Generering af genetisk modificerede mus gennem mikroinjektion af oocytter

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Mikroinjektionen af ​​musoocytter er almindeligt anvendt til både klassisk transgenese ( dvs. den tilfældige integration af transgene) og CRISPR-medieret genmålretning. Denne protokol gennemgår de seneste udviklinger inden for mikroinjektion, med særlig vægt på kvalitetskontrol og genotyping-strategier.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Delerue, F., Ittner, L. M. Generation of Genetically Modified Mice through the Microinjection of Oocytes. J. Vis. Exp. (124), e55765, doi:10.3791/55765 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Anvendelsen af ​​genetisk modificerede mus har signifikant bidraget til studier på både fysiologiske og patologiske in vivo- processer. Den prækukleære injektion af DNA-ekspressionskonstruktioner i befrugtede oocytter forbliver den mest almindeligt anvendte teknik til frembringelse af transgene mus til overekspression. Med introduktionen af ​​CRISPR-teknologi til genmålretning er pronukleær injektion i befrugtede oocytter blevet udvidet til dannelsen af ​​både knockout- og knock-mus. Dette arbejde beskriver fremstillingen af ​​DNA til injektion og dannelsen af ​​CRISPR-guider til genmålretning med særlig vægt på kvalitetskontrol. Genotypeprocedurerne til identifikation af potentielle grundlæggere er kritiske. Innovative genotypebestemmelser, der udnytter CRISPR's "multiplexing" -muligheder, præsenteres her. Kirurgiske procedurer er også beskrevet. Sammen vil protokollens trin tillade generering af genEtisk modificerede mus og til efterfølgende etablering af musekolonier for en overflod af forskningsområder, herunder immunologi, neurovidenskab, cancer, fysiologi, udvikling og andre.

Introduction

Dyremodeller, både hos hvirveldyr og hvirvelløse dyr, har været med til at undersøge patofysiologien af ​​humane tilstande såsom Alzheimers sygdom 1 , 2 . De er også uvurderlige værktøjer til at søge efter sygdomsmodifikatorer og til sidst udvikle nye behandlingsstrategier i håb om en kur. Selvom hver model har indre begrænsninger, er anvendelsen af ​​dyr som hele systemiske modeller afgørende for biomedicinsk forskning. Dette skyldes, at det metaboliske og komplekse fysiologiske miljø ikke helt kan simuleres i vævskulturen.

Til dato er musen den mest almindelige pattedyrsart, der anvendes til genetisk manipulation, fordi den har flere fordele. De fysiologiske processer og gener forbundet med sygdomme er stærkt konserveret mellem mus og mennesker. Musen var det første pattedyr, der havde sin fulde genom sekventeret (2002), et år før den menneskelige genoMig (2003). Bortset fra denne rigdom af genetisk information har musen god avlskapacitet, en hurtig udviklingscyklus (6 uger fra befrugtning til fravænning) og en rimelig størrelse. Alle disse fordele, kombineret med fysiologiske indikatorer, som f.eks. Klare farver (kræves til krydsstrategier), gjorde musen til en attraktiv model til genetisk manipulation. I den tidlige moderne genetikkens begyndelse begyndte Gregor Mendel at arbejde på mus, før han flyttede til planter 3 .

Genoverførselsteknikker resulterede i dannelsen af ​​den første transgene mus over tre årtier siden 4 , der oprindeligt blev oprettet ved hjælp af viral levering. Forskere indså imidlertid snart, at en af ​​de vigtigste udfordringer ved mus transgenese var manglende evne til at kontrollere skæbnen af ​​det eksogene DNA. Fordi den virale afgivelse af transgener i musoocytter resulterede i flere kopier integreret tilfældigt i genomet, kunne mulighedenY for at etablere efterfølgende transgene linjer var begrænset.

En sådan begrænsning blev overvundet, når Gordon et al. Dannet den første transgene muselinie ved mikroinjektion 5 , 6 . Dette begyndte æra med rekombinant DNA-teknologi, og parametrene, der påvirker resultatet af en mikroinjektionssession, er blevet studeret bredt 7 . Selv om mikroinjektion ikke tillader kontrol over transgenets integrationssted (som i sidste ende resulterer i specifikke ekspressionsniveauer for hver grundmus), forbliver den primære fordel ved pronuklear mikroinjektion dannelsen af ​​concatemers ( dvs. arrays af flere kopier af transgenet, Forbundet i serie) før genomisk integration 5 . Denne egenskab er blevet brugt gennem årene til at etablere tusindvis af transgene muselinier, der overudtrykker et gen af ​​interesse. Siden da har transgenese, aRtificerende modifikation af et organismer genom har i vid udstrækning været anvendt til at identificere de enkelte geners rolle i forekomsten af ​​sygdomme.

En yderligere vigtig præstation i manipulering af musegenomet blev nået, da Mario Capecchi med succes forstyrrede et enkelt gen i musen og åbner æra med genmålretning 8 . Imidlertid opstod der store ulemper hurtigt fra ES-cellebaseret genmålretning, herunder udfordringerne ved dyrkning af ES-celler, den noget variable grad af chimerisme og længden af ​​processen ( dvs. 12-18 måneder minimum for at opnå musen) .

For nylig er fremskridt inden for ny teknologi, såsom manipulerede endonukleaser ( fx zinkfingernukleaser (ZFN), transkriptionsaktivatorlignende effektor-nukleaser (TALEN) og klyngede regelmæssigt interspaced korte palindromiske gentagelser (CRISPR / Cas9)) fremkommet som alternative metoder til Fremskynde processen med genmålretning i mikrofonenE 9 , 10 . Disse endonucleaser kan let injiceres i musococytter ved mikroinjektion, hvilket tillader generering af genmålrettede mus i så lidt som 6 uger.

Siden den første rapport om brugen af ​​CRISPR til genomredigering 11 har dette bakterielt adaptive immunsystem erstattet ZFN og TALEN på grund af dets mange fordele, herunder den lette syntese og evnen til at målrette flere loci på én gang (kaldet multiplexing "). CRISPR blev først anvendt til genmålretning i mus 12 og er siden blevet anvendt på utallige arter fra planter til mennesker 13 , 14 . Til dato er der ingen rapport om en enkelt art, der er resistent over for CRISPR genom redigering.

De to hovedbegrænsende trin i generationen af ​​transgene mus er injektionen af ​​oocytter og reimplantationenAf disse oocytter til pseudo-gravide kvinder. Selv om denne teknik er blevet beskrevet af os 15 og andre 16 , har de seneste tekniske forbedringer i musembryologi og genoverførselsteknikker revolutioneret processen med at generere genetisk modificerede mus. Disse forbedringer vil blive beskrevet heri.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle procedurer er godkendt af University of New South Wales Dyrpleje og Etikudvalg.

1. Fremstilling af transgenet (tilfældig integration)

  1. Analytisk agarosegelelektroforese.
    1. Fordel plasmidet for at punge transgenet ved hjælp af passende enzymer (1 time inkubation) eller hurtigt fordøjelsesenzymer (15 til 30 minutter inkubation) i en termocykler efter producentens anbefalinger (se figur 2A og dens legende).
    2. Stiv en 1% tris-acetat-ethylendiamintetraeddikesyre (EDTA) (TEA) agarosegel, farvet med 0,5-1,0 μg / ml ethidiumbromid (EtBr).
      BEMÆRK: Vær forsigtig, når du bruger EtBr; Det er en potent mutagen. Brug passende personlige værnemidler (se sikkerhedsdatabladet).
    3. Indsæt en 1 kb molekylvægt markør.
    4. Indlæs de lineære fragmenter ( dvs. transgen og rygrad). Kør elektroforese ved 100 V i 45 minutter.
    5. Visualiser gelen på en ultraviolet (UV) transilluminator for at kontrollere, at fordøjelsen er fuldstændig og for at bekræfte den korrekte størrelse af transgenet ( dvs. 7.333 bp, se figur 2A ).
  2. Forberedende agarosegelelektroforese.
    1. Cast en 1% TAE-agarosegel farvet med en lavtoksicitetsgel-plet. Indsæt 8 alikvoter (1 μg hver) af lineariseret transgen uden en molekylvægtmarkør og kør elektroforese ved 100 V i 45 min. Brug en skalpel til at punge alle 8 bånd svarende til det lineariserede transgen.
    2. Ekstraher DNA'et ved hjælp af et gelekstraktionskit ved at følge producentens anbefalinger (se Materialebordet ).
      1. Smelte gelfragmenterne ved 50 ° C i 1,5 ml rør i mindst 15 minutter. Nedfæld det med isopropanol og tilsæt derefter bindingsbufferen.
      2. Kombiner hele DNA ved at pipettere det hele i en søjle. Udløb i nukleasefri mikroinjektionsbuffer (8 mM Tris-HCI og 0,15 mM EDTA). Filter gennem et 0,22 μm mikrocentrifugfilter og centrifuge i 60 s ved 12.000 x g.
    3. Mål koncentrationen og kvaliteten af ​​DNA'et ved hjælp af et spektrofotometer. Kontroller, at A260 / A280-forholdet er omkring 1,8 ( dvs. ingen forurening af proteiner), og A260 / A230-forholdet er mindst 2,0 ( dvs. ingen forurening med organiske opløsningsmidler). Fortynd ned til 3 ng / μL i nukleasefri mikroinjektionsbuffer, alikvot (20-50 μl) og frys ved -20 ° C.

2. Syntese af CRISPR-komponenter (genmålretning)

  1. Cas9 mRNA.
    1. Fortynd Cas9 mRNA (opnået fra en kommerciel kilde, se Materialetabellen ) til en koncentration på 1 μg / μl i nukleasefri mikroinjektionsbuffer.
    2. Aliquot i 2 μL og fri De ved -80 ° C.
  2. Single-guide RNA (SgRNA).
    1. Identificer de ønskede to-mål-genomiske sekvenser (guider) ved hjælp af et beregningsdesignværktøj, der muliggør minimal potentiel off-target-aktivitet 17 .
      1. Ved genknockout vælges systematisk to guider, der ligger et par hundrede basepar (bp) fra hinanden i modsatte retninger og indbefatter startkodonet for genet af interesse. Til homologi direkte reparation skal du vælge to overlappende guider (når det er muligt) i modsatte retninger.
        BEMÆRK: Som et eksempel er følgende vejledninger for nylig blevet injiceret med succes for at forstyrre den første exon af TPM4.2 genet:
        Guide 1: 5 'CGCCATCCAGTTCGCGCTGC 3';
        Guide 2: 5 'CAGAACGATTGAGCTATGGC 3'
    2. Bestil et sæt primere som beskrevet i tabel 1 .
    3. Syntese en lineær DNA-skabelon.
      1. Fortynd px330Ref "> 12 plasmid til 10 ng / μl i nukleasefrit vand.
      2. Forbered masterblandingen som angivet i tabel 1 . Tilsæt polymerasen i slutningen og hold masterblandingen på is.
      3. Bland og opdel dette i 8 PCR rør (19 μL / rør). Tilsæt 1 μL px330 pr. Rør og kør PCR under følgende betingelser: 1 min ved 98 ° C; 40 cyklusser på 98 ° C i 10 s, 64 ° C i 30 s og 72 ° C i 15 s; Og en endelig forlængelse ved 72 ° C i 5 minutter. Hold ved 4 ° C.
      4. Rens PCR-produkterne ved hjælp af et PCR-rensningssæt (se Materialebordet ), en manifold og en vakuumkilde (til hurtigere behandling). Påfør maksimal vakuumstyrke ( dvs. 8 mbar).
        1. Tilsæt 5 volumener (100 μl) bindingsbuffer til 1 volumen af ​​PCR-prøven og bland.
        2. Anbring en (tilvejebragt) silikamembran-spids-søjle i et (forsynet) 2 ml opsamlingsrør til centrifugering eller på manifolden til vakuumprocesing. For at binde DNA, påfør successivt alle 8 prøver til søjlen og vakuum eller centrifuge i 60 s ved 12.000 xg for hver belastning.
        3. For at vaske tilsættes 0,75 ml vaskebuffer (buffer PE) til søjlen og vakuum eller centrifuge i 60 s ved 12.000 x g. Centrifuger kolonnen i 60 s ved 12.000 xg for at eliminere rest ethanol.
        4. Placer søjlen i et rent 1,5 ml mikrocentrifugerør. For at eluere DNA'et tilsættes 30 μl nukleasefrit vand til membranets centrum, lad søjlen stå i 1 minut og centrifuger i 60 s ved 12.000 g.
      5. Mål koncentrationen ved hjælp af et spektrofotometer Koncentrationen bør typisk være 100 ng / μl eller højere. Kontroller, at A260 / A280-forholdet er omkring 1,8 ( dvs. ingen forurening af proteiner), og A260 / A230-forholdet er mindst 2,0 ( dvs. ingen forurening med organiske opløsningsmidler).
    4. In vitro transkription ved anvendelse af et T7 RNA syntese kit.
      1. Forbered tHan master mix, som angivet i tabel 1 , og inkuberes i 3 timer ved 37 ° C i en termocykler. Tilsæt 28 μL nukleasefrit vand og 2 μl DNase I og inkuber i yderligere 15 minutter ved 37 ° C i en termocykler.
    5. RNA rensning ved hjælp af spin kolonner.
      1. Opløs pulveret indeholdt i den tilvejebragte spin-søjle i 650 μL nukleasefri mikroinjektionsbuffer, og fjern forsigtigt alle luftbobler. Hæld røret og hydrat i 5 - 15 minutter ved stuetemperatur.
      2. Fjern den blå hætte i bunden og læg søjlen i et 2 ml rør. Centrifuger i 2 minutter ved 750 xg og stuetemperatur. Sæt kolonnen i et nyt 1,5 ml rør og anbring 50 μL RNA-opløsningen dråbevis i midten uden at røre søjlemuren. Spin kolonnen i 2 minutter ved 750 x g.
      3. Mål RNA-koncentrationen ved anvendelse af et spektrofotometer (det typiske udbytte af en reaktion er 30-50 μg). Kontroller, at A260 / A280-forholdet er aRunde 2,0 ( dvs. ingen forurening af proteiner) og A260 / A230 forholdet er mindst 2,0 ( dvs. ingen forurening med organiske opløsningsmidler). Opbevar sgRNA'erne ved -80 ° C indtil brug.
      4. Vurdere kvaliteten af ​​RNA'et ved hjælp af 1% TAE-gelerne, der rutinemæssigt anvendes til DNA-elektroforese. Kør 200-400 ng af DNA-skabelonen og det tilsvarende sgRNA i parallel. RNA-båndet (≈ 100 bp) bør være lidt større end DNA-båndet (se figur 3A ).

3. Donorskabelon

  1. Bestil kommercielt syntetiserede enkeltstrengede oligonukleotider (ssOligos, se Materialetabellen ) til punktmutationer eller til integration af små sekvenser op til 50 bp; Homologi arme er typisk 60-90 bp lange.
  2. Ved større indsætninger skal du bruge et donorplasmid som en skabelon. Generer et egnet plasmid under anvendelse af enten den klassiske kloningsmetode eller de novo- syntese fra aKommerciel kilde.
    BEMÆRK: Mindst 800 bp pr. Homologiarm anbefales. Størrelsen af ​​rygraden har ingen indflydelse på effektiviteten af ​​homologi direkte reparation (HDR).

4. Injektionsblanding

  1. Fortynd Cas9 mRNA til 50 ng / μl og sgRNA'erne til 12,5 ng / μl (25 ng / μl i alt) ved anvendelse af nukleasefri mikroinjektionsbuffer til gen-knockout-eksperimenter. Tilsæt donorskabelonen (ssOligo eller plasmidet) ved en koncentration på 200 ng / μl for genomreaktionsforsøg baseret på homologi direkte reparation.
    BEMÆRK: Fortyndingsvolumener kan let bestemmes ved hjælp af onlineværktøjer, som f.eks. En resuspension-regnemaskine 18 .
  2. Hold hver alikvot på is under mikroinjektionssessionen og kassér efterfølgende (frys ikke injektionsblandingen igen).

5. Skrotal vasektomi

BEMÆRK: To typer vasektomi udføres normalt hos mus: abdominal og skrotal. Det sidsteEr mindre invasiv og har tidligere været beskrevet 15 .

  1. Autoklaver alle rustfrit stål kirurgiske instrumenter.
  2. Bestem musens vægt ved hjælp af en vægtskala og bedøve mændene ved intraperitoneal (ip) injektion med injicerbare anæstetika (ketamin 100 mg / kg, xylazin 10 mg / kg).
  3. Overvåg tabet af tåhindereflex, og når musen er sederet, placer den oven på en varmepude.
  4. Desinficere huden omkring testiklerne med alternerende klud af et topisk antiseptisk middel, såsom chlorhexidin og 70% ethanol.
  5. Skub testiklerne ind i scrotal sac og lav et hudindsnit med en skalpel.
  6. Visualiser testiklerne, cauda epididymis og vas deferens.
  7. Grib vas deferens med pincet, hold det og cauterize på hver side af pincet for at fjerne 3 mm af vas deferens.
  8. Udfør samme procedure på den anden testis.
  9. Luk hudens snit med sårklip og monitorerMus tæt til fuld genopretning.

6. Superovulation (Oocytes Donors) og Time-pairing (Pseudo-pregnant Females)

BEMÆRK: Teknikken til at generere et passende antal befrugtede oocytter og plugged fosterhunner til reimplantation er blevet beskrevet andetsteds 15 .

  1. Injicer 10 hunner ip med 5 IE af gravid mares serumgonadotropin (PMSG, i 100 μl) ca. kl 12 på dag 1.
  2. Injicer hunner ip med 5 IE af human choriongonadotropin (hCG i 100 μl) 46-48 timer senere (ca. kl 11 på dag 3).
  3. Omgående mage hunnerne med single-housed mænd over natten.

7. Pronukleære (random-integration) og cytoplasmatiske (gen-targeting) injektioner

  1. Cull de superovulerede mus ved cervikal dislokation, udslæt abdomen og få adgang til æggestokkene og ovidukterne, som tidligere beskrevet 15 . Dissect oViducts og høste cumulus-oocyt-komplekserne (COC'er) under en stereomicorskop 15 . Placer dem i en dråbe kalium simplex optimeringsmedium suppleret med aminosyrer (KSOMaa) efter den traditionelle metode 15 .
  2. Rens oocyterne ved at tilsætte ca. 1 μl hyaluronidase (10 mg / ml) til dråbe KSOMaa-medium ved anvendelse af et aspiratormundstykke og sæt skålen i en 37 ° C / 5% CO2-inkubator i 30 s til 1 min.
  3. Vask oocytterne med 4 friske dråber KSOMaa medium ved hjælp af aspirator mundstykket og overfør dem til en sidste dråbe KSOMaa medium overlejret med mineralolie (ca. 2 ml). Placer fadet i 37 ° C / 5% CO 2 inkubatoren, indtil oocytterne er klar til injektion.
  4. Pronukleær injektion (tilfældig integration).
    1. Visualiser æggene under det stereoskopiske mikroskop og overfør ca. 50 æg til injektionskammeret (aP af M2 medium overlejret med mineralolie) ved hjælp af aspirator mundstykket.
    2. Overfør indsprøjtningskammeret til det inverterede mikroskop og injicér de befrugtede oocytter (to synlige pronuclei) med et par picoliters af injektionsblandingen, der målretter mod en pronucleus (hvilken som helst af prækuklerne kan målrettes). Visualiser en vellykket injektion ved at observere pronucleus hævelse.
  5. Cytoplasmisk injektion (genmålretning).
    1. Overfør ca. 50 æg til en dråbe KSOMaa indeholdende 5 μg / ml Cytochalasin B ved hjælp af mundstykket og inkuber i 5 minutter i 37 ° C / 5% CO2-inkubatoren.
    2. Overfør æggene til injektionskammeret med mundstykket.
    3. Injicer få picoliters af injektionsblandingen i cytoplasma ved meget lavt tryk (50-100 hPa) ved hjælp af kompensationstrykket fra den automatiserede mikroinjektor, hvor det er muligt.
    4. Efter injektion, overfør oocytterne tilbage til en dråbe KSOMaa (ved hjælp af mundstykket) og opbevar dem i 37 ° C / 5% CO 2 inkubatoren, indtil de er indlæst til reimplantation i ovidukten af ​​pseudo-gravide kvinder.

8. Reimplantation

  1. Autoklaver alle rustfrit stål kirurgiske instrumenter.
  2. Bestem musens vægt ved hjælp af vægtskalaen og bedøve hunner ved intraperitoneal (ip) injektion med injicerbare anæstetika (ketamin 100 mg / kg, xylazin 10 mg / kg).
  3. Overvåg tabet af tåhindereflex, og når musen er sederet, placer den oven på en varmepude.
  4. Klip et stort område af pelsen omkring den dorsale midterlinje af den kvindelige mus.
  5. Desinficér den eksponerede hud med alternerende klud af et topisk antiseptisk middel som chlorhexidin og 70% ethanol.
  6. Udsæt reproduktive kanaler efter traditionel metode 15 . Lav et 1 cm langt hudindsnit parallelt med den dorsale midterlinie, skær muskelen og tag fat i fedtpudenEn pincet, og træk forsigtigt ovnen ud, indtil den vedhæftede æggeblomme og livmoderen er tydeligt synlige.
  7. Fastgør fedtpladen med en skibsklemme. Visualiser oviduktet under det stereoskopiske mikroskop, og brug et par mikroskærer til et snit i oviduktets væg få millimeter opstrøms for ampulla.
  8. Under det stereoskopiske mikroskop skal 25 mikroinjicerede æg anbringes i glaskapillæret, der er forbundet med mundstykket (kapillærens indre diameter skal være omkring 120 μm bred). Indfør glaskapillæret i oviducten og udstød, indtil en luftboble er synlig inden i ampulla.
  9. Fjern forsigtigt glaskapillaret og læg reproduktive kanaler tilbage i maven. Sutur snit med 3-0 ikke-absorberbare kirurgiske suturer, og luk derefter med sårklip. Overvåg musen nøje indtil fuld genopretning.

9. Genotyping Strategier / Sequencing

BEMÆRK: Isolér det genomiskeDNA fra 2 mm hale- eller ørebiopsier, i henhold til relevante dyreetikbestemmelser.

  1. Hurtig genomisk DNA-ekstraktion (tilfældig integration).
    1. Lyse vævsprøverne (~ 2 mm) ved 95 ° C i 1 time i 100 μl alkalisk lysereagens (25 mM natriumhydroxid og 0,2 mM EDTA, pH = 12).
    2. Tilsæt 100 μl neutraliserende reagens (40 mM Tris-HCI, pH = 5).
    3. Centrifuger i 5 minutter ved 12.000 g og 4 ° C.
  2. Højkvalitets genomisk DNA-ekstraktion (genmålretning).
    1. Tilsæt 500 μL halebuffer (50 mM Tris, pH = 8; 100 mM EDTA, pH = 8; 100 mM NaCl; 1% SDS og 0,5 mg / ml proteinase K, frisk tilsat).
    2. Inkubér natten over ved 55 ° C.
    3. Bland i 5 min ved invertering (ikke vortex).
    4. Tilsæt 250 μl mættet NaCl (6 M) og bland i 5 minutter ved invertering (ikke vortex).
    5. Spin i 5-10 minutter ved 12.000 xg og 4 ° C, og hæld supernatanten i nyt rør. Tilsæt 500 μl isopropanol og bland i 5 minutter ved invertering (ikke vortex).
    6. Spin i 10 minutter ved 12.000 xg og stuetemperatur.
    7. Dekanter supernatanten (pelleten er usynlig og stikker til røret).
    8. Vask med 1 ml 70% ethanol.
    9. Spin i 5-10 minutter ved 12.000 xg og stuetemperatur. Fjern supernatanten forsigtigt, da den hvide pille ikke er klæbrig længere og kan gå tabt.
    10. Luft tør det i ~ 1 time.
    11. Tilsæt 400 μl TE buffer (10 mM Tris og 1 mM EDTA, pH = 8).
    12. Opløs DNA'et ved 55-60 ° C i 2 timer.
  3. Primer design.
    1. Design primere mindst 20 bp lang ved hjælp af et beregningsværktøj 19 .
      BEMÆRK: For tilfældig integration skal primrene hybridisere med transgenet, hvilket genererer et særskilt fragment på 200-800 bp. For genmålretning design primrene således, at de hybridiserer med det genomiske DNA, der genererer en distinktiv fUdsagn et par hundrede bp omkring de skårne steder. Til store insertioner kan primrene sidde på transgenet, men bekræftelse af målrettet integration skal efterfølgende udføres ved anvendelse af primervandring eller lignende teknik.
  4. PCR genotyping.
    1. For hver genomisk modifikation skal du designe en ny PCR-protokol og teste den empirisk. Overvej længden af ​​det dannede fragment og smeltetemperaturen (Tm) for hvert par af primere.
  5. Sekventering.
    1. Til genmålretning send PCR-produkter til en Sanger-sekventeringsudbyder.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Nedenfor beskrives arbejdsprocesserne for mikroinjektion i tilfælde af tilfældig integration og CRISPR-medieret genmålretning ( Figur 1 ).

figur 1
Figur 1: Typisk arbejdsstrøm til generering af genetisk modificerede mus. Til tilfældig integration injiceres det oprensede transgen i pronucleus af befrugtede oocytter før ovidukt overførsel til plugged fosterhunner. Analyse af afkom udføres ved PCR efter en hurtig genomisk DNA-ekstraktion. Til CRISPR-genmåling syntetiseres sgRNA'er ved anvendelse af den her beskrevne ikke-kloningsmetode, og to guider co-injiceres (sammen med Cas9 mRNA) i cytoplasmaet af befrugtede oocytter. Denne strategi anvendes til den efterfølgende PCR-baserede analyse af afkom, hvilket kræver meget renset gEnom DNA. Klik her for at se en større version af denne figur.

Selvom mikroinjektionen af ​​oocytter og reimplantationen af ​​disse injicerede æg er de to hovedbegrænsende trin, der kræver tekniske færdigheder og træning, er kvaliteten af ​​injektionsblandingen af ​​største vigtighed for succesfuldt at generere genetisk modificerede mus. Kvaliteten af ​​transgenrensningen ( Figur 2A ) og sgRNAs-syntesen ( Figur 3A ) bør systematisk vurderes på analytiske agarosegeler. Potentielle forureninger af blandingen bør også kontrolleres ved måling af koncentrationerne med et spektrofotometer, da de forskellige absorptionsværdier er direkte afhængige af opløsningens renhedsgrad (se trin 1.2.3, 2.2.3.5 og 2.2.5.3).

figur 2B ) og for genmålretning ( figur 3B ). DNA-ekstraktionsprotokollerne er også forskellige afhængigt af typen af ​​eksperimenter; Efterfølgende PCR'er er afhængige af primere, der hybridiserer enten på transgenet eller på det genomiske DNA. De strategier, der præsenteres her, muliggør nem fejlfinding og strømlining af hvert trin, der kræves for at producere genetisk modificerede mus.

Skønt det kvantitative udfald af en mikroinjektionssession varierer afhængigt af eksperimentatorens erfaringer, når hvert trin af protokollen er optimeret, skal procentdelen af ​​transgene pupper typisk nå 10-25% for tilfældigt integreretRation som vist i figur 2B (4 grundlæggere ud af 15 pupper født = 26,6%). Denne lidt "lave" effektivitet står i kontrast til CRISPR-komponenternes pålidelige evne til at redigere musegenomet. Faktisk er antallet af grundlæggere genereret generelt højere ved anvendelse af CRISPR til genmålretning og varierer fra 25-100% (se figur 3B ; 3 grundlæggere ud af 13 pups = 23%). Det er ikke ualmindeligt at få et helt afkom, der med succes er homozygot, når de redigeres ved hjælp af CRISPR.

Figur 2
Figur 2: Kvalitetskontrol og genotypestrategi for succesfuld produktion af transgene mus til overekspression. ( A ) Plasmidet fordøjes i 1 time med PvuI og NotI. Komplet fordøjelse og korrekte størrelser ( dvs. transgen = 7,338 bp, rygrad = 1,440+ 896 bp) kontrolleres på en analytisk gel (1). Ekstraktionen af ​​adskillige fordøjelsesprodukter fra den præparative gel (2) frembringer en øget koncentration af transgenet. Langvarig udsættelse for UV bør undgås, og brug af et blåt lys i stedet for en UV-transilluminator anbefales. (B) Genotypestrategi (1): Primerne skal sidde på transgenet og bør konstrueres til at generere et fragment på 200-800 bp. Når genotypning udføres (2), anbefales det at inkludere en positiv kontrol ( dvs. injektionsblandingen anvendt til mikroinjektion) og en negativ kontrol ( dvs. genomisk DNA fra en WT-mus). Klik her for at se en større version af denne figur.

Figur 3
Figur 3: Kvalitetskontrol og genotyping StraTegy for den vellykkede produktion af gen-målrettede (KO) mus. ( A ) Kvaliteten af ​​sgRNA'erne produceret ved in vitro transkription vurderes ved at køre DNA-skabelonen og det genererede RNA parallelt for hver guide. Størrelsen af ​​RNA er lidt større end DNA'et. Skal kvaliteten være tilfredsstillende ( dvs. ingen smørebånd) måles koncentrationerne. ( B ) (1) Design af de to guider (modsatte retninger), der omfatter startkodonet i Exon 1. Primerne vælges for at hybridisere med det genomiske DNA uden for regionen, som til sidst skæres af de to guider. Denne strategi muliggør typisk direkte identifikation af heterozygote (# 5 og 9) og homozygote (# 3) KO-grundstoffer ved anvendelse af PCR (2). PCR-produkter fra homozygote dyr viser ikke noget WT-band. Klik her for at se en større version af denne figur.

Reaktion komponenter Bind Bemærk Syntese af lineær DNA-skabelon
(2.5) Nukleasefrit vand 97,2 μl 5x HF buffer 36 μl MgCl2 9 μl 10 mM dNTP'er 9 μl 10 μM fwd primer 9 μl 5'TTAATACGACTCACTATAGN 20
gttttagagctagaaatagcaagttaaaata
Aggctagtc 3 ' 10 μM rev primer 9 μl 5 'AAAAGCACCGACTCGGTGCC 3' prO-læsepolymerase 1,8 μl IVT ved anvendelse af et T7 RNA syntese kit
(2.6) Nukleasefrit vand X μL Fyld op til 20 μL total volumen NTP buffer mix 10 μl Skabelon DNA ≈ 300 ng T7 RNA polymerase 2 μl

Tabel 1: Sammensætning af de forskellige masterblandinger anvendt i denne undersøgelse. Syntese af den lineære DNA-template: T7-promotorens minimale sekvens (TTAATACGACTCACTATAG) er opstrøms for 20-bp-sekvensen (vejledning; N20 identificeret ved anvendelse af CRISPR-designværktøjet) og en sekvens komplementær til ekspressionsvektoren (gttttagagctagaaatagcaagttaaaataaggctagtc). In vitroTranskription (IVT): Afhængigt af koncentrationen af ​​DNA-skabelonen bør det endelige volumen justeres til 20 μl med nukleasefrit vand.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Kritiske trin i protokollen

Genereringen af ​​genetisk modificerede mus er kendt for at være teknisk udfordrende. Protokollen, der præsenteres her, er imidlertid en optimeret og forenklet metode, der gør det muligt for en at mestre og fejlfinding teknikken i rekordtid. Der er to trin nødvendige for en vellykket gennemførelse af teknikken. For det første kan syntesen af ​​lineære DNA-skabeloner (til syntese af sgRNA'er) opnås uden magnesiumchlorid (MgCl2). Det anbefales dog stærkt at tilføje MgCl2 til masterblandingen, fordi den delvise hybridisering af den fremadrettede primer ofte forhindres i mangel af MgCl2. Derudover er det kritisk, at den målrettede genomiske sekvens ikke er til stede i nogen del af donorskabelonen (i tilfælde af målrettet integration), ellers vil Cas9 nukleasen skære det og forhindre forekomsten af ​​HDR.

ÆndringerOg fejlfinding

Skønt denne protokol til generering af genetisk modificerede mus er blevet optimeret og strømlinet gennem årene, er der nogle overvejelser vedrørende udbyttet af oocytter af god kvalitet til mikroinjektion og tilslutningsgraden hos fosterhunner. Valget af baggrundsstammen er kritisk i forhold til antallet af levende popper, der stammer fra en mikroinjektionssession. C57BL / 6 er den mest almindeligt anvendte baggrund for musemodeller af sygdomme. Det er imidlertid også en af ​​de mindre effektive baggrunde i form af resistens overfor mikroinjektion 20 . Endvidere er kvindens alder også kritisk for at give et stort antal oocytter; Det anbefales at undgå mus 5-8 uger, uanset baggrunden, da dette er den mindst gunstige reaktionsperiode på hormonel stimulering 21 . I vores erfaring giver 3 til 4 ugers gamle C57BL / 6 mus pålideligt 20-30 æg pr. Kvinde. Det er vigtigt atBemærk, at en ny teknik (kaldet ultra superovulation) har produceret op til 100 æg pr. Kvinde og er for nylig blevet anvendt til at generere oocytter til mikroinjektion 22 . Imidlertid er anvendelsen af ​​ultra superovulering til mikroinjektion generelt hæmmet af behovet for kunstigt befrugtning ( in vitro befrugtning) et så stort antal æg.

For at opnå plugged fosterhunner, der er egnede til reimplantation, er hunmus parret med vasektomiserede hanner (baggrunden for disse mus er ikke kritisk). For at øge antallet af tilsluttede modtagere kan der foretages en omhyggelig undersøgelse af scenen af ​​østrus og udvælgelsen af ​​egnede kvinder 23 . Synkronisering af kvinders cykler kan også induceres ved at udsætte hunner for vasektomiserede mænd to dage før parring (den såkaldte "Whitten effect") 24 .

Begrænsninger af teknikken

Meget små genomiske modifikationer, såsom punktmutationer, er relativt nemme at generere, men de er vanskelige at identificere. Når genotypning udføres, sekvenseres PCR-produkterne direkte ved Sanger-sekventering. Imidlertid genererer den direkte mikroinjektion af CRISPR-komponenter i musococytter ofte mosaikdyr, fordi Cas9 forbliver aktiv i nogen tid, og forskellige genomiske modifikationer kan forekomme efter den første opdeling af oocyten. Denne konfronterende virkning komplicerer identifikationen af ​​diskrete mutationer blandt forskellige alleler, og næste generations sekventering (NGS) kan hjælpe med udfordrende udlæsninger. Følsomme teknikker, såsom tetra-primerARMS-PCR, 25 kan også hjælpe med genotyping af kolonien efter identifikation af grundlæggerne ved sekventering.

Omvendt er det stadig udfordrende at indsætte store stykker DNA på målrettet måde. Jo større det eksogene DNA, jo mindre effektiviteten af ​​HDR. Følgelig udvikles nye strategier, såsom brug af lange ssOligos-donorer (i stedet for plasmider) 26 eller HDR-uafhængig målrettet integration 27 .

Betydningen af ​​protokollen

Denne protokol præsenterer betydelige fremskridt, fordi de fire hovedtrin ( dvs. forberedelse af transgen- eller CRISPR-komponenterne, mikroinjektion, reimplantation og genotyping) er optimeret, testet og valideret i vores laboratorium.

Den tilfældige integration af transgener anvendes i vid udstrækning til overekspressionsundersøgelser af to hovedårsager. For det første at undgåId den potentielle "positioneffekt" er målrettet integration af et transgen, der anvender CRISPR i "safe harbor" loci, såsom Rosa26 28 og Col1a 29 loci, fortsat notorisk udfordrende, da effektiviteten af ​​HDR er lav. Strategier til at løse dette problem er kommende 26 , 27 , men tilfældig integration har hidtil vist sig mere effektiv. Desuden er generationen af ​​flere transgene linier, der overudtrykker det samme transgen med forskellige niveauer af ekspression, af interesse i undersøgelser, der involverer behandlingsstrategier for at omdanne en fænotype 30 . Plasmidbaserede transgene genereres ved hjælp af middel til kloning ved anvendelse af ad hoc- restriktionsenzymer til at samle essentielle fragmenter til ekspressionen af ​​et protein af interesse. Generelt er et transgen lavet af mindst tre elementer: en egnet promotor (forøgende regioner tilføjes nogle gange); KodningenSekvens (cDNA), med eller uden introniske regioner; Og en PolyA-hale til stabilisering af mRNA-ekspression 31 .

Efter montering indføres transgenet i et plasmid indeholdende bakterielle replikationselementer og ekspanderes i kultur efter transformation (typisk varmchokbaseret). Oprensningsmetoden for transgene til mikroinjektion er kritisk. Dette værk beskriver anvendelsen af ​​DNA-pletter med ny generation (lavtoksicitet) til mere præcis visualisering af fragmentet af interesse på gelen (sammenlignet med traditionel krystalviolet) og af lav mutagen eksponering (sammenlignet med ethidiumbromid).

Ikke-kloningsmetoden beskrevet heri til genmålretning er meget hurtig og tillader syntese af flere sgRNA'er på kun 5-6 timer. Der kræves kun fire trin: identifikationen af ​​den målrettede sekvens, syntesen af ​​en lineær DNA-template, der indeholder en T7-promotor og den valgte målsekvens, syntesen oF sgRNA ved in vitro transkription (IVT) og rensning af sgRNA ved anvendelse af spin-søjler.

I den tidlige alder af CRISPR-musegenometredigeringen blev den potentielle off-target-effekt vurderet systematisk, selv om det har vist sig at være meget begrænset i musembryoer 32 og let kan fortyndes ud ved hjælp af et avlskema, hvor udvalgte mus bærer kun Den ønskede genomiske modifikation. On-target-aktivitet blev også systematisk forhåndsevalueret in vitro ved hjælp af forskellige guider og udvælgelse af de mere aktive (e) 12 . Denne praksis er nu mindre almindelig af flere grunde. For det første vurderes on-mål-aktiviteten ved anvendelse af transfektion af immortaliserede musecellelinier (typisk N2a eller NIH3T3) med CRISPR-kodende plasmider. Dette er en anden metode end injektionen af ​​CRISPR RNA-komponenter i musococytter. Derfor oversætter de resultater, der findes in vitro , ikke altid ligeTil oocytter. Ydermere viste høj gennemløbsforsøg, at de fleste guider er aktive 33 . Følgelig er on-target-aktivitet ikke vurderet, og der har hidtil ikke været tegn på en vejledning, der viser ingen aktivitet i mus-oocytter. Sammen med ikke-kloningsmetoden til syntetisering af sgRNA'er, der præsenteres her, forenkles og effektiviserer workflowen meget, og flere aktive guider kan sømløst syntetiseres på en dag.

CRISPR betragtes som en "forstyrrende teknologi", som er en innovation, der ændrer måden teknikker udføres på. Når mikroinjektion blev etableret, fandt Brinster et al. Viste, at cytoplasmatisk transgenese, selv om det var opnåeligt, forblev for det meste ineffektivt 7 . Følgelig forblev prækuklear mikroinjektion den eneste almindelige praksis i næsten 30 år indtil den første demonstration af et vellykket CRISPR-genmålretning i mus. Denne undersøgelse viste, at cytoplasmisk mikroinjektion Ion kunne generere et lignende eller overlegen resultat sammenlignet med pronukleær afgivelse 12 . Da CRISPR-komponenter typisk er lavet af RNA, er det klart, at cytoplasma er målrettet. Selv når donorskabeloner injiceres i cytoplasmaet, kan det imidlertid også med succes fremkalde HDR. En høj cytoplasmatisk koncentration af skabeloner muliggør deres diffusion i kernen. Desuden er anvendelsen af ​​piezo-drevet cytoplasmisk mikroinjektion 16 ikke et krav. En kort inkubation af oocytterne med en cytoskeletonhæmmer, såsom Cytochalasin B, øger overlevelsen af ​​oocytterne 34 , 35 , hvilket gør det tilstrækkeligt at udføre cytoplasmatiske injektioner uden et piezo-slagdrevsystem. Ligeledes nedsætter brugen af ​​et forbedret dyrkningsmedium, såsom KSOMaa, blokeringen i tocelle-stadiet og forbedrer embryonernes udviklingskapacitet i forhold til M16-mediumXref "> 36.

En-celle eller to-celle (når dyrket natten over) kan embryoner overføres til ovidukten. Den konventionelle procedure er ganske invasiv, da det kræver at rive bursa, der beskytter æggestokken. Det er også teknisk udfordrende, fordi glaskapillæret skal indsættes i infundibulum 15 . Metoden, der præsenteres her, er meget lettere at lære, fremkalder ikke potentiel blødning og bevarer ægthedets integritet. Det er baseret på arbejde udviklet på Kumamoto University 37 .

Genotypestrategier og sekventeringsteknikker er afgørende for at identificere potentielle grundlæggere. Til tilfældig integration er ekstraktionen af ​​genomisk DNA baseret på en simpel metode tilpasset Truett et al. 38 . En sådan hurtig ekstraktionsmetode er tilstrækkelig til at identificere potentielle grundlæggere, da primrene er konstrueret til at hybridisere med transgenet (ofte integreretAted som flere kopier). Omvendt kræver genmålretning meget renset genomisk DNA, da PCR-produktet omfatter den modificerede genomiske region.

Til gen-knockout genererer den traditionelle metode til indsprøjtning af et enkelt sgRNA små deletioner (indeler) eller insertioner, der til sidst slår det gen af ​​interesse 12 ud . Disse små modifikationer er vanskelige at identificere og kræver ofte tidskrævende, ligaseuafhængig kloning og sekventering for at bekræfte arten af ​​disse mutationer.

I denne protokol benyttede vi CRISPR-multiplexing til at udvikle den systematiske injektion af to sgRNA'er, der omfatter startkodonet af et gen af ​​interesse. Dette øger ikke kun sandsynligheden for et gen-knockout, men også udskillelsen af ​​et stykke af genomisk DNA med en foruddefineret størrelse (100-300 bp), hvilket muliggør nem identifikation af grundlæggerne ved simpel PCR. Bemærk, hvalpe, der ikke bærer den forventede genomiske eXcision kunne stadig analyseres for små fremskiftsmutationer, da kun en sgRNA viste sig at være aktiv. Ligeledes i tilfælde af genredigering bør den systematiske injektion af to overlappende sgRNA'er i modsatte retninger øge effektiviteten af ​​HDR, da cellereparationsmekanismerne fortrinsvis bruger en af ​​de to tråde 39 .

Fremtidige applikationer

Den foreliggende protokol udnytter de seneste udviklinger i musembryologi og genmålretning 40 for at forenkle og strømline processen med at generere forskellige sofistikerede musemodeller af menneskelige tilstande. Disse modeller spiller en afgørende rolle for at bidrage til at udvikle vores forståelse af pathomechanisms, i sidste ende hjælpe med udvikling af terapeutiske strategier 2 . Optimeringen og strømlinningen af ​​reagenserne, der kræves til genmålretning eller tilfældig integration, er bredt og let anvendeligLe til andre pattedyrsarter, såsom rotter, kaniner og endda til store dyr som kvæg.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne giver akademiske transgenesetjenester i mus via University of New South Wales Mark Wainwright Analytical Center.

Acknowledgments

Forfatterne takker dyreanlægets personale (BRC) for deres løbende støtte. Dette arbejde blev finansieret af National Health and Medical Research Council og Australian Research Council.

Materials

Name Company Catalog Number Comments
Micropipette 0.1-2.5 μL Eppendorf 4920000016
Micropipette 2 - 20 μL Eppendorf 4920000040
Micropipette 20 - 200 μL Eppendorf 4920000067
Micropipette 100 - 1,000 μL Eppendorf 4920000083
Molecular weight marker  Bioline BIO-33025 HyperLadder 1 kb
Molecular weight marker  Bioline BIO-33056 HyperLadder 100 bp
Agarose Bioline BIO-41025
EDTA buffer Sigma-Aldrich 93296 10x - Dilute to 1x
Ethidium bromide Thermo Fisher Scientific 15585011
SYBR Safe gel stain Invitrogen S33102
Gel extraction kit Qiagen 28706
PCR purification kit (Qiaquick) Qiagen 28106
Vacuum system (Manifold) Promega A7231
Nuclease-free microinjection buffer  Millipore MR-095-10F
Ultrafree-MC microcentrifuge filter  Millipore UFC30GV00
Cas9 mRNA Sigma-Aldrich CAS9MRNA
CRISPR expressing plasmid (px330) Addgene 42230
Nuclease free water Sigma-Aldrich W4502
Phusion polymerase New England Biolabs M0530L
T7 Quick High Yield RNA kit New England Biolabs E2050S
RNA purification spin columns (NucAway) Thermo Fisher Scientific AM10070
ssOligos Sigma-Aldrich OLIGO STANDARD
Donor plasmid Thermo Fisher Scientific GeneArt
Hyaluronidase Sigma-Aldrich H3884
KSOMaa embryo culture medium Zenith Biotech  ZEKS-100
Mineral oil Zenith Biotech  ZSCO-100
M2 Medium Sigma-Aldrich M7167
Cytochalasin B Sigma-Aldrich C6762
Mouthpiece Sigma-Aldrich A5177
Glass microcapillaries Sutter Instrument BF100-78-10
Proteinase K Applichem A3830.0100
Dumont #5 forceps Fine Science Tools  91150-20
Iris scissors Fine Science Tools  91460-11
Vessel clamp Fine Science Tools  18374-43
Wound clips  Fine Science Tools  12040-01
Clips applier  Fine Science Tools  12018-12
Micro-scissors  Fine Science Tools  15000-03
Cauterizer Fine Science Tools  18000-00
Non-absorbable surgical sutures (Ethilon 3-0) Ethicon 1691H
5% CO2 incubator MG Scientific Galaxy 14S
Spectrophotometer Thermo Fisher Scientific Nanodrop 2000c
Thermocycler Eppendorf 6321 000.515
Electrophoresis set up BioRad 1640300
UV Transilluminator BioRad 1708110EDU
Thermocycler Eppendorf 6334000069
Stereoscopic microscope Olympus SZX7
Inverted microscope Olympus IX71
2x Micromanipulators Eppendorf 5188000.012
Oocytes manipulator Eppendorf 5176000.025
Microinjector (Femtojet) Eppendorf 5247000.013
Mice C57BL/6J strain Australian BioResources C57BL/6JAusb 

DOWNLOAD MATERIALS LIST

References

  1. Ittner, L. M. Dendritic function of tau mediates amyloid-beta toxicity in Alzheimer's disease mouse models. Cell. 142, (3), 387-397 (2010).
  2. Ittner, A. Site-specific phosphorylation of tau inhibits amyloid-beta toxicity in Alzheimer's mice. Science. 354, (6314), 904-908 (2016).
  3. Marantz Henig, R. The Monk in the Garden. Mariner books. (2000).
  4. Jaenisch, R., Mintz, B. Simian virus 40 DNA sequences in DNA of healthy adult mice derived from preimplantation blastocysts injected with viral DNA. Proc Natl Acad Sci U S A. 71, (4), 1250-1254 (1974).
  5. Gordon, J. W., Ruddle, F. H. Integration and stable germ line transmission of genes injected into mouse pronuclei. Science. 214, (4526), 1244-1246 (1981).
  6. Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A., Ruddle, F. H. Genetic transformation of mouse embryos by microinjection of purified DNA. Proc Natl Acad Sci U S A. 77, (12), 7380-7384 (1980).
  7. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Yagle, M. K., Palmiter, R. D. Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc Natl Acad Sci U S A. 82, (13), 4438-4442 (1985).
  8. Capecchi, M. R. Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century. Nat Rev Genet. 6, (6), 507-512 (2005).
  9. Carbery, I. D. Targeted genome modification in mice using zinc-finger nucleases. Genetics. 186, (2), 451-459 (2010).
  10. Sung, Y. H. Knockout mice created by TALEN-mediated gene targeting. Nat Biotechnol. 31, (1), 23-24 (2013).
  11. Jinek, M. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  12. Wang, H. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  13. Kang, X. Introducing precise genetic modifications into human 3PN embryos by CRISPR/Cas-mediated genome editing. J Assist Reprod Genet. 33, (5), 581-588 (2016).
  14. Liang, P. CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes. Protein Cell. 6, (5), 363-372 (2015).
  15. Ittner, L. M., Götz, J. Pronuclear injection for the production of transgenic mice. Nat Protoc. 2, (5), 1206-1215 (2007).
  16. Yang, H., Wang, H., Jaenisch, R. Generating genetically modified mice using CRISPR/Cas-mediated genome engineering. Nat Protoc. 9, (8), 1956-1968 (2014).
  17. CRISPR DESIGN. Available from: http://crispr.mit.edu (2017).
  18. Integrated DNA Technologies. Resuspension Calculator. Available from: https://sg.idtdna.com/calc/resuspension/ (2017).
  19. BioTools at UMass Medical School. Primer3: WWW primer tool. Available from: http://biotools.umassmed.edu/bioapps/primer3_www.cgi (2017).
  20. Auerbach, A. B. Strain-dependent differences in the efficiency of transgenic mouse production. Transgenic Res. 12, (1), 59-69 (2003).
  21. Merriman, J. A., Jennings, P. C., McLaughlin, E. A., Jones, K. T. Effect of aging on superovulation efficiency, aneuploidy rates, and sister chromatid cohesion in mice aged up to 15 months. Biol Reprod. 86, (2), 49 (2012).
  22. Nakagawa, Y., et al. Ultra-superovulation for the CRISPR-Cas9-mediated production of gene-knockout, single-amino-acid-substituted, and floxed mice. Biol Open. 5, (8), 1142-1148 (2016).
  23. Byers, S. L., Wiles, M. V., Dunn, S. L., Taft, R. A. Mouse estrous cycle identification tool and images. PLoS One. 7, (4), e35538 (2012).
  24. Whitten, W. K. Modification of the oestrous cycle of the mouse by external stimuli associated with the male. J Endocrinol. 13, (4), 399-404 (1956).
  25. Ye, S., Dhillon, S., Ke, X., Collins, A. R., Day, I. N. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 29, (17), E88 (2001).
  26. Yoshimi, K., et al. ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat Commun. 7, 10431 (2016).
  27. Suzuki, K., et al. In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. (2016).
  28. Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 21, 70-71 (1999).
  29. Liu, X., et al. A targeted mutation at the known collagenase cleavage site in mouse type I collagen impairs tissue remodeling. J Cell Biol. 130, (1), 227-237 (1995).
  30. Ke, Y. D. Short-term suppression of A315T mutant human TDP-43 expression improves functional deficits in a novel inducible transgenic mouse model of FTLD-TDP and ALS. Acta Neuropathol. 130, (5), 661-678 (2015).
  31. Auerbach, A. B. Production of functional transgenic mice by DNA pronuclear microinjection. Acta Biochim Pol. 51, (1), 9-31 (2004).
  32. Iyer, V., et al. Off-target mutations are rare in Cas9-modified mice. Nat Methods. 12, (6), 479 (2015).
  33. Zhou, Y. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 509, (7501), 487-491 (2014).
  34. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Avarbock, M. R. Translation of globin messenger RNA by the mouse ovum. Nature. 283, (5746), 499-501 (1980).
  35. Pinkert, C. A., Irwin, M. H., Johnson, L. W., Moffatt, R. J. Mitochondria transfer into mouse ova by microinjection. Transgenic Res. 6, (6), 379-383 (1997).
  36. Biggers, J. D., Summers, M. C. Choosing a culture medium: making informed choices. Fertil Steril. 90, (3), 473-483 (2008).
  37. Nakagata, N. Embryo transfer through the wall of the fallopian tube in mice. Jikken Dobutsu. 41, (3), 387-388 (1992).
  38. Truett, G. E. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  39. Richardson, C. D., Ray, G., DeWitt, M. A., Curie, G. L., Corn, J. E. Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 34, (3), 339-344 (2016).
  40. Delerue, F., Ittner, L. M. Genome Editing in Mice Using CRISPR/Cas9: Achievements and Prospects. Clon. Transgen. 4, (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics