het monster bij 4800 xg gedurende 20 min bij 4 ° C. Verzamel de bovenstaande vloeistof.
  9. Ondertussen bereiden de IODIXANOL gradiënt oplossing:
    1. Bereid de 17% van de gradiënt oplossing door 5 ml 10 x PBS, 0,05 ml 1 M MgCl2, 0,125 ml 1 M KCl, 10 ml van 5 M NaCl en 12,5 ml ofdensity gradiëntmedium. Stel het totale volume op 50 ml met behulp H 2 O.
    2. Bereid de 25% oplossing door 5 ml 10 x PBS, 0,05 ml 1 M MgCl2, 0,125 ml 1 M KCl, 20 ml dichtheidsgradiënt medium en 0,2 ml van 0,5% (w / v) fenolrood. Stel het totale volume op 50 ml met behulp H 2 O.
    3. Bereid de 40% oplossing door 5 ml 10 x PBS, 0,05 ml 1 M MgCl2, 0,125 ml van 1 M KCl en 33,3 ml dichtheidsgradiënt medium. Stel het totale volume op 50 ml met behulpH 2 O.
    4. Bereid de 60% oplossing door het mengen van 0,05 ml 1 M MgCl2, 0,125 ml 1 M KCl, 50 ml dichtheidsgradiënt medium en 0,1 ml van 0,5% (w / v) fenolrood.
  10. Met een naald en spuit, laadt de IODIXANOL gradiënt oplossing in de polypropyleen buis in de orde van 5 ml van 17%, 5 ml van 25%, 5 ml van 40% en 5 ml van 60%, uitgaande van de bodem. Laad alle lysaat verkregen uit stap 3.8 (14-16 ml) bovenop de gradiënt. De gradiënt opgenomen van beneden naar boven, is 60%, 40%, 25%, 17%, en het lysaat laag. Vul de buis met lysisbuffer en bedek het met de kurk.
  11. Centrifugeer bij 185.000 xg gedurende 90 min bij 16 ° C.
  12. Oogst de virale fractie (40% laag) met een spuit. Steek de naald (21 gauge) in het snijpunt tussen de 40% en 60% fracties alleen aanzuigen de 40% laag.
    OPMERKING: Voorkom opzuigen ENIGE van de 25% laag.
  13. Meng de virale fractie met gesteriliseerd polyoxyethyleen-polyoxypropropyleen blokcopolymeer PBS-oplossing (10% polyoxyethyleen-polyoxypropyleen blokcopolymeer voorraad 1: 10.000 verdund in PBS) tot een totaal volume van 15 ml. Plaats het mengsel in de filter buis (cut-off MW = 100 kD). Centrifugeer bij 2000 xg gedurende 30 min bij 4 ° C.
  14. Gooi de oplossing aan de onderzijde. Vul de filterbuis met polyoxyethyleen-polyoxypropyleen blokcopolymeer PBS-oplossing tot een totaal volume van 15 ml. Centrifugeer bij 2000 xg gedurende 20 min bij 4 ° C. Herhaal deze stap nog twee keer. Verzamel de gezuiverde rAAV9 virus (de fractie boven de filter).
  15. Breng de gezuiverde rAAV9 in het filter buis tot 1,7 ml buizen. Aliquot de gezuiverde rAAV9 (100 - 400 ul / buis, afhankelijk van het volume en de titer van de AAV) en bewaar het virus bij -80 ° C.
    OPMERKING: Vermijd herhaalde vries-dooi.

4. Meting van de titer van rAAV9

  1. Bereid standaard DNA-monsters.
    1. Ontwerpen specifieke en efficiënte PCRprimers voor rAAV9 vectoren en optimaliseren van de PCR toestand.
      LET OP: De primers die in deze studie zijn "Forward: TCGGGATAAAAGCAGTCTGG; Reverse: TCGGACGGAGATACGTGAGT". De PCR reactie werd uitgevoerd onder de volgende omstandigheden: initiële denaturatie bij 95 ° C gedurende 3 min; 35 cycli van 95 ° C gedurende 20 seconden, 60 ° C gedurende 15 sec en 72 ° C gedurende 10 seconden; en de uiteindelijke verlenging bij 72 ° C gedurende 10 minuten. De geoptimaliseerde primers en PCR omstandigheden plasmide-specifiek, aangezien de inzet sequentie in de vector rAAV9 de specificiteit en efficiëntie van PCR 31 kunnen beïnvloeden.
    2. Voer de PCR reactie met de in stap 4.1.1. Zuiver het PCR product met een gel extractie kit.
    3. Meet de concentratie van gezuiverd DNA met een spectrofotometer. Bereken de concentraties in DNA moleculaire aantallen basis van het molecuulgewicht / lengte van het PCR-product.
      1. Bereken de moleculaire concentratie met de volgende formule: molecular concentratie (DNA-moleculen of fragmenten / ml) = 6,23 x 10 23 mol -1 x Con. x 10 -6 / MW. Opmerking: (6,23 x 10 23 mol -1 is Avagadro het nummer, Con .: DNA-concentratie in mg / ml; MW .: molecuulgewicht in g / mol). Bijvoorbeeld, indien de verkregen concentratie van het PCR-product is 100 ug / ml en de lengte is 200 bp, het molecuulgewicht van het dubbelstrengs DNA 2 x 200 x 310 = 124.000 (het gemiddelde molecuulgewicht van elk nucleotide in de enkelstrengs DNA ongeveer 310 g / mol). De moleculaire concentratie (DNA-moleculen / ml) = 6,23 X 10 23 mol -1 x 100 ug / ml x 10 -6 / 124.000 g / mol = 5,18 x 10 14 DNA-moleculen / ml.
      2. Voer een verdunningsreeks van het DNA-fragment en de voorbereiding van de standaardmonsters met concentraties van 10 13 moleculen / ml, 10 12 moleculen / ml, 10 11 moleculen / ml, 10 10 moleculen / ml, 10 9 moleculen / ml, 10 7 moleculen / ml. Met 1 pl van de oplossing voor elk standaardmonster voor de kwantitatieve PCR (qPCR, in stap 4,6).
  2. Meng 5 gl gezuiverde rAAV9 oplossing 5 ui 10X DNAse buffer, 1 pl DNAse (10.000 U / ml) en 39 pi DDH 2 O. Het totale volume moet 50 pl.
  3. Incubeer het flesje bij 37 ° C gedurende 30 minuten om overblijvende verpakte plasmide DNA te verwijderen.
  4. DNAse inactiveren bij 95 ° C gedurende 10 minuten. Koel de oplossing, voeg 44 ui H2O, 5 ui 10X DNAse buffer en 1 ui proteïnase K voorraad (10 mg / ml).
  5. Incubeer de oplossing bij 50 ° C gedurende 2 uur. Stop de reactie en inactiveren het proteïnase K bij 95 ° C gedurende 10 minuten.
  6. Met 1 pl van het monster voor kwantitatieve PCR (qPCR) assay. Bereken de titer.
    1. Run kwantitatieve PCR (qPCR) met de primers in stap 4.1.1 ontworpen met behulp van de monsters frOM stap 4.1.4 (standaardmonsters) en uit stap 4,5 (monsters te meten).
      1. Voor elke reactie, meng 10 pl van 2x Green master mix (met Taq-polymerase, dNTP mix, buffer, MgCl2 en groene kleurstof), 0,5 pl voorwaartse primer (5 uM), 0,5 ui reverse primer (5 uM), 8 pl H2O en 1 ul van het monster te meten. Voer qPCR met de volgende voorwaarden: houd de monsters bij 50 ° C gedurende 2 min en 95 ° C gedurende 10 min; presteren 40 cycli bij 95 ° C gedurende 15 seconden en bij 60 ° C gedurende 1 min; de smeltfase, incubeer de monsters bij 95 ° C gedurende 30 sec en 60 ° C gedurende 15 sec. Genereren de standaardcurve gebaseerd op de CT-getallen van de standaardmonsters (figuur 3).
    2. Bereken de moleculaire concentratie / titer van de AAV monster ten opzichte van de standaard curve. De rAAV9 een enkelstrengs DNA genoom, zodat de moleculaire concentratie wordt 2-maal hoger dan deberekende waarde (2x vermogen (10, y), Figuur 3B). Bovendien zal de titer van de gezuiverde rAAV9 worden 20 keer hoger dan wat wordt verkregen uit de berekening door de 1:20 verdunning van het virus in DNAse en Proteinase K reacties (5 pl in 100 pl totaal).

5. rAAV9 Injectie in pasgeboren muizen en Gene Expression Testen in het Hart

  1. Bereid rAAV9 werkoplossingen in polyoxyethyleen- polyoxypropyleen blokcopolymeer PBS-oplossing. Maak het virus voorraad met de titers van 1-7 x 10 12 deeltjes / ml.
    OPMERKING: Lever 50-70 ul van rAAV9 oplossing in elke postnatale dag 0,5-1,5 muis door middel van subcutane injectie. Om efficiënt genoverexpressie of knock-down te bereiken, is het raadzaam om een ​​pilot-test uit te voeren voor elke studie naar de hoeveelheid ingespoten AAV te optimaliseren. Gebruik dezelfde hoeveelheid rAAV9.cTNT :: Luc of rAAV9.U6 :: scramble controles voor elke studie naar de bias te minimaliseren.
    LET OP: We gebruikten 1-1,5x 10 11 deeltjes / pup voor overexpressie en 2,5-5 x 10 11 deeltjes / pup voor knock-down in postnatale dag 0,5-1,5 mi ce).
  2. Behandel neonatale muizen met rAAV9 op P0.5-P2.5 via subcutane injectie.
    1. Pre-Vul een 29G1 / 2, 0,33 x 12,7 mm insuline spuit met de rAAV9 oplossing. Wees voorzichtig om luchtbellen te verwijderen.
    2. Houd de cryo-verdoofde pup in de ene hand met duim en wijsvinger. Voorafgaand aan de injectie, veegt de achterkant huid van de pup met een wattenstaafje stok verzadigd met 70% isopropylalcohol om de steriele toestand te handhaven. Steek de naald in de anterior-dorsale subcutis van het dier onder een hoek van 5-10 °. Injecteer 50-70 pl van de oplossing met de rAAV9 insulinespuit.
      OPMERKING: rAAV9 kan ook de muis worden geleverd via intraperitoneale of intraveneuze injectie 26,27. Efficiënte expressie van het afgeleverde genen in het hart kan worden verkregen. Echter, intraperitoneaal injecterenion soms leidt tot lekkende expressie in de lever. Na injectie werd de toestand van de pups dagelijks gecontroleerd.
  3. Het niveau van genexpressie in het hart, kunnen door qPCR, immunofluorescentie of western blot (representatieve resultaten worden in Figuren 4 en 5) 25,26.
    LET OP: De muizen werden gedood door CO 2 geleverd vanuit een gecomprimeerde gasbron. Weefselmonsters werden verzameld na de bevestiging dat de hartslag, beweging, en de ademhaling van de dieren had opgehouden. Neonatale knaagdieren resistent zijn tegen 2 euthanasie CO en werden gedood door onthoofding met een scherpe schaar. De methode is in overeenstemming met de aanbevelingen van het panel voor euthanasie van de American Veterinary Medical Association.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

De strategieën voor rAAV9 bouw van rAAV9.cTNT :: GFP of rAAV9.U6 :: shRNA plasmiden worden getoond in figuren 1 en 2, respectievelijk. Zoals de voorbeelden werd de rAAV9 vector gegenereerd om het GFP gen tot overexpressie in muisharten. Het resulterende plasmide bevat de cTnT :: GFP geflankeerd door twee ITR plaatsen (Figuur 1). De rAAV9.U6 :: shRNA vector werd geconstrueerd voor knockdown Trbp mRNA (figuur 2)

De standaardcurve voor rAAV9 titratie werd gegenereerd met qPCR data door lineaire regressie. De gemanipuleerde variabele y de Log 10 waarde van DNA moleculaire concentratie van elk standaard monster, en de bijbehorende variabele x staat voor de C T-waarde. The Log 10 (concentratie) waarden (y) en de C T-nummers (x) vertonen een mooie lineaire correlatie (R 2 = 0,9971) en passen bij de vergelijking y = -0.2832x + 14,616 (figuur 3A). Titers van rAAV9 monsters werden berekend op basis van de lineaire vergelijking (Figuur 3B). Met de werkwijze het protocol (stap 4.6.2 en figuur 3B) beschreven een hoge titer van rAAV9 vectoren (50-200 pl,> 6 x 10 13 deeltjes / ml) werd verkregen van de representatieve studie.

De efficiëntie en weefselspecificiteit van rAAV9.cTNT vectoren volgen, werden P0.5 pups behandeld met dezelfde hoeveelheid (1 x 10 11 deeltjes / pup) van rAAV9.cTNT :: Luciferase (AAV-Luc) of rAAV9.cTNT :: GFP (AAV-GFP) door subcutane injectie. Twee weken na injectie, werd het GFP-signaal bewaakt in verschillende weefsels van de muizen. Robuuste expressie van GFP werd gedetecteerd in het hart, maar niet in andere organen (figuur 4, n> 3). Aldus was efficiënt en hart-genexpressie bereikt met de rAAV9.cTNT vector.

jove_content "fo: keep-together.within-page =" 1 "> Om de knock-down efficiëntie en weefsel specificiteit van rAAV9.U6 vectoren te controleren, werden P0.5 muizen behandeld met hetzelfde bedrag (3 x 10 11 deeltjes / pup) van rAAV9 .U6 :: Scramble (AAV-Scramble) of rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) via subcutane injectie. Twee weken na injectie, de expressie van Trbp in verschillende weefsels van werd gevolgd door qPCR (Figuur 5, n = 3 ). het mRNA-niveau van Trbp in het hart werd aanzienlijk verminderd door rAAV9.U6 :: shTrbp (68% downregulatie, P = 0,0004452). onderaan de regulering van Trbp werd ook gedetecteerd in de lever weefsel van rAAV9.U6 :: shTrbp-behandelde muizen. de verandering is veel lager.

Figuur 1
Figuur 1: De Strategieën om de rAAV9.cTNT :: GFP Plasmid Construct. (A) De regeling van het cTnT :: GFP cassette. (B TNNT2 promoter (rAAV9.cTNT) gevolgd door de twee unieke restrictieplaatsen (KpnI en NheI) haven. Het GFP open leesraam werd gekloneerd in de vector door rAAV9.cTNT restrictieplaats bemiddelde ligatie aan de rAAV9.cTNT :: GFP plasmide te genereren. (B) De rAAV9.cTNT :: GFP plasmide worden geconstrueerd door Gibson samenstel. Klik hier om een grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2: De Strategieën om de rAAV9.U6 :: shRNA Plasmid Construct. (A) De regeling van het U6 :: shRNA cassette wordt weergegeven. Expressie van shRNA wordt aangedreven door de U6 promotor (blauw). (B) rAAV9-U6-shRNA cassettes kunnen worden gegenereerd door gloeien en ligeren van DNA-oligo's bevating shRNA sequenties in het restrictie-enzym verteerd rAAV9 vectoren herbergen van het U6 promotor. (C) rAAV9.U6 :: shRNA cassettes kan worden gegenereerd door de lange afstand PCR en intra-moleculaire Gibson-assemblage op basis van "naadloos" constructie. De 5'-arm, loop, en 3'-arm van shRNA worden in het groen, oranje en rood, respectievelijk. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 3
Figuur 3: Berekening van de rAAV9 Titer. (A) De standaard curve voor rAAV9 titratie werd gegenereerd door lineaire agressie met de qPCR data. De gemanipuleerde variabele y de Log 10 waarde van DNA moleculaire concentratie van elk standaard monster, en de bijbehorende variabele xstelt de CT-waarde. (B) Titers van rAAV9 monsters worden berekend op basis van de lineaire vergelijking van de standaardcurve. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 4
Figuur 4: Expressie Patroon van rAAV9.cTNT :: GFP in Muizen Doekjes. P0.5 pups werden behandeld met dezelfde hoeveelheid (1 x 10 11 deeltjes / pup) van rAAV9.cTNT :: Luciferase (AAV-Luc, negatieve controle) of rAAV9.cTNT :: GFP (AAV-GFP) via subcutane injectie. Twee weken na injectie werden de weefselmonsters geoogst. Expressie van GFP werd gevolgd onder een tl-dissectie scope. Zowel helderveld en fluorescentie beelden worden gepresenteerd. De experimenten werden herhaald meer dan 3 maal (n> 3).Schaal bar = 2,0 mm. SkM, skeletspier. Klik hier om een grotere versie van deze figuur te bekijken.

figuur 5
Figuur 5: Knockdown Gene Expression met AAV-shRNA. P0.5 muizen werden behandeld met dezelfde hoeveelheid (3 x 10 11 deeltjes / pup) van rAAV9.U6 :: Scramble (AAV-Scramble) of rAAV9.U6 :: Trbp shRNA (AAV-shTrbp) via subcutane injectie. Twee weken na injectie werden de mRNA niveaus van Trbp in verschillende weefsels gevolgd door qPCR (n = 3). Gegevens zijn weergegeven als gemiddelde ± SEM. De cut-off P-waarde is 0,05. NS, p> 0,05, niet significant. **, P <0,01. SkM, skeletspier. Klik hier om een grotere versie van deze figuur te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Het is belangrijk om ongewenste ITR recombinatie te minimaliseren tijdens plasmideconstructie. Vóór het genereren van het virus, moet men altijd controleren de ITR integriteit van de AAV plasmiden met restrictie digestie en agarosegelelektroforese. Het is onmogelijk om 100% intacte plasmiden te verkrijgen, maar de verhouding recombinatie moet zoveel mogelijk worden beperkt. Minder dan 20% aanvaardbaar is voor een succesvolle rAAV9 verpakking. Opmerkelijk, kweken van de bacteriën bij lagere temperatuur (30 ° C) met een lagere schudsnelheid (180-200 rpm) kan de kans op recombinatie ITR verminderen.

Het is essentieel dat de HEK293 cellen gezond voor succesvolle transfectie en rAAV9 verpakking. "Gezond" cellen zijn meestal zeer proliferatieve en groeien snel. Echter snelle proliferatie en groei van HEK293 cellen onvoldoende garantie op het hoge rendement van rAAV9 verpakking. Derhalve is het belangrijk om de experimenten te beginnen met verse cellen. HetAanbevolen wordt weinig overgezette gebruiken HEK293-cellen (<10 passages, worden de cellen om de 2-3 dagen doorgekweekt) voor rAAV9 verpakking. Opmerkelijk kunnen andere serotypen van rAAV gezuiverd moeten worden met behulp van verschillende procedures 32.

De onderzoeker geflexibiliseerd bij het genereren van rAAV9 plasmiden. Ofwel restrictieplaats-bemiddelde ligatie of Gibson samenstel kan worden gebruikt 30. Voor de rAAV9.U6 :: shRNA bouw, de intramoleculaire Gibson-samenstel gebaseerde strategie een effectieve methode (figuren 1 en 2). Meerdere AAV-shRNA plasmiden of samengevoegde AAV-shRNAs kan snel worden uitgevoerd. Om genen met behulp van rAAV9 overexpressie, bestaat er een grootte beperking voor ingevoegde cDNA sequenties. In het algemeen is de grootte fragment tussen ITR moet kleiner dan 5 kb 33 zijn. Inteïne gekatalyseerde eiwit splicing kan worden gebruikt om de verpakkingsgrootte maximaal aantal rAAV9 34 vectoren te omzeilen.

Andere virale systeems, waaronder retrovirus, lentivirus en adenovirus, zijn ontwikkeld en maken flexibele genmanipulatie. Vergeleken met deze verschillende soorten virale vectoren, rAAV heeft specifieke voordelen: hoge efficiëntie, hoge specificiteit, lage genomische integratie rate, minimale immunogeniciteit en weinig pathogeniciteit. Aldus wordt rAAV-genoom gebaseerde techniek opkomst als een ideaal hulpmiddel in vivo genmanipulatie.

Eerdere studies hebben aangetoond dat de rAAV9 systeem de efficiënte expressie van genen in vivo afgeleverd. De cTnT (kip TNNT2) promotor werd hart-genexpressie verkregen (figuur 4) 25,26. Hoewel de U6 promotor alomtegenwoordige actief in muisweefsels een meest opvallende remming van doelwit mRNA (Trbp) van rAAV9.U6 :: shRNA werd waargenomen in het hart, maar niet in andere organen (Figuur 5). De lever is de meest voorkomende orgel getransduceerd door verschillende serotypes vanrAAV 35,36. De knockdown efficiëntie (36% reductie van mRNA-niveau) in de lever is veel lager dan die in het hart (68% reductie van mRNA-niveau). Dit komt overeen met de eerdere studie blijkt dat, ondanks hogere virale genoom aanwezig in de lever, systemische afgifte van shRNA door rAAV9 zorgt voor een efficiëntere gen knockdown in het hart 35. Het is mogelijk dat hepatocyten proliferatieve meer dan cardiomyocyten en worden celdeling actiever ondergaan na rAAV9 toediening in de neonatale leeftijd, waardoor aanzienlijke vectorgenoom verdunning in het leverweefsel. Echter, dit suggereert ook dat het serotype van rAAV9 efficiënter hartspiercellen kunnen transduceren in vergelijking met andere celtypen. Zoals aangetoond door Lovric et al., In gedifferentieerde myocyten, de DNA schade respons MRN complexe eiwitten worden onderdrukt. MRN complexe eiwitten binden AAV genomen en remmen AAV transductie door middel van transcriptie silencing. Dus permissivity AAV transductie kan worden geïnduceerd door de terminale differentiatie van cardiomyocyten 36, waardoor het rAAV9 systeem, in vergelijking met andere virale vectoren, zeer geschikt voor genmanipulatie in het hart. De ongewenste effecten knockdown in andere organen (bijvoorbeeld de lever), kan men ook cardiaal-specifieke promotor cTnT aangedreven miR-30a-gebaseerde shmiR gebruikt om de interessante genen onderdrukken in het hart 29 verder te minimaliseren. Dit manuscript geeft de lezer met de specifieke technieken voor het kapitaliseren op de rAAV9 technologie in de cardiovasculaire onderzoek.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Polyethylenimine, Linear (MW 25,000) Polysciences, Inc.  #23966-2
Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56) Beckman Coulter, Inc # 362183
Nuclease, ultrapure SIGMA #E8263-25KU
Density Gradient Medium(Iodixanol) SIGMA #D1556-250ML
Centrifugal Filter Unit with Ultracel-100 membrane EMD Millipore Corporation #UFC910008
Laboratory pipetting needle with 90° blunt ends,gauge 14, L 6 in., nickel plated hub SIGMA #CAD7942-12EA
Poloxamer 188 solution (Pluronic® F-68 solution) SIGMA P5556-100ML
Proteinase K SIGMA 3115828001
DNase I Roche 10104159001
Centrifuge machine Thermo Scientific 75004260
Centrifuge System Beckman Coulter 363118
Ultracentrifuge Beckman Coulter
DMEM medium Fisher Scientific SH30243FS
Fetal Bovine Serum  Atlanta Biologicals               S11150
rAAV9 vector Penn Vector Core P1967

DOWNLOAD MATERIALS LIST

References

  1. Primrose, S. B., Twyman, R. Principles of gene manipulation and genomics. John Wiley & Sons. (2013).
  2. Doudna, J. A., Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science. 346, 1258096 (2014).
  3. Gaj, T., Gersbach, C. A., Barbas, C. F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31, 397-405 (2013).
  4. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  5. Sander, J. D., Joung, J. K. CRISPR-Cas systems for editing, regulating and targeting genomes. Nat. Biotechnol. 32, 347-355 (2014).
  6. Szulc, J., Wiznerowicz, M., Sauvain, M. -O., Trono, D., Aebischer, P. A versatile tool for conditional gene expression and knockdown. Nat. Methods. 3, 109-116 (2006).
  7. Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. Advances in Gene Delivery Systems. BioMed Res. Int. 2015, 610342 (2015).
  8. Kamimura, K., Suda, T., Zhang, G., Liu, D. Advances in gene delivery systems. Pharm. Med. 25, 293-306 (2011).
  9. Thomas, C. E., Ehrhardt, A., Kay, M. A. Progress and problems with the use of viral vectors for gene therapy. Nat. Rev. Genet. 4, 346-358 (2003).
  10. Giacca, M., Zacchigna, S. Virus-mediated gene delivery for human gene therapy. J. Control Release. 161, 377-388 (2012).
  11. Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. Evolving gene therapy approaches for osteosarcoma using viral vectors: review. Bone. 40, 797-812 (2007).
  12. De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).
  13. Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. Retrovirus-mediated gene delivery into male germ line stem cells. FEBS Lett. 475, 7-10 (2000).
  14. Scharfmann, R., Axelrod, J. H., Verma, I. M. Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants. Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).
  15. Katz, R. A., Greger, J. G., Skalka, A. M. Effects of cell cycle status on early events in retroviral replication. J. Cell. Biochem. 94, 880-889 (2005).
  16. Escors, D., Breckpot, K. Lentiviral vectors in gene therapy: their current status and future potential. Arch. Immunol. Ther. Exp. 58, 107-119 (2010).
  17. Mátrai, J., Chuah, M. K., VandenDriessche, T. Recent advances in lentiviral vector development and applications. Mol. Ther. 18, 477-490 (2010).
  18. Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. Structural dynamics of retroviral genome and the packaging. Front. Microbiol. 2, 1-9 (2011).
  19. Douglas, J. T. Adenovirus-Mediated Gene Delivery. Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. 3-14 (2004).
  20. Armendáriz-Borunda, J., et al. Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration. J. Biosci. Bioeng. 112, 415-421 (2011).
  21. Snyder, R. O. Adeno-associated virus-mediated gene delivery. J Gene Med. 1, 166-175 (1999).
  22. Samulski, R. J., Muzyczka, N. AAV-mediated gene therapy for research and therapeutic purposes. Annu. Rev. Virol. 1, 427-451 (2014).
  23. Kaplitt, M. G., et al. Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector. Ann. Thorac. Surg. 62, 1669-1676 (1996).
  24. Kaspar, B. K., et al. Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus. J. Gene. Med. 7, 316-324 (2005).
  25. Ding, J., et al. Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776-783 (2015).
  26. Lin, Z., et al. Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model. Circ. Res. 115, 354-363 (2014).
  27. Wahlquist, C., et al. Inhibition of miR-25 improves cardiac contractility in the failing heart. Nature. 508, 531-535 (2014).
  28. Carroll, K. J., et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).
  29. Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy. Science. 342, 111-114 (2013).
  30. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  31. Rychlik, W., Spencer, W., Rhoads, R. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Allocca, M., et al. Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice. J. Clin. Invest. 118, 1955-1964 (2008).
  33. Wu, Z., Yang, H., Colosi, P. Effect of genome size on AAV vector packaging. Mol. Ther. 18, 80-86 (2010).
  34. Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -Q. Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy. Hum. Gene Ther. 19, 958-964 (2008).
  35. Piras, B. A., O'Connor, D. M., French, B. A. Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver. PLoS One. 8, e75894 (2013).
  36. Lovric, J., et al. Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins. Mol. Ther. 20, 2087-2097 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics