הדור של עכברים השתנה גנטית דרך Microinjection של ביציות

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Microinjection של ביציות העכבר משמש בדרך כלל עבור transgenesis קלאסי ( כלומר, שילוב אקראי של transgenes) ו CRISPR בתיווך גישור המיקוד. פרוטוקול זה סוקר את ההתפתחויות האחרונות microinjection, עם דגש מיוחד על בקרת איכות אסטרטגיות genotyping.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Delerue, F., Ittner, L. M. Generation of Genetically Modified Mice through the Microinjection of Oocytes. J. Vis. Exp. (124), e55765, doi:10.3791/55765 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

השימוש בעכברים מהונדסים גנטית תרם באופן משמעותי למחקרים על תהליכים פיזיולוגיים ופתולוגיים בתהליכי vivo . הזרקת pronuclear של ביטוי דנ"א בונה לתוך ביציות מופרות נשאר הטכניקה הנפוצה ביותר לייצר עכברים מהונדס overexpression. עם כניסתה של טכנולוגיית CRISPR עבור מיקוד גנים, הזרקת pronuclear לתוך ביציות מופרות הורחב לדור של שני נוקאאוט ועכברים נוקין. עבודה זו מתארת ​​את הכנת ה- DNA להזרקה ואת הדור של מדריכים CRISPR עבור מיקוד גנים, עם דגש מיוחד על בקרת איכות. ההליכים הגנוטיפיים הדרושים לזיהוי המייסדים הפוטנציאליים הם קריטיים. אסטרטגיות גנוטיפינג חדשניות המנצלות את יכולות ה"רב-ריבוב "של CRISPR מוצגות כאן. הליכים כירורגיים מתוארים גם. יחד, השלבים של הפרוטוקול יאפשר את הדור של genעכברים מותאמים באופן מהותי עבור הקמתם הבאים של מושבות עכבר עבור שפע של תחומי מחקר, כולל אימונולוגיה, מדעי המוח, סרטן, פיזיולוגיה, פיתוח, ועוד.

Introduction

מודלים של בעלי חיים, הן בחולייתנים והן בחסרי חוליות, שימשו כלי עזר לבחינת הפתופיזיולוגיה של מצבים אנושיים כגון מחלת אלצהיימר 1 , 2 . הם גם כלים שלא יסולאו בפז כדי לחפש מחליפי מחלות ובסופו של דבר לפתח אסטרטגיות טיפול חדש בתקווה של תרופה. למרות שלכל מודל יש מגבלות פנימיות, השימוש בבעלי חיים כמודלים מערכתיים שלמים הוא חיוני למחקר ביו-רפואי. הסיבה לכך היא כי הסביבה הפיזיולוגית מטבולית ומורכבת לא ניתן לדמות לחלוטין בתרבית רקמות.

עד כה, העכבר נשאר המין היונקים הנפוצים ביותר המשמשים מניפולציה גנטית כי זה כולל מספר יתרונות. תהליכים פיזיולוגיים וגנים הקשורים למחלות הם שמורים מאוד בין עכברים ובני אדם. העכבר היה יונק הראשון יש רצף הגנום המלא שלה (2002), שנה אחת לפני geno האדםלי (2003). מלבד זה עושר של מידע גנטי, העכבר יש יכולות הרבייה טובה, מחזור פיתוח מהיר (6 שבועות מן ההפריה לגמילה), וגודל סביר. כל היתרונות הללו, בשילוב עם אינדיקטורים פיזיולוגיים, כגון צבעי מעיל נפרדים (נדרש לחצות אסטרטגיות), הפכו את העכבר למודל אטרקטיבי עבור מניפולציה גנטית. יש לציין, בגיל מוקדם מאוד של גנטיקה מודרנית, גרגור מנדל התחיל לעבוד על עכברים לפני המעבר צמחים 3 .

טכניקות העברת גנים גרמו לדור של העכבר המהונדס הראשון מעל לפני שלושה עשורים 4 , נוצר בתחילה באמצעות משלוח ויראלי. עם זאת, החוקרים הבינו עד מהרה כי אחד האתגרים העיקריים של transgenesis העכבר היה חוסר היכולת לשלוט על גורלו של ה- DNA אקסוגני. בגלל המסירה ויראלי של transgenes לתוך הביציות העכבר הביא עותקים מרובים משולבים באופן אקראי לתוך הגנום, possibilitY של הקמת קווים מהונדסים שלאחר מכן היה מוגבל.

מגבלה אחת כזו היתה להתגבר כאשר גורדון et al. שנוצר קו העכבר מהונדס הראשון על ידי microinjection 5 , 6 . זה התחיל את העידן של טכנולוגיית DNA רקומביננטי, ואת הפרמטרים המשפיעים על התוצאה של הפגישה microinjection נחקרו באופן נרחב 7 . למרות microinjection אינו מאפשר שליטה על אתר האינטגרציה של transgene (אשר בסופו של דבר תוצאות רמות ביטוי ספציפי עבור כל עכבר מייסד), היתרון העיקרי של microinjection pronuclear נשאר היווצרות של concatemers ( כלומר, מערכים של עותקים מרובים של transgene, מקושר בסדרה) לפני שילוב גנומי 5 . מאפיין זה שימש במשך השנים להקים אלפי שורות עכבר מהונדס כי overexpress גן עניין. מאז, transgenesis, אשינוי מלאכותי של הגנום של האורגניזם, נעשה שימוש נרחב כדי לזהות את התפקיד של גנים בודדים בהתרחשות של מחלות.

הישג מפתח נוסף על מניפולציה של הגנום העכבר הגיע כאשר מריו Capecchi בהצלחה שיבשו גן אחד בעכבר, פתיחת עידן של הגן מיקוד 8 . עם זאת, החסרונות העיקריים שהגיחו במהירות ממיקוד גנים המבוסס על תאי גזע ES, כולל האתגרים של תאי ES מתורבתים, מידת השתנות מסוימת של קימברליות ואורך התהליך ( כלומר, 12-18 חודשים, מינימום, כדי להשיג את העכבר) .

לאחרונה, ההתקדמות בטכנולוגיות חדשות, כגון אנדונואלאסים מהונדסים ( למשל, נוקלאזות אצבע אבץ (ZFN), גרעיני אפקט מניע כמו activator (TALEN), וקבוצות חוזרות ונשנות של פליינדרומיס מקובצים בקביעות (CRISPR / Cas9) התפתחו כשיטות חלופיות להאיץ את תהליך המיקוד הגנטי ב- micE 9 , 10 . אלה endonucleases יכול בקלות להיות מוזרק לתוך ביציות העכבר על ידי microinjection, המאפשר לדור של עכברים ממוקד תוך פחות מ 6 שבועות.

מאז הדו"ח הראשון על השימוש CRISPR עבור עריכת הגנום 11 , מערכת חיסונית חיידקית אדפטיבית זו החליפה ZFN ו TALEN בשל היתרונות הרבים שלה, כולל את הקלות של סינתזה ואת היכולת למקד לוקוסים מרובים בבת אחת (המכונה "ריבוב" "). CRISPR שימש לראשונה עבור מיקוד גנים בעכברים 12 ומאז הוחל על מינים אינספור, מן הצמחים לבני אדם 13 , 14 . עד כה, אין דיווח על מין אחד עמיד לעריכת הגנום CRISPR.

שני השלבים המגבילים העיקריים של הדור של עכברים מהונדסים הם הזרקה של ביציות ואת ההשתלה מחדששל הביציות האלה לתוך נקבות מדומות בהיריון. למרות טכניקה זו תוארה על ידינו 15 ועוד 16 , שיפורים טכניים האחרונות עכבר embryology וטכניקות העברת הגן יש מהפכה בתהליך של יצירת עכברים מהונדסים גנטית. שיפורים אלה יתוארו כאן.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

כל ההליכים אושרו על ידי אוניברסיטת ניו סאות 'ויילס טיפול בבעלי חיים ואתיקה הוועדה.

1. הכנת הטרנסג'ן (אינטגרציה אקראית)

  1. ג 'ל אלקטרופורזה אקרוטית אנליטית.
    1. לעכל את הפלסמיד כדי לסתום את transgene באמצעות אנזימים המתאימים (דגירה 1 שעה) או אנזים מהיר digest (15 עד 30 דקות הדגירה) ב thermocycler בעקבות המלצות היצרן (ראה איור 2 א ואת האגדה שלה).
    2. משתתפות 1% tris- אצטט-ethylenediaminetetraacetic חומצה (EDTA) (תה) agarose ג'ל, מוכתם 0.5-1.0 מיקרוגרם / מ"ל ​​אתיד ברומיד (EtBr).
      הערה: יש לנקוט משנה זהירות בעת השימוש ב- EtBr; זה mutagen עוצמה. השתמש בציוד מגן אישי מתאים (עיין בגיליון נתוני בטיחות החומר).
    3. טען 1 קילו סמן משקל מולקולרי.
    4. טען את שברי linearized ( כלומר, transgene ואת עמוד השדרה).
    5. הפעל את אלקטרופורזה ב 100 V במשך 45 דקות.
    6. דמיינו את הג'ל על transilluminator אולטרה סגול (UV) כדי לבדוק כי העיכול הושלמה לאשר את הגודל הנכון של transgene ( כלומר, 7,338 bp, ראה איור 2 א ).
  2. ג 'ל אלקטרופורזה agarose מתכונן.
    1. משתתפות 1% TAE agarose ג'ל מוכתם בכתם ג'ל רעילות נמוכה. טען 8 aliquots (1 מיקרוגרם כל) של transgene לינארית ללא סמן משקל מולקולרי ולהפעיל אלקטרופורזה ב 100 V במשך 45 דקות. השתמש באזמל כדי לסתום את כל 8 להקות המתאים transgene לינארית.
    2. חלץ את ה- DNA באמצעות ערכת מיצוי ג'ל על ידי ביצוע המלצות היצרן (ראה טבלה של חומרים ).
      1. ממיסים את שברי ג'ל ב 50 מעלות צלזיוס צינורות 1.5 מ"ל לפחות 15 דקות. להאיץ אותו עם isopropanol ולאחר מכן להוסיף את המאגר מחייב.
      2. שלב את כל DNA על ידי pipetting הכל לתוך עמודה אחת. Elute למאגר noclease ללא חיץ microinjection (8 מ"מ Tris-HCl ו 0.15 מ"מ EDTA). מסנן דרך מסנן microcentrifuge מיקרומטר 0.22 ו צנטריפוגה עבור 60 s ב 12,000 x גרם.
    3. למדוד את הריכוז ואת האיכות של ה- DNA באמצעות ספקטרופוטומטר. בדוק כי היחס A260 / A280 הוא סביב 1.8 ( כלומר, ללא זיהום על ידי חלבונים) ואת יחס A260 / A230 הוא לפחות 2.0 ( כלומר, לא זיהום על ידי ממיסים אורגניים). לדלל עד 3 ng / μL ב nuclease ללא חיץ microinjection חינם, aliquot (20-50 μL), להקפיא ב -20 מעלות צלזיוס.

2. סינתזה של רכיבי CRISPR (מיקוד גנטי)

  1. Cas9 mRNA.
    1. לדלל את mRNA Cas9 (המתקבל ממקור מסחרי, ראה טבלה של חומרים ) לריכוז של 1 מיקרוגרם / μL במאגר microinjection חינם nuclease.
    2. Aliquot ב 2 μL ללא תשלום Ze ב -80 ° C.
  2. מדריך יחיד RNA (SgRNA).
    1. זהה את הרצף הגנמי הרצוי של שני היעדים (מדריכי) באמצעות כלי תכנון חישובי המאפשר פעילות מינימלית של פעילות לא ממוצעת 17 .
      1. עבור נוק אאוט גן, בחר שיטתי שני מדריכים הממוקם כמה מאות זוגות (bp) בנפרד, בכיוונים מנוגדים, וכוללים את קודון ההתחלה של הגן של עניין. עבור תיקון ישיר הומולוגיה, בחר שני מדריכים חופפים (בכל הזדמנות אפשרית), בכיוונים מנוגדים.
        הערה: כדוגמה, לאחרונה המדריכים הבאים בהצלחה משותפת מוזרק כדי לשבש את האקסון הראשון של הגן TPM4.2 :
        מדריך 1: 5 'CGCCATCCAGTTCGCGCTGC 3';
        מדריך 2: 5 'CAGAACGATTGAGCTATGGC 3'
    2. להזמין סט של פריימרים כמתואר בטבלה 1 .
    3. לסנתז תבנית DNA לינארית.
      1. מדולל px330Ref "> 12 פלסמיד עד 10 ng / μL במים nuclease ללא.
      2. הכינו את התמהיל הראשי כפי שצוין בטבלה 1 . מוסיפים את הפולימראז בסוף ולשמור את התמהיל הראשי על הקרח.
      3. מערבבים ו לפצל את זה לתוך 8 צינורות PCR (19 μL / צינור). הוסף 1 μL של px330 לכל צינור ולהפעיל את ה- PCR בתנאים הבאים: 1 דקות ב 98 מעלות צלזיוס; 40 מחזורים של 98 מעלות צלזיוס למשך 10 שניות, 64 מעלות צלזיוס למשך 30 שניות, ו- 72 מעלות צלזיוס למשך 15 שניות; ו התארכות הסופי ב 72 מעלות צלזיוס במשך 5 דקות. החזק ב 4 ° C.
      4. לטהר את מוצרי ה- PCR באמצעות ערכת טיהור PCR (ראה טבלה של חומרים ), סעפת, ומקור ואקום (לעיבוד מהיר יותר). החל את כוח ואקום מקסימלי ( כלומר, 8 mbar).
        1. הוסף 5 כרכים (100 μL) של חיץ מחייב נפח 1 של המדגם PCR ומערבבים.
        2. מניחים (מסופקת) סיליקה הממברנה ספין טור ב (מסופקים) 2-מ"ל צינור אוסף צנטריפוגה, או על סעפת לתהליך ואקום. כדי לקשור DNA, להחיל ברציפות את כל 8 דגימות לעמודה ואקום או צנטריפוגה עבור 60 s ב 12,000 XG עבור כל העומס.
        3. כדי לשטוף, להוסיף 0.75 מ"ל של חיץ לשטוף (חיץ PE) לעמודה ואקום או צנטריפוגה עבור 60 s ב 12,000 x גרם. צנטריפוגה טור עבור 60 s ב XG 12,000 לחסל אתנול שיורית.
        4. מניחים את העמודה צינור נקי 1.5 מ"ל microcentrifuge. כדי elute הדנ"א, להוסיף 30 μL של מים nuclease חינם למרכז הממברנה, לתת לעמוד לעמוד 1 דקות, צנטריפוגות עבור 60 ים ב 12,000 גרם.
      5. למדוד את הריכוז באמצעות ספקטרופוטומטר; בדרך כלל, הריכוז צריך להיות 100 ng / μL או גבוה יותר. בדוק כי היחס A260 / A280 הוא סביב 1.8 ( כלומר, ללא זיהום על ידי חלבונים) ואת יחס A260 / A230 הוא לפחות 2.0 ( כלומר, לא זיהום על ידי ממיסים אורגניים).
    4. שעתוק במבחנה באמצעות ערכת T7 RNA סינתזה.
      1. הכן את tהוא תערובת הורים, כפי שצוין בטבלה 1 , ו דגירה במשך 3 שעות ב 37 מעלות צלזיוס ב thermocycler. הוסף 28 μL של מים ללא nuclease ו 2 μL של DNase אני ו דגירה עוד 15 דקות ב 37 מעלות צלזיוס thermocycler.
    5. טיהור RNA באמצעות עמודות ספין.
      1. ממיסים את אבקת הכלול בעמודה הספין בתנאי μL 650 של חיץ microocjection nuclease ללא חינם, להסיר בזהירות את כל בועות אוויר. מכסה את הצינור ואת מימה במשך 5 - 15 דקות בטמפרטורת החדר.
      2. הסר את הכובע הכחול בתחתית ומקום את העמודה בצינור 2 מ"ל. צנטריפוגה עבור 2 דקות ב 750 xg וטמפרטורת החדר. מניחים את הטור בצינור 1.5 מ"ל טרי ולהחיל 50 μL של הפתרון RNA dropwise למרכז, בלי לגעת בקיר העמודה. ספין את הטור עבור 2 דקות ב 750 x גרם.
      3. למדוד את ריכוז RNA באמצעות ספקטרופוטומטר (התשואה האופיינית של תגובה אחת היא 30 - 50 מיקרוגרם). בדוק כי היחס A260 / A280 הואסיבוב 2.0 ( כלומר, ללא זיהום על ידי חלבונים) ויחס A260 / A230 הוא לפחות 2.0 ( כלומר, לא זיהום על ידי ממיסים אורגניים). חנות sgRNAs ב -80 מעלות צלזיוס עד לשימוש.
      4. להעריך את האיכות של ה- RNA באמצעות 1% ג'ל TAE המשמש באופן שגרתי עבור אלקטרופורזה DNA. הפעל 200-400 ng של תבנית ה- DNA ואת המקביל sgRNA במקביל. הלהקה RNA (≈ 100 נ"ב) צריך להיות קצת יותר גדול הלהקה דנ"א (ראה איור 3 א ).

3. תבנית התורם

  1. להזמין מסונתז יחיד oligonucleotides מסוממת (ssOligos, לראות את לוח החומרים ) עבור מוטציות נקודה או שילוב של רצפים קטנים עד 50 BP; זרועות הומולוגיה הם בדרך כלל 60-90 bp ארוך.
  2. עבור החדירות גדול, להשתמש פלסמיד התורם כתבנית. יצירת פלסמיד מתאים באמצעות או בשיטת שיבוט קלאסי או סינתזה דה novo ממקור מסחרי.
    הערה: מומלץ מינימום של 800 bp לכל זרוע הומולוגיה. גודל עמוד השדרה אין השפעה על היעילות של תיקון ישיר הומולוגיה (HDR).

4. תערובת הזרקת

  1. לדלל את mRNA Cas9 ל 50 ng / μL ו sgRNAs ל 12.5 ng / μL (25 ng / μL בסך הכל) באמצעות חיץ noclease ללא microinjection עבור ניסויים גנום knockout. הוסף את התבנית התורם (ssOligo או פלסמיד) בריכוז של 200 ng / μL עבור ניסויים עריכת הגנום מבוסס על תיקון ישיר הומולוגיה.
    הערה: אמצעי אחסון דילול ניתן לקבוע בקלות באמצעות כלים מקוונים, כגון מחשבון resuspension 18 .
  2. שמור על כל aliquot על הקרח במהלך הפגישה microinjection וזורקים לאחר מכן (לא להקפיא מחדש את תערובת ההזרקה).

5. כריתת כיס מרה

הערה: שני סוגים של vasectomy מבוצעות בדרך כלל בעכברים: בטן ו scrotal. האחרוןהוא פחות פולשני ותואר לעיל 15 .

  1. החיטוי כל כלי כירורגי נירוסטה.
  2. קביעת משקל העכבר באמצעות סולם לשקול להרדים את הזכרים על ידי הזרקת intraperitoneal (IP) עם הרדמה הזרקת (קטמין 100 מ"ג / ק"ג, xylazine 10 מ"ג / ק"ג).
  3. צג את ההפסד של רפרפת קמצוץ הבוהן ופעם העכבר הוא מסומם במקום זה על גבי כרית חימום.
  4. לחטא את העור סביב האשכים עם מגבונים לסירוגין של חיטוי מקומי כגון chlorhexidine ו 70% אתנול.
  5. לדחוף את האשכים לתוך שק האשכים ולעשות חתך בעור עם אזמל.
  6. דמיינו את המבחן, את האפידידימיס, ואת הכאב.
  7. תפוס את VAS דפרנס עם מלקחיים, להחזיק אותו, לצרוב על כל צד של מלקחיים כדי להסיר 3 מ"מ של דחיית ואס.
  8. בצע את אותו הליך על testis השני.
  9. סגור את החתכים בעור עם קליפים הפצע ולעקוב אחרהעכבר מקרוב עד התאוששות מלאה.

6. Superovulation (ביציות התורמים) ו-הזדווגות זמן (פסאודו בהריון נקבות)

הערה: הטכניקה לייצר מספר מתאים של ביציות מופרות ו נקשר נקבה נקבות עבור השתלה תוארה במקום אחר 15 .

  1. להזריק 10 נקבות IP עם 5 IU של gonadotropin של סוסה בהריון של סוסה (PMSG; ב 100 μL) בסביבות השעה 12:00 ביום 1.
  2. להזריק את הנקבות IP עם 5 IU של גונדוטרופין כוריוני האדם (hCG, ב 100 μL) 46-48 שעות מאוחר יותר (בסביבות 11:00 בבוקר ביום 3).
  3. מיד להזדווג את הנקבות עם זכר אחד שוכנו בן לילה.

7. Pronuclear (אקראי שילוב) ו cytoplasmic (Gene- מיקוד) הזרקות

  1. לסלק את עכברים superovulated ידי נקע בצוואר הרחם, לחשוף את הבטן, לגשת השחלות oviducts, כפי שתואר לעיל 15 . לנתח את oViducts ומסיק את קומולוס, ביציות, מתחמי (COCs) תחת stereomicorscope 15 . מניחים אותם ירידה של אשלגן סימפלקס אופטימיזציה בינוני בינוני עם חומצות אמינו (KSOMaa) בעקבות השיטה המסורתית 15 .
  2. לטהר את הביציות על ידי הוספת 1 μL בקירוב של hyaluronidase (10 מ"ג / מ"ל) לירידה של מדיום KSOMaa באמצעות חתיכת פה אספירטור ומניחים את המנה ב 37 מעלות צלזיוס / 5% CO 2 חממה למשך 30 שניות עד 1 דקות.
  3. לשטוף את הביציות עם 4 טיפות טריות של מדיום KSOMaa באמצעות חתיכת הפה aspirator ולהעביר אותם לירידה הסופית של KSOMaa בינוני עם שמן מינרלי (סביב 2 מ"ל). מניחים את המנה ב 37 ° C / 5% CO 2 באינקובטור עד הביציות מוכנים להזרקת.
  4. הזרקה פרו - גרעינית (אינטגרציה אקראית).
    1. לדמיין את הביצים תחת מיקרוסקופ stereoscopic ולהעביר כ 50 ביצים לתא ההזרקה (א droP של בינוני M2 עם שמן מינרלי) באמצעות חתיכת הפה aspirator.
    2. מעבירים את החדר ההזרקה למיקרוסקופ הפוכה להזריק את הביציות מופרות (שני pronuclei גלוי) עם כמה picoliters של תערובת ההזרקה, מיקוד pronucleus (כל pronuclei יכול להיות ממוקד). דמיינו הזרקת מוצלח על ידי התבוננות בנפיחות של פרונוקליוס.
  5. הזרקת ציטופלסמה (מיקוד גנטי).
    1. העברת כ 50 ביצים לירידה של KSOMaa המכיל 5 מיקרוגרם / מ"ל ​​Cytochalasin B באמצעות חתיכת הפה דגירה של 5 דקות ב 37 ° C / 5% CO 2 חממה.
    2. מעבירים את הביצים לחדר הזריקה באמצעות פיסת הפה.
    3. להזריק כמה picoliters של תערובת ההזרקה לתוך הציטופלסמה בלחץ נמוך מאוד (50-100 hPa), באמצעות לחץ פיצוי של microinjector אוטומטית היכן שניתן.
    4. לאחר ההזרקה, להעביר את הביציות בחזרה לתוך ירידה של KSOMaa (באמצעות פיסת הפה) ולשמור אותם 37 ° C / 5% CO 2 חממה, עד טעון להשתלה לתוך אובידוקט של נשים פסאודו בהריון.

8. השתלה

  1. החיטוי כל כלי כירורגי נירוסטה.
  2. לקבוע את המשקל של העכבר באמצעות סולם לשקול להרדים את הנקבות על ידי הזרקת intraperitoneal (IP) עם הרדמה הזרקת (קטמין 100 מ"ג / ק"ג, xylazine 10 מ"ג / ק"ג).
  3. צג את ההפסד של רפרפת קמצוץ הבוהן ופעם העכבר הוא מסומם במקום זה על גבי כרית חימום.
  4. קליפ שטח גדול של הפרווה סביב קו האמצע הגבי של העכבר הנשי.
  5. לחטא את העור חשוף עם מגבונים לסירוגין של חיטוי מקומי כגון chlorhexidine ו 70% אתנול.
  6. לחשוף את דרכי הרבייה בשיטה המסורתית 15 . הפוך 1 ס"מ ארוך חתך העור במקביל לקו האמצע הגב, לחתוך את השרירים לתפוס את כרית שומן wiמ מלקחיים, ולאחר מכן בעדינות למשוך את השחלה החוצה עד oviduct שלה מחובר הרחם נראים בבירור.
  7. תקן את כרית שומן עם מהדק כלי. דמיינו את oviduct תחת מיקרוסקופ stereoscopic ושימוש זוג מיקרו מספריים לעשות חתך לתוך הקיר של אובידוק כמה מילימטרים במעלה הזרם של ampulla.
  8. תחת מיקרוסקופ stereoscopic, לטעון 25 ביצים microinjected לתוך הזכוכית נימי מחובר פיסת הפה (הקוטר הפנימי של נימי צריך להיות סביב 120 מיקרומטר רחב). הציגו את הזכוכית נימי לתוך oviduct ו לגרש עד בועה אוויר גלוי בתוך ampulla.
  9. הסר בעדינות את נימי הזכוכית והנח את דרכי הרבייה בחזרה אל הבטן. תפר את החתך עם sutures 3-0 שאינם ניתוחים absorbable, ולאחר מכן לסגור עם קליפים הפצע. לפקח על העכבר מקרוב עד להחלמה מלאה.

9. גנוטיפינג אסטרטגיות / רצף

הערה: לבודד את הגנוםDNA מ 2 מ"מ זנב או ביופסיות אוזניים, בעקבות תקנות אתיקה בעלי חיים רלוונטיים.

  1. מיצוי דנ"א מהיר (שילוב אקראי).
    1. Lyse דגימות רקמות (~ 2 מ"מ) ב 95 מעלות צלזיוס למשך 1 שעות μL 100 של מגיב תמוגה אלקליין (25 מ"מ נתרן hydroxide ו 0.2 מ"מ EDTA, pH = 12).
    2. הוסף 100 μL של מגיב ניטרול (40 מ"מ Tris-HCl, pH = 5).
    3. צנטריפוגה 5 דקות ב 12,000 גרם ו 4 ° C.
  2. מיצוי דנ"א באיכות גבוהה (מיקוד גנטי).
    1. הוספת 500 μL של חיץ זנב (50 מ"מ טריס, pH = 8, 100 מ"מ EDTA, pH = 8, 100 מ"מ NaCl, 1% SDS, ו 0.5 mg / מ"ל ​​proteinase K, נוספה טרי).
    2. דגירה לילה ב 55 מעלות צלזיוס.
    3. מערבבים במשך 5 דקות על ידי היפוך (לא מערבולת).
    4. הוסף 250 μL של NaCl רווי (6 M) ומערבבים במשך 5 דקות על ידי היפוך (לא מערבולת).
    5. ספין עבור 5-10 דקות ב 12,000 XG ו 4 ° C ויוצקים את supernatant לתוך צינור חדש.
    6. הוסף 500 μL של isopropanol ומערבבים במשך 5 דקות על ידי היפוך (לא מערבולת).
    7. ספין במשך 10 דקות ב 12,000 xg וטמפרטורת החדר.
    8. ממלאים את supernatant (גלולה הוא בלתי נראה ומקלות על הצינור).
    9. לשטוף עם 1 מ"ל של אתנול 70%.
    10. ספין עבור 5-10 דקות ב 12,000 xg וטמפרטורת החדר. הסר את supernatant עם טיפול, כמו גלולה לבן הוא לא דביק עוד יכול להיות אבוד.
    11. אוויר זה יבש עבור ~ 1 ח.
    12. הוסף 400 μL של חיץ TE (10 מ"מ טריס ו 1 מ"מ EDTA, pH = 8).
    13. ממיסים את ה- DNA ב 55-60 מעלות צלזיוס למשך 2 שעות.
  3. עיצוב פריימר.
    1. עיצוב primers מינימום של 20 bp ארוך באמצעות כלי חישובי 19 .
      הערה: עבור אינטגרציה אקראית, primers צריך הכלאה עם transgene, יצירת שבר ברור של 200-800 bp. עבור מיקוד גנטי, עיצוב primers כך שהם הכלאה עם ה- DNA הגנומי, יצירת f נפרדRagment כמה מאות BP סביב האתרים לחתוך. עבור החדירות הגדולות, primers יכול לשבת על transgene, אבל אישור של אינטגרציה ממוקד לאחר מכן צריך להתבצע באמצעות הליכה פריימר או טכניקה דומה.
  4. PCR גנוטיפינג.
    1. עבור כל שינוי גנומי, עיצוב פרוטוקול PCR חדש ולבדוק אותו באופן אמפירי. שקול את אורך השבר שנוצר ואת טמפרטורת ההיתוך (Tm) של כל זוג primers.
  5. סידור.
    1. עבור מיקוד גנים, שלח מוצרי PCR לספק שירות של סידור רצף.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

להלן, זרימות עבודה עבור microinjection במקרה של אינטגרציה אקראית CRISPR בתיווך גנים מיקוד מתוארים ( איור 1 ).

איור 1
איור 1: זרימת עבודה אופיינית עבור הדור של עכברים מהונדסים גנטית. עבור אינטגרציה אקראית, transgene מטוהרים מוזרק לתוך pronucleus של ביציות מופרות לפני העברת oviduct לתוך נקבות פוסטר מחובר. ניתוח הצאצאים נעשה על ידי PCR לאחר מיצוי DNA גנומי מהיר. עבור מיקוד CRISPR הגן, sgRNAs מסונתזים בשיטת שיבוט שאינם מתוארים כאן, שני מדריכים הם שיתוף מוזרק (יחד עם m9NA Cas9) לתוך הציטופלסמה של ביציות מופרות. אסטרטגיה זו משמשת עבור ניתוח PCR מבוססי הבאים של הצאצאים, אשר דורש מטוהרים מאוד ז דנ"א אטומי. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

למרות microinjection של ביציות ואת ההשתלה של ביצים אלה מוזרקים הם שני הצעדים המגבילים העיקריים הדורשים מיומנויות טכניות הכשרה, איכות תערובת הזרקת הוא בעל חשיבות עליונה כדי ליצור בהצלחה עכברים מהונדסים גנטית. איכות טיהור transgene ( איור 2 א ) ואת סינתזה sgRNAs ( איור 3 א ) יש להעריך באופן שיטתי על ג'ל אנליטית agarose. זיהומים פוטנציאליים של תערובת יש לבדוק גם כאשר מודדים את הריכוזים עם ספקטרופוטומטר, כמו ערכי הקליטה השונים תלויים ישירות על מידת טוהר של הפתרון (ראה צעדים 1.2.3, 2.2.3.5, ו 2.2.5.3).

כמו כן, זיהוי של עכברים מייסדים פוטנציאליים מסתמך במידה רבה על אסטרטגיות גנוטיפינג חדשניות. עבודה זו ממחישה readout טיפוסית של הפגישה microinjection, הן עבור אינטגרציה אקראית ( איור 2 ב ) והן עבור מיקוד גנים ( איור 3 ב ). פרוטוקולי מיצוי הדנ"א גם הם שונים בהתאם לסוג הניסויים; PCRs הבאים להסתמך על primers כי הכלאה או על transgene או על DNA גנומי, בהתאמה. האסטרטגיות המוצגות כאן מאפשרות פתרון בעיות פשוט וייעול של כל צעד נדרש כדי לייצר עכברים מהונדסים גנטית.

למרות התוצאה הכמותית של הפגישה microinjection משתנה בהתאם לחוויה של הנסיין, לאחר כל צעד של הפרוטוקול הוא מותאם, אחוז של גורים מהונדס שהושגו בדרך כלל להגיע 10-25% עבור שילוב אקראי, כפי שמוצג באיור 2 ב (4 מייסדים מתוך 15 גורים שנולדו = 26.6%). זה קצת "נמוך" יעילות בניגוד ליכולת אמינה של רכיבי CRISPR כדי לערוך את הגנום העכבר. ואכן, מספר המייסדים שנוצר הוא בדרך כלל גבוה יותר כאשר משתמשים CRISPR עבור מיקוד גנים טווחים בין 25-100% (ראה איור 3 ב : 3 מייסדים מתוך 13 גורים = 23%). אין זה נדיר להשיג צאצא שלם כי הוא הומוזיגוזי בהצלחה כאשר הם נערך באמצעות CRISPR.

איור 2
איור 2: בקרת איכות ו Genotyping אסטרטגיה לייצור מוצלח של עכברים מהונדס על overexpression. ( א ) פלסמיד הוא מתעכל במשך 1 שעות עם PvuI ו Noti. עיכול מלא וגדלים נכונים ( כלומר, transgene = 7,338 bp, עמוד השדרה = 1,440+ 896 bp) נבדקים על ג'ל אנליטי (1). מיצוי של מספר מוצרים העיכול של ג'ל prepative (2) מייצר ריכוז מוגבר של transgene. חשיפה ממושכת UV יש להימנע, ואת השימוש באור כחול במקום transilluminator UV מומלץ. (ב) Genotyping אסטרטגיה (1): primers צריך לשבת על transgene ו צריך להיות מתוכנן לייצר קטע של 200 - 800 bp. כאשר גנוטיפינג מבוצע (2), מומלץ לכלול שליטה חיובית ( כלומר, תערובת הזרקת המשמש microinjection) ושליטה שלילית ( כלומר, DNA גנומי מעכבר WT). אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 3
איור 3: בקרת איכות גנוטיפינג StraTegy עבור הפקה מוצלחת של ג 'ין ממוקד (KO) עכברים. ( א ) איכות sgRNAs המיוצר על ידי שעתוק במבחנה מוערכת על ידי הפעלת תבנית ה- DNA ואת RNA שנוצר במקביל עבור כל מדריך. גודל ה- RNA הוא מעט גדול יותר מאשר ה- DNA. אם איכות תהיה משביעת רצון ( כלומר, לא להפיץ להקות) הריכוזים נמדדים. ( ב ) (1) עיצוב של שני מדריכים (כיוונים מנוגדים) המקיף את קודון התחלה ב אקסון 1. פריימרים נבחרים להכליא עם DNA הגנומי מחוץ לאזור בסופו של דבר נכרת על ידי שני המדריכים. בדרך כלל, אסטרטגיה זו מאפשרת זיהוי ישיר של המטרו (5 ו 9) ו הומוזיגואי (# 3) KO מייסדים באמצעות PCR (2). מוצרי PCR של בעלי חיים הומוזיגיים אינם מציגים כל הלהקה WT. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

תְגוּבָה רכיבים כֶּרֶך הערה סינתזה של תבנית DNA לינארית
(2.5) Nuclease מים חינם 97.2 μL 5x HF חיץ 36 μL MgCl2 9 μL 10 mN dNTPs 9 μL 10 מיקרומטר fwd תחל 9 μL 5'TTAATACGACTCACTAGAGN 20
Gttttagagctagaaatagcaagttaattaata
Aggctagtc 3 ' 10 מיקרומטר rev תחל 9 μL 5 'אגהאגקגגטקג 3' יחסי ציבורפולימרז קריאה oof 1.8 μL IVT באמצעות ערכת T7 RNA סינתזה
(2.6) Nuclease מים חינם X μL להמציא עד 20 נפח הכולל μL NTP תערובת חיץ 10 μL תבנית DNA ≈ 300 ng פולימרז T7 RNA 2 μL

טבלה 1: הרכב התמהיל הראשוני המשומש במחקר זה. סינתזה של תבנית ה- DNA ליניארית: רצף T7 מינימלי מקדם (TTAATACGACTCACTATAG) הוא במעלה של רצף 20-bp (מדריך, N 20 מזוהה באמצעות כלי עיצוב CRISPR) וכן רצף משלים את וקטור הביטוי (gttttagagctagaaatagcaagttaaaataaggctagtc). בַּמַבחֵנָהתמלול (IVT): בהתאם לריכוז של תבנית ה- DNA, נפח הסופי צריך להיות מותאם μL 20 עם מים ללא nuclease.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

צעדים קריטיים בתוך הפרוטוקול

הדור של עכברים מהונדסים גנטית ידוע להיות מאתגר מבחינה טכנית. עם זאת, הפרוטוקול המוצג כאן היא שיטה אופטימיזציה ופשוט המאפשר אחד לשלוט ולפתור את הטכניקה בזמן שיא. ישנם שני שלבים הכרחיים להשלמת הטכניקה בהצלחה. ראשית, הסינתזה של תבניות DNA לינאריות (לסינתזה של sgRNAs) ניתן להשיג ללא מגנזיום כלורי (MgCl 2 ). עם זאת, מומלץ מאוד להוסיף MgCl 2 באופן שיטתי לתמהיל הראשי כי הכלאה חלקית של תחל קדימה מונע לעתים קרובות בהעדר MgCl 2 . בנוסף, חשוב מאוד שהרצף הגנומי לא יהיה נוכח בכל חלק מתבנית התורם (במקרה של אינטגרציה ממוקדת), אחרת ה- n99 יפסיק אותו, וימנע את התרחשותה של HDR.

שינוייםופתרון בעיות

למרות פרוטוקול זה להפקת עכברים מהונדסים גנטית כבר אופטימיזציה ויעילה לאורך השנים, ישנם מספר שיקולים הנוגעים תשואה של ביציות באיכות טובה microinjection ואת שיעור חיבור של נשים אומנה. הבחירה של זן הרקע הוא קריטי לגבי מספר גורים חיים כתוצאה מפגישה microinjection. C57BL / 6 הוא הרקע הנפוץ ביותר עבור מודלים העכבר של מחלות. עם זאת, הוא גם אחד רקעים פחות יעיל במונחים של התנגדות microinjection 20 . יתר על כן, גיל הנקבה הוא קריטי גם להניב מספר גדול של ביציות; מומלץ להימנע מעכברים 5-8 שבועות של גיל, ללא קשר לרקע, שכן זו התקופה הפחות חיובית של תגובה לגירוי הורמונלי 21 . מניסיוננו, 3 עד 4 שבועות בן C57BL / 6 עכברים אמין תשואה 20-30 ביצים לכל נקבה. זה חשוב ל שים לב כי טכניקה חדשה (המכונה אולטרה superovulation) הפיק עד 100 ביצים לכל נקבה ויש לו לאחרונה נעשה שימוש כדי לייצר ביציות עבור microinjection 22 . עם זאת, השימוש אולטרה- superovulation עבור microinjection נפגע בדרך כלל על ידי הצורך מלאכותי להפרות ( הפריה חוץ גופית ) כגון מספר גדול של ביצים.

כדי להשיג נקבות פוסטר מחובר מתאים להשתלת, עכברים נקבה מזדווגות עם זכרים vasectomized (הרקע של עכברים אלה אינה קריטית). כדי להגדיל את מספר הנמענים מחובר, בדיקה זהירה של שלב ההדרה ואת הבחירה של נקבות מתאימות ניתן לבצע 23 . סינכרון של מחזורי הנקבות יכול גם להיות המושרה על ידי חשיפת הנקבות לזכרים vasectomized יומיים לפני ההזדווגות (מה שנקרא "אפקט whitten").

מגבלות הטכניקה

התחת = "jove_content"> לאחר אופטימיזציה, ההליך צריך לאפשר באופן אמין אחד שיטתי לייצר עכברים מהונדסים גנטית במהלך כל מפגש microinjection. עם זאת, קיימות שתי הגבלות עיקריות לנוהל המתואם עם גודלו של ניסיון ההתאמה הגנומית.

שינויים גנומיים קטנים מאוד, כגון מוטציות נקודה, קל יחסית ליצור, אבל הם קשה לזהות. כאשר genotyping מבוצע, מוצרי ה- PCR הם רצף ישירות על ידי רצף סנגר. עם זאת, microinjection ישירה של רכיבים CRISPR לתוך ביציות העכבר לעתים קרובות מייצר חיות פסיפס כי Cas9 נשאר פעיל במשך זמן לא רב שינויים גנומיים שונים יכולים להתרחש לאחר החלוקה הראשונה של הביצית. האפקט המבלבל הזה מסבך את הזיהוי של מוטציות נפרדות בין אללים שונים, ורצף הדור הבא (NGS) יכול לסייע בקריאה מאתגרת. טכניקות רגישות, כגון tetra-primerARMS-PCR, 25 יכול גם לעזור עם genotyping המושבה לאחר זיהוי של המייסדים על ידי רצף.

לעומת זאת, הוספת חתיכות גדולות של DNA באופן ממוקד נותרה מאתגרת. ככל הדנ"א אקסוגני, פחות את היעילות של HDR. כתוצאה מכך, אסטרטגיות חדשות, כגון שימוש ארוך ssOligos התורמים (במקום פלסמידים) 26 או HDR עצמאית ממוקד אינטגרציה 27 , כרגע מפותחים.

משמעות הפרוטוקול

פרוטוקול זה מציג התקדמות משמעותית כי ארבעה שלבים עיקריים ( כלומר, הכנת מרכיבים transgene או CRISPR, microinjection, השתלה, genotyping) כבר אופטימיזציה, נבדק, ואומתה במעבדה שלנו.

שילוב אקראי של transgenes נעשה שימוש נרחב ללימודי overexpression משתי סיבות עיקריות. ראשית, למזהה את פוטנציאל "אפקט המיקום", אינטגרציה ממוקדת של transgene באמצעות CRISPR ב "נמל מבטחים" loci, כגון Rosa26 28 ו Col1a 29 loci, נשאר מאתגר לשמצה, שכן היעילות של HDR הוא נמוך. אסטרטגיות להתגבר על בעיה זו הן הקרובות 26 , 27 , אבל אינטגרציה אקראית הוכיחה עד כה יעיל יותר. חוץ מזה, הדור של קווי מהונדס מרובים overexpressing transgene אותו עם רמות שונות של ביטוי הוא עניין במחקרים הקשורים אסטרטגיות טיפול כדי להפוך פנוטיפ 30 . טרנסגנים מבוססי פלסמיד נוצרים על ידי שיבוט, תוך שימוש אנזימי הגבלה אד הוק להרכיב שברי חיוניים לביטוי של חלבון של עניין. בדרך כלל, טרנסגן מורכב משלושה אלמנטים לפחות: מקדם מתאים (אזורים משפר מתווספים לעתים); את קידודרצף (cDNA), עם או בלי אזורים אינטרוניים; ו זנב PolyA לייצב ביטוי mRNA 31 .

לאחר התאספו, transgene מוחדר לתוך פלסמיד המכיל חיידקים יסודות חיידקים מורחבת בתרבות לאחר השינוי (בדרך כלל חום בהלם מבוסס). שיטת הטיהור של transgenes עבור microinjection הוא קריטי. עבודה זו מתארת ​​את השימוש בדגימות DNA חדשניות (רעילות נמוכה) לצורך הדמיה מדויקת יותר של קטע הריבית על הג'ל (בהשוואה לגבישי קריסטל מסורתיים) וחשיפה מוטאגנית נמוכה (בהשוואה לאתדיום ברומיד).

שיטת שיבוט לא מתואר כאן עבור מיקוד גנים הוא מהיר מאוד ומאפשר סינתזה של sgRNAs כמה רק 5-6 ​​שעות. רק ארבעה שלבים נדרשים: זיהוי רצף ממוקד, סינתזה של תבנית DNA לינארית המכיל מקדם T7 ואת רצף היעד שנבחרה, סינתזה oF sgRNA על ידי שעתוק במבחנה (IVT), ואת טיהור sgRNA באמצעות עמודות ספין.

בעידן המוקדם של CRISPR העריכה הגנום העכבר, פוטנציאל מחוץ היעד השפעה הוערכה באופן שיטתי, למרות שזה כבר הראה להיות מוגבל מאוד בעובר העכבר 32 והוא יכול בקלות להיות מדוללת על ידי משמעות של ערכת הרבייה שבה העכברים שנבחרו לשאת רק את השינוי הגנטי הרצוי. פעילות על המטרה נבחנה גם באופן שיטתי במבחנה , תוך שימוש במדריכים שונים ובחירת אחד או יותר פעילים. פרקטיקה זו כיום שכיחה פחות, מכמה סיבות. ראשית, הפעילות על היעד מוערכת באמצעות transfection של שורות תאים העכבר הנצח (בדרך כלל N2a או NIH3T3) עם פלסמידים קידוד CRISPR. זוהי שיטה שונה מאשר הזרקת רכיבים CRISPR RNA לתוך ביציות העכבר. לכן, התוצאות שנמצאו במבחנה לא תמיד מתרגמות באופן שווהביציות. יתר על כן, ניסויים תפוקה גבוהה הראו כי רוב המדריכים פעילים 33 . כתוצאה מכך, על פעילות היעד לא מוערך, ועד כה, לא היה כל עדות של מדריך מראה שום פעילות ביציות העכבר. יחד עם שיטת שיבוט לא לסנתז sgRNAs, המוצגת כאן, זה מאוד מפשט ו מייעלת את זרימת העבודה, ומדריכים פעילים רבים ניתן חלקה להיות מסונתז ביום אחד.

CRISPR נחשבת "טכנולוגיה מפריעה", שהיא חידוש שמשנה את אופן ביצוע הטכניקות. כאשר microinjection הוקמה, Brinster et al. הראה כי transgenesis cytoplasmic, אם כי בר השגה, נשאר יעיל בעיקר 7 . כתוצאה מכך, microonjection pronuclear נשאר הנוהג הנפוץ רק במשך כמעט 30 שנים, עד ההפגנה הראשונה של הגן CRISPR מוצלח המיקוד בעכברים. מחקר זה הראה כי microtject cytoplasmic יון יכול לייצר תוצאה דומה או מעולה לעומת משלוח pronuclear 12 . ברור, כי CRISPR רכיבים עשויים בדרך כלל של רנ"א, ברור כי הציטופלסמה ממוקדת. עם זאת, גם כאשר מוזרק לתוך הציטופלסמה, תבניות התורם יכול גם להצליח HDR. ריכוז cytoplasmic גבוה של תבניות מאפשר דיפוזיה שלהם לתוך הגרעין. יתר על כן, השימוש pyzo מונע cytoplasmic microinjection 16 אינו דרישה. הדגירה קצרה של ביציות עם מעכב cytoskeleton, כגון Cytochalasin B, מגביר את ההישרדות של ביציות 34 , 35 , מה שהופך אותו מספיק כדי לבצע זריקות cytoplasmic ללא מערכת הכונן piezo השפעה. כמו כן, השימוש במדיום תרבות משופרת, כמו KSOMaa, מקטין את החסימה בשלב של שני תאים ומשפר את היכולות ההתפתחותיות של העוברים בהשוואה למדיום M16Xref "> 36.

תא אחד או שני תאים (כאשר מעובדים בן לילה) עוברי ניתן להעביר את אובידוקט. הנוהל הקונבנציונלי הוא פולשני למדי, כפי שהוא דורש לקרוע את בורסה המגינה על השחלה. זה גם מאתגר מבחינה טכנית, כי זכוכית נימי צריך להיות מוכנס infundibulum 15 . השיטה המוצגת כאן היא הרבה יותר קל ללמוד, לא לגרום לדימום פוטנציאלי, ושומרת על שלמות השחלה. הוא מבוסס על עבודה שפותחה באוניברסיטת קומאמוטו 37 .

גנוטיפינג אסטרטגיות ורצף טכניקות קריטיים לזהות מייסדי פוטנציאליים. עבור אינטגרציה אקראית, מיצוי הדנ"א הגנומי מבוסס על שיטה פשוטה המותאמת מ- Truett et al. פשרות שיטה כזו החילוץ מהיר מספיק כדי לזהות מייסדי פוטנציאליים, שכן primers נועדו להכליא עם transgene (לעתים קרובות אינטגרAt at עותקים מרובים). לעומת זאת, מיקוד גנטי דורש טיהור גנומי מטופח מאוד, שכן המוצר PCR מקיף את האזור הגנומי שונה.

עבור נוקאאוט הגן, השיטה המסורתית של הזרקת sgRNA יחיד מייצר מחיקות קטנות (indels) או הוספות, בסופו של דבר לדפוק את הגן של עניין 12 . שינויים קטנים אלה קשה לזהות ולעתים קרובות דורשים זמן רב, שיבוט עצמאית ligase ו רצף כדי לאשר את טבעם של מוטציות אלה.

בפרוטוקול זה, ניצלנו CRIPPR ריבוב לפתח שיתוף שיטתי שיתוף של שני sgRNAs המקיף את קודון התחלה של גן של עניין. זה לא רק מגדיל את הסבירות של נוקאאוט גן, אלא גם את כריתה של נתח של DNA גנומי של גודל מוגדר מראש (100-300 bp), המאפשר זיהוי קל של המייסדים על ידי PCR פשוטה. שים לב, גורים שאינם נושאים את הגנומי הצפוי eXcision עדיין יכול להיות מנותח עבור מוטציות frameshift קטנים, כאשר רק אחד sgRNA הוכיח פעיל. כמו כן, במקרה של עריכת גנים, הזרקת שיתוף שיטתית של שני sgRNAs חופפים בכיוונים מנוגדים צריכה להגדיל את היעילות של HDR, שכן מנגנוני תיקון התא מעדיפים להשתמש באחד משני גדילי 39 .

יישומים עתידיים

הפרוטוקול הנוכחי מנצל את ההתפתחויות האחרונות עכבר embryology וגן מיקוד 40 כדי לפשט ולייעל את התהליך של יצירת מודלים עכבר שונים מתוחכמים של מצבים אנושיים. מודלים אלה ממלאים תפקיד מרכזי בסיוע לפתח את ההבנה שלנו של pathomechanisms, בסופו של דבר סיוע בפיתוח של אסטרטגיות טיפוליות 2 . אופטימיזציה וייעול של ריאגנטים הנדרשים עבור מיקוד גנים או אינטגרציה אקראית הם נרחב ליישם בקלותLe כל מיני יונקים אחרים, כגון חולדות, ארנבות, ואפילו לבעלי חיים גדולים כמו בקר.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים מספקים שירותי transgenesis אקדמי בעכברים באמצעות אוניברסיטת ניו סאות 'ויילס מארק ויינרייט אנליטית מרכז.

Acknowledgments

המחברים מודים לצוות של מתקן החיות (BRC) על תמיכתם המתמשכת. עבודה זו מומנה על ידי המועצה הלאומית למחקר רפואי רפואי ומועצת המחקר האוסטרלית.

Materials

Name Company Catalog Number Comments
Micropipette 0.1-2.5 μL Eppendorf 4920000016
Micropipette 2 - 20 μL Eppendorf 4920000040
Micropipette 20 - 200 μL Eppendorf 4920000067
Micropipette 100 - 1,000 μL Eppendorf 4920000083
Molecular weight marker  Bioline BIO-33025 HyperLadder 1 kb
Molecular weight marker  Bioline BIO-33056 HyperLadder 100 bp
Agarose Bioline BIO-41025
EDTA buffer Sigma-Aldrich 93296 10x - Dilute to 1x
Ethidium bromide Thermo Fisher Scientific 15585011
SYBR Safe gel stain Invitrogen S33102
Gel extraction kit Qiagen 28706
PCR purification kit (Qiaquick) Qiagen 28106
Vacuum system (Manifold) Promega A7231
Nuclease-free microinjection buffer  Millipore MR-095-10F
Ultrafree-MC microcentrifuge filter  Millipore UFC30GV00
Cas9 mRNA Sigma-Aldrich CAS9MRNA
CRISPR expressing plasmid (px330) Addgene 42230
Nuclease free water Sigma-Aldrich W4502
Phusion polymerase New England Biolabs M0530L
T7 Quick High Yield RNA kit New England Biolabs E2050S
RNA purification spin columns (NucAway) Thermo Fisher Scientific AM10070
ssOligos Sigma-Aldrich OLIGO STANDARD
Donor plasmid Thermo Fisher Scientific GeneArt
Hyaluronidase Sigma-Aldrich H3884
KSOMaa embryo culture medium Zenith Biotech  ZEKS-100
Mineral oil Zenith Biotech  ZSCO-100
M2 Medium Sigma-Aldrich M7167
Cytochalasin B Sigma-Aldrich C6762
Mouthpiece Sigma-Aldrich A5177
Glass microcapillaries Sutter Instrument BF100-78-10
Proteinase K Applichem A3830.0100
Dumont #5 forceps Fine Science Tools  91150-20
Iris scissors Fine Science Tools  91460-11
Vessel clamp Fine Science Tools  18374-43
Wound clips  Fine Science Tools  12040-01
Clips applier  Fine Science Tools  12018-12
Micro-scissors  Fine Science Tools  15000-03
Cauterizer Fine Science Tools  18000-00
Non-absorbable surgical sutures (Ethilon 3-0) Ethicon 1691H
5% CO2 incubator MG Scientific Galaxy 14S
Spectrophotometer Thermo Fisher Scientific Nanodrop 2000c
Thermocycler Eppendorf 6321 000.515
Electrophoresis set up BioRad 1640300
UV Transilluminator BioRad 1708110EDU
Thermocycler Eppendorf 6334000069
Stereoscopic microscope Olympus SZX7
Inverted microscope Olympus IX71
2x Micromanipulators Eppendorf 5188000.012
Oocytes manipulator Eppendorf 5176000.025
Microinjector (Femtojet) Eppendorf 5247000.013
Mice C57BL/6J strain Australian BioResources C57BL/6JAusb 

DOWNLOAD MATERIALS LIST

References

  1. Ittner, L. M. Dendritic function of tau mediates amyloid-beta toxicity in Alzheimer's disease mouse models. Cell. 142, (3), 387-397 (2010).
  2. Ittner, A. Site-specific phosphorylation of tau inhibits amyloid-beta toxicity in Alzheimer's mice. Science. 354, (6314), 904-908 (2016).
  3. Marantz Henig, R. The Monk in the Garden. Mariner books. (2000).
  4. Jaenisch, R., Mintz, B. Simian virus 40 DNA sequences in DNA of healthy adult mice derived from preimplantation blastocysts injected with viral DNA. Proc Natl Acad Sci U S A. 71, (4), 1250-1254 (1974).
  5. Gordon, J. W., Ruddle, F. H. Integration and stable germ line transmission of genes injected into mouse pronuclei. Science. 214, (4526), 1244-1246 (1981).
  6. Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A., Ruddle, F. H. Genetic transformation of mouse embryos by microinjection of purified DNA. Proc Natl Acad Sci U S A. 77, (12), 7380-7384 (1980).
  7. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Yagle, M. K., Palmiter, R. D. Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc Natl Acad Sci U S A. 82, (13), 4438-4442 (1985).
  8. Capecchi, M. R. Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century. Nat Rev Genet. 6, (6), 507-512 (2005).
  9. Carbery, I. D. Targeted genome modification in mice using zinc-finger nucleases. Genetics. 186, (2), 451-459 (2010).
  10. Sung, Y. H. Knockout mice created by TALEN-mediated gene targeting. Nat Biotechnol. 31, (1), 23-24 (2013).
  11. Jinek, M. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  12. Wang, H. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  13. Kang, X. Introducing precise genetic modifications into human 3PN embryos by CRISPR/Cas-mediated genome editing. J Assist Reprod Genet. 33, (5), 581-588 (2016).
  14. Liang, P. CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes. Protein Cell. 6, (5), 363-372 (2015).
  15. Ittner, L. M., Götz, J. Pronuclear injection for the production of transgenic mice. Nat Protoc. 2, (5), 1206-1215 (2007).
  16. Yang, H., Wang, H., Jaenisch, R. Generating genetically modified mice using CRISPR/Cas-mediated genome engineering. Nat Protoc. 9, (8), 1956-1968 (2014).
  17. CRISPR DESIGN. Available from: http://crispr.mit.edu (2017).
  18. Integrated DNA Technologies. Resuspension Calculator. Available from: https://sg.idtdna.com/calc/resuspension/ (2017).
  19. BioTools at UMass Medical School. Primer3: WWW primer tool. Available from: http://biotools.umassmed.edu/bioapps/primer3_www.cgi (2017).
  20. Auerbach, A. B. Strain-dependent differences in the efficiency of transgenic mouse production. Transgenic Res. 12, (1), 59-69 (2003).
  21. Merriman, J. A., Jennings, P. C., McLaughlin, E. A., Jones, K. T. Effect of aging on superovulation efficiency, aneuploidy rates, and sister chromatid cohesion in mice aged up to 15 months. Biol Reprod. 86, (2), 49 (2012).
  22. Nakagawa, Y., et al. Ultra-superovulation for the CRISPR-Cas9-mediated production of gene-knockout, single-amino-acid-substituted, and floxed mice. Biol Open. 5, (8), 1142-1148 (2016).
  23. Byers, S. L., Wiles, M. V., Dunn, S. L., Taft, R. A. Mouse estrous cycle identification tool and images. PLoS One. 7, (4), e35538 (2012).
  24. Whitten, W. K. Modification of the oestrous cycle of the mouse by external stimuli associated with the male. J Endocrinol. 13, (4), 399-404 (1956).
  25. Ye, S., Dhillon, S., Ke, X., Collins, A. R., Day, I. N. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 29, (17), E88 (2001).
  26. Yoshimi, K., et al. ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat Commun. 7, 10431 (2016).
  27. Suzuki, K., et al. In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. (2016).
  28. Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 21, 70-71 (1999).
  29. Liu, X., et al. A targeted mutation at the known collagenase cleavage site in mouse type I collagen impairs tissue remodeling. J Cell Biol. 130, (1), 227-237 (1995).
  30. Ke, Y. D. Short-term suppression of A315T mutant human TDP-43 expression improves functional deficits in a novel inducible transgenic mouse model of FTLD-TDP and ALS. Acta Neuropathol. 130, (5), 661-678 (2015).
  31. Auerbach, A. B. Production of functional transgenic mice by DNA pronuclear microinjection. Acta Biochim Pol. 51, (1), 9-31 (2004).
  32. Iyer, V., et al. Off-target mutations are rare in Cas9-modified mice. Nat Methods. 12, (6), 479 (2015).
  33. Zhou, Y. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 509, (7501), 487-491 (2014).
  34. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Avarbock, M. R. Translation of globin messenger RNA by the mouse ovum. Nature. 283, (5746), 499-501 (1980).
  35. Pinkert, C. A., Irwin, M. H., Johnson, L. W., Moffatt, R. J. Mitochondria transfer into mouse ova by microinjection. Transgenic Res. 6, (6), 379-383 (1997).
  36. Biggers, J. D., Summers, M. C. Choosing a culture medium: making informed choices. Fertil Steril. 90, (3), 473-483 (2008).
  37. Nakagata, N. Embryo transfer through the wall of the fallopian tube in mice. Jikken Dobutsu. 41, (3), 387-388 (1992).
  38. Truett, G. E. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  39. Richardson, C. D., Ray, G., DeWitt, M. A., Curie, G. L., Corn, J. E. Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 34, (3), 339-344 (2016).
  40. Delerue, F., Ittner, L. M. Genome Editing in Mice Using CRISPR/Cas9: Achievements and Prospects. Clon. Transgen. 4, (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics