Generering av genetiskt modifierade möss genom mikroinjektion av oocyter

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Mikroinjektionen av musoocyter används vanligtvis för både klassisk transgenes ( dvs den slumpmässiga integrationen av transgener) och CRISPR-medierad geninriktning. Detta protokoll granskar den senaste utvecklingen inom mikroinjektion, med särskild tonvikt på kvalitetskontroll och genotypstrategier.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Delerue, F., Ittner, L. M. Generation of Genetically Modified Mice through the Microinjection of Oocytes. J. Vis. Exp. (124), e55765, doi:10.3791/55765 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Användningen av genetiskt modifierade möss har avsevärt bidragit till studier på både fysiologiska och patologiska in vivo- processer. Den pronukleära injektionen av DNA-expressionskonstruktioner i befruktade oocyter är den vanligaste tekniken för att generera transgena möss för överuttryck. Med införandet av CRISPR-teknik för geninriktning har pronukleär injektion i befruktade oocyter utvidgats till alstring av både knockout- och knock-möss. I detta arbete beskrivs förberedelsen av DNA för injektion och generering av CRISPR-guider för genriktning, med särskild tonvikt på kvalitetskontroll. Genotypförfarandena som krävs för identifiering av potentiella grundare är kritiska. Innovativa genotypstrategier som utnyttjar "Multiplexing" -funktionerna i CRISPR presenteras här. Kirurgiska procedurer beskrivs också. Tillsammans kommer protokollets steg att möjliggöra generering av genEtiskt modifierade möss och för efterföljande etablering av muskolonier för en uppsjö av forskningsfält, inklusive immunologi, neurovetenskap, cancer, fysiologi, utveckling och andra.

Introduction

Djurmodeller, både hos ryggradsdjur och ryggradslösa djur, har varit avgörande för att undersöka patofysiologin hos mänskliga tillstånd, såsom Alzheimers sjukdom 1 , 2 . De är också ovärderliga verktyg för att söka sjukdomsmodifierare och till sist utveckla nya behandlingsstrategier i hopp om ett botemedel. Även om varje modell har inneboende begränsningar är användningen av djur som hela systemiska modeller avgörande för biomedicinsk forskning. Detta beror på att den metaboliska och komplexa fysiologiska miljön inte helt kan simuleras i vävnadsodling.

Hittills är musen den vanligaste däggdjursarter som används för genetisk manipulation eftersom det har flera fördelar. De fysiologiska processerna och generna som är associerade med sjukdomar är starkt konserverade mellan möss och människor. Musen var det första däggdjuret som hade sitt fulla genom sekvenserade (2002), ett år före det mänskliga genotMig (2003). Bortsett från denna rikedom av genetisk information har musen god avelsförmåga, en snabb utvecklingscykel (6 veckor från befruktning till avvänjning) och en rimlig storlek. Alla dessa fördelar, i kombination med fysiologiska indikatorer, som tydliga färgfärger (krävs för övergångsstrategier) gjorde musen till en attraktiv modell för genetisk manipulation. I början av modern genetik började Gregor Mendel arbeta på möss innan han flyttade till växter 3 .

Genöverföringsteknik resulterade i genereringen av den första transgena musen över tre decennier sedan 4 , som ursprungligen skapades med hjälp av viral leverans. Forskare insåg emellertid snart att en av de viktigaste utmaningarna med mustransgenes var oförmågan att kontrollera ödet hos det exogena DNA. Eftersom den virala tillförseln av transgener i musokocyter resulterade i flera kopior som slumpmässigt integrerades i genomet, var möjlighetenY för att etablera efterföljande transgena linjer var begränsade.

En sådan begränsning övervinnades när Gordon et al. Genererade den första transgena muslinjen genom mikroinjektion 5 , 6 . Detta började epoken med rekombinant DNA-teknik, och parametrarna som påverkar resultatet av en mikroinjektionssession har studerats omfattande 7 . Även om mikroinjektion inte tillåter kontroll över transgenets integrationsplats (vilket slutligen resulterar i specifika uttrycksnivåer för varje grundmus), förblir den huvudsakliga fördelen med pronukleär mikroinjektion bildandet av concatemers ( dvs arrays av multipla kopior av transgenet, Kopplade i serie) före genomisk integration 5 . Denna egenskap har använts under åren för att etablera tusentals transgena muslinjer som överuttrycker en gen av intresse. Sedan dess har transgenes, aArtificiell modifiering av en organisms genom har i stor utsträckning använts för att identifiera rollen av enskilda gener i förekomsten av sjukdomar.

En ytterligare nyckelprestation för att manipulera musgenometet uppnåddes när Mario Capecchi framgångsrikt störde en enda gen i musen och öppnade genen för geninriktning 8 . Emellertid uppstod stora nackdelar snabbt från ES-cellbaserad geninriktning, inklusive utmaningarna att odla ES-celler, den något variabla graden av chimerism och processens längd ( dvs. 12-18 månader, minsta för att få musen) .

Nyligen har framsteg inom ny teknik, såsom manipulerade endonukleaser ( t.ex. zinkfingernukleaser (ZFN), transkriptionsaktivatorliknande effektornukleaser (TALEN) och klyvda regelbundna interspaced korta palindroma upprepningar (CRISPR / Cas9)) framkommit som alternativa metoder för att Påskynda processen med geninriktning i mikrofonE 9 , 10 . Dessa endonukleaser kan lätt injiceras i mus-oocyter genom mikroinjektion, vilket möjliggör generering av genriktade möss på så lite som 6 veckor.

Sedan den första rapporten om användningen av CRISPR för genomredigering 11 har detta bakteriellt adaptiva immunsystem ersatts ZFN och TALEN på grund av dess många fördelar, inklusive enkelheten i syntesen och förmågan att rikta flera loci på en gång (kallad multiplexering "). CRISPR användes först för geninriktning hos möss 12 och har sedan tillämpats på oräkneliga arter, från växter till människor 13 , 14 . Hittills finns det ingen rapport om en enda art som är resistent mot CRISPR genom redigering.

De två huvudbegränsande stegen i generationen av transgena möss är injektionen av oocyter och reimplantationenAv dessa oocyter till pseudo-gravida kvinnor. Fastän denna teknik har beskrivits av oss 15 och andra 16 har senaste tekniska förbättringar i musembryologi och genöverföringstekniker revolutionerat processen för att generera genetiskt modifierade möss. Dessa förbättringar kommer att beskrivas häri.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alla förfaranden har godkänts av University of New South Wales Animal Care and Ethics Committee.

1. Framställning av transgen (slumpmässig integration)

  1. Analytisk agarosgelelektrofores.
    1. Digestera plasmiden för att excisera transgen med lämpliga enzymer (1 timmars inkubation) eller snabba digereringsenzymer (15 till 30 min inkubation) i en termocykler enligt tillverkarens rekommendationer (se figur 2A och dess legend).
    2. Kasta en 1% tris-acetat-etylendiamintetraättiksyra (EDTA) (TEA) agarosgel, färgad med 0,5-1,0 μg / ml etidiumbromid (EtBr).
      OBS! Var försiktig när du använder EtBr; Det är en potent mutagen. Använd lämplig personlig skyddsutrustning (se säkerhetsdatabladet).
    3. Ladda en 1 kb molekylviktmarkör.
    4. Ladda de linjära fragmenten ( dvs transgen och ryggraden). Kör elektroforesen vid 100 V i 45 min.
    5. Visualisera gelén på en ultraviolett (UV) transilluminator för att kontrollera att matsmältningen är fullständig och för att bekräfta transgenes korrekta storlek ( dvs 7.333 bp, se figur 2A ).
  2. Preparativ agarosgelelektrofores.
    1. Kasta en 1% TAE agarosgel gel färgad med en lågtoxicitetsgelfärg. Ladda 8 alikvoter (1 μg vardera) av linjäriserad transgen utan en molekylviktmarkör och kör elektroforesen vid 100 V i 45 min. Använd en skalpell för att excise alla 8 band som motsvarar den linjäriserade transgenen.
    2. Extrahera DNA: n med hjälp av ett geluttagskit genom att följa tillverkarens rekommendationer (se materialet ).
      1. Smälta gelfragmenten vid 50 ° C i 1,5 ml rör i minst 15 minuter. Precipitera det med isopropanol och tillsätt sedan bindningsbufferten.
      2. Kombinera hela DNA genom att pipettera allt i en kolumn. Släpp ut i nukleasfri mikroinjektionsbuffert (8 mM Tris-HCl och 0,15 mM EDTA). Filtrera genom ett 0,22 μm mikrocentrifugfilter och centrifugera i 60 s vid 12 000 x g.
    3. Mät koncentrationen och kvaliteten på DNA med hjälp av en spektrofotometer. Kontrollera att A260 / A280-förhållandet är ca 1,8 ( dvs ingen förorening av proteiner) och A260 / A230-förhållandet är minst 2,0 ( dvs ingen förorening av organiska lösningsmedel). Späd ner till 3 ng / μl i nukleasfri mikroinjektionsbuffert, alikvot (20-50 μl) och frys vid -20 ° C.

2. Syntes av CRISPR-komponenter (genriktning)

  1. Cas9 mRNA.
    1. Späd Cas9 mRNA (erhållen från en kommersiell källa, se materialet ) till en koncentration av 1 μg / μl i nukleasfri mikroinjektionsbuffert.
    2. Aliquot i 2 μL och fri Ze vid -80 ° C.
  2. Enstegs RNA (SgRNA).
    1. Identifiera önskade två-måls genomiska sekvenser (guider) med hjälp av ett beräkningsverktyg som möjliggör minimal potentiell off-target-aktivitet 17 .
      1. För genknockout, välj systematiskt två guider som ligger några hundra baspar (bp) ifrån varandra, i motsatta riktningar och inkludera startkodonet av genen av intresse. För homologi direktreparation, välj två överlappande guider (om möjligt), i motsatta riktningar.
        Obs! Följande guider har till exempel nyligen injicerats med framgång för att störa den första exonen av TPM4.2- genen:
        Guide 1: 5 'CGCCATCCAGTTCGCGCTGC 3';
        Guide 2: 5 'CAGAACGATTGAGCTATGGC 3'
    2. Bestäm en uppsättning primers som beskrivs i Tabell 1 .
    3. Syntes en linjär DNA-mall.
      1. Späd px330Ref "> 12 plasmid till 10 ng / | il i nukleasfritt vatten.
      2. Förbered masterblandningen enligt tabell 1 . Lägg till polymeras i slutet och behåll masterblandningen på is.
      3. Blanda och dela upp det i 8 PCR-rör (19 μL / rör). Tillsätt 1 μl px330 per rör och kör PCR under följande förhållanden: 1 min vid 98 ° C; 40 cykler av 98 ° C under 10 s, 64 ° C i 30 s och 72 ° C i 15 s; Och en slutlig förlängning vid 72 ° C i 5 min. Håll vid 4 ° C.
      4. Rengör PCR-produkterna med hjälp av ett PCR-reningskit (se materialet ), en grenrör och en vakuumkälla (för snabbare bearbetning). Applicera maximal vakuumstyrka ( dvs. 8 mbar).
        1. Tillsätt 5 volymer (100 μl) bindningsbuffert till 1 volym av PCR-provet och blanda.
        2. Placera en (försedd) silikamembransspinnkolonn i ett (tillhandahållet) 2 ml uppsamlingsrör för centrifugering eller på manifolden för vakuumprocessening. För att binda DNA, applicera successivt alla 8 prov till kolonnen och vakuum eller centrifugera i 60 s vid 12 000 xg för varje belastning.
        3. För att tvätta, tillsätt 0,75 ml tvättbuffert (buffert PE) till kolonnen och vakuum eller centrifugera i 60 s vid 12 000 x g. Centrifugera kolonnen i 60 s vid 12 000 xg för att eliminera kvarvarande etanol.
        4. Placera kolonnen i ett rent 1,5 ml mikrocentrifugrör. För att eluera DNA tillsätt 30 μL nukleasfritt vatten till mitten av membranet, låt kolonnen stå i 1 min och centrifugera i 60 s vid 12 000 g.
      5. Mät koncentrationen med hjälp av en spektrofotometer; Vanligen bör koncentrationen vara 100 ng / μl eller högre. Kontrollera att A260 / A280-förhållandet är ca 1,8 ( dvs ingen förorening av proteiner) och A260 / A230-förhållandet är minst 2,0 ( dvs ingen förorening av organiska lösningsmedel).
    4. In vitro transkription med användning av en T7 RNA syntes kit.
      1. Förbered tHan mästerblandningen, såsom anges i tabell 1 , och inkuberas i 3 h vid 37 ° C i en termocykler. Tillsätt 28 μL nukleasfritt vatten och 2 μl DNase I och inkubera i ytterligare 15 minuter vid 37 ° C i en termocykler.
    5. RNA-rening med hjälp av spinnkolumner.
      1. Lös upp pulvret som finns i den tillförda spinnkolonnen i 650 μL nukleasfri mikroinjektionsbuffert, och försiktigt avlägsna alla luftbubblor. Häll röret och hydrat i 5 - 15 min vid rumstemperatur.
      2. Ta bort det blå locket längst ner och placera kolonnen i ett 2 ml rör. Centrifugera i 2 min vid 750 xg och rumstemperatur. Placera kolonnen i ett nytt 1,5 ml rör och applicera 50 μL av RNA-lösningen droppvis till mitten utan att röra kolonnväggen. Vrid kolonnen i 2 minuter vid 750 x g.
      3. Mät RNA-koncentrationen med hjälp av en spektrofotometer (det typiska utbytet av en reaktion är 30-50 μg). Kontrollera att A260 / A280-förhållandet är aRound 2.0 ( dvs ingen förorening av proteiner) och A260 / A230-förhållandet är minst 2,0 ( dvs ingen förorening med organiska lösningsmedel). Förvara sgRNA vid -80 ° C tills användning.
      4. Bedöm kvaliteten på RNA med hjälp av 1% TAE-gelerna som används rutinmässigt för DNA-elektrofores. Kör 200-400 ng av DNA-mallen och motsvarande sgRNA parallellt. RNA-bandet (≈ 100 bp) bör vara något större än DNA-bandet (se figur 3A ).

3. Donormall

  1. Beställa kommersiellt syntetiserade enkelsträngade oligonukleotider (ssOligos, se tabell över material ) för punktmutationer eller för integration av små sekvenser upp till 50 bp; Homologiska armar är typiskt 60-90 bp långa.
  2. För större insertioner använd en donatorplasmid som en mall. Generera en lämplig plasmid med användning av antingen den klassiska kloningsmetoden eller de novo- syntesen från aKommersiell källa.
    OBS: Minst 800 bp per homologarm är rekommenderad. Ryggradens storlek har ingen inverkan på effektiviteten hos homologi direktreparation (HDR).

4. Injektionsblandning

  1. Späd Cas9 mRNA till 50 ng / μl och sgRNA till 12,5 ng / μl (25 ng / μl totalt) med användning av nukleasfri mikroinjektionsbuffert för genknockout-experiment. Lägg till donormallen (ssOligo eller plasmiden) vid en koncentration av 200 ng / μl för genomreaktionsexperiment baserat på homologins direkta reparation.
    ANMÄRKNING: Spädningsvolymer kan enkelt bestämmas med hjälp av onlineverktyg, såsom en resuspenningsberäknare 18 .
  2. Håll varje alikvot på is under mikroinjektionssessionen och kassera därefter (frys inte injektionsblandningen igen).

5. Skrotal vasektomi

OBS: Två typer av vasektomi utförs vanligen hos möss: buk och skrot. Den senareÄr mindre invasiv och har tidigare beskrivits 15 .

  1. Autoklavera alla kirurgiska instrument i rostfritt stål.
  2. Bestäm musens vikt med hjälp av en viktskala och bedöva männen genom intraperitoneal (ip) injektion med injicerbar bedövning (ketamin 100 mg / kg, xylazin 10 mg / kg).
  3. Övervaka förlusten av tånklämningsreflexen och när musen är sedativ placera den ovanpå en värmepanna.
  4. Desinficera huden runt testiklarna med alternerande duk av ett aktuellt antiseptiskt medel såsom klorhexidin och 70% etanol.
  5. Skjut testiklarna i scrotalacken och gör en hud snitt med en skalpell.
  6. Visualisera testis, cauda epididymis och vas deferens.
  7. Ta fast deferenserna med pincett, håll den och torka på vardera sidan av tången för att ta bort 3 mm av deferenserna.
  8. Gör samma procedur på den andra testen.
  9. Stäng hudens snitt med sårklämmor och övervakaMusen nära tills full återhämtning.

6. Superovulation (Oocytes Donors) och Time-paring (Pseudo-pregnant Females)

OBS: Tekniken för att skapa ett lämpligt antal befruktade oocyter och pluggade fosterhonor för reimplantation har beskrivits någon annanstans 15 .

  1. Injicera 10 kvinnliga ip med 5 IE av gravidareens serumgonadotropin (PMSG, i 100 μl) klockan 12 på dag 1.
  2. Injicera kvinnorna ip med 5 IE av humant koriongonadotropin (hCG, i 100 μl) 46-48 h senare (klockan 11 på dag 3).
  3. Hantera omedelbart kvinnorna med ensamstående män över natten.

7. Pronukleära (random-integration) och cytoplasmatiska (gen-riktade) injektioner

  1. Kasta de superovulerade mössen genom cervikal dislokation, exponera buken och få åtkomst till äggstockarna och äggledarna, som tidigare beskrivits 15 . Dissect oViducts och skörda cumulus-oocytkomplexen (COC) under en stereomicorskop 15 . Placera dem i en droppe kalium simplex optimeringsmedium kompletterat med aminosyror (KSOMaa) enligt traditionell metod 15 .
  2. Rening av oocyterna genom att tillsätta ungefär 1 μl hyaluronidas (10 mg / ml) till droppen KSOMaa-medium med användning av en aspirator munstycke och placera skålen i en 37 ° C / 5% CO2 inkubator under 30 s till 1 min.
  3. Tvätta oocyterna med 4 färska droppar KSOMaa-medium med hjälp av aspiratorns munstycke och överför dem till en sista droppe KSOMaa-medium överlagrad med mineralolja (ca 2 ml). Placera disken i 37 ° C / 5% CO2-inkubatorn tills oocyterna är färdiga för injektion.
  4. Pronukleär injektion (slumpmässig integration).
    1. Visualisera ägget under stereoskopiskt mikroskop och överför ca 50 ägg till injektionskammaren (en droP av M2-medium överlagrad med mineralolja) med användning av aspiratorns munstycke.
    2. Överför injektionskammaren till det inverterade mikroskopet och injicera de befruktade oocyterna (två synliga pronuclei) med några picoliters av injektionsblandningen, riktade mot en pronucleus (vilken som helst av pronuclei kan riktas). Visualisera en framgångsrik injektion genom att observera svullnaden av pronucleus.
  5. Cytoplasmatisk injektion (genmålning).
    1. Överför ca 50 ägg till en droppe KSOMaa innehållande 5 μg / ml Cytochalasin B med munstycket och inkubera i 5 minuter i 37 ° C / 5% CO2-inkubatorn.
    2. Överför äggen till injektionskammaren med munstycket.
    3. Injicera några picoliters av injektionsblandningen i cytoplasman vid mycket lågt tryck (50-100 hPa), med hjälp av kompensationstrycket hos den automatiska mikroinjektorn där det är möjligt.
    4. Efter injektion, överför oocyterna tillbaka till en droppe KSOMaa (med munstycket) och håll dem i 37 ° C / 5% CO2 inkubatorn tills de laddas för reimplantation i ovidukten hos pseudo-gravida kvinnor.

8. Reimplantation

  1. Autoklavera alla kirurgiska instrument i rostfritt stål.
  2. Bestäm musens vikt med hjälp av vägen och bedöva kvinnorna genom intraperitoneal (ip) injektion med injicerbar bedövning (ketamin 100 mg / kg, xylazin 10 mg / kg).
  3. Övervaka förlusten av tånklämningsreflexen och när musen är sedativ placera den ovanpå en värmepanna.
  4. Klipp ett stort område av pälsen runt den kvinnliga musens dorsala mittlinje.
  5. Desinficera den exponerade huden med alternerande duk av ett aktuellt antiseptiskt medel, såsom klorhexidin och 70% etanol.
  6. Exponera reproduktivsystemet enligt traditionell metod 15 . Gör en 1 cm lång hudinsats parallell med dorsal mittlinjen, klipp muskeln och ta tag i fettkudden wiTh en pincett, dra försiktigt ut äggstocken tills dess fastsatta äggled och livmoder är tydligt synliga.
  7. Fixa fettkudden med en kärlklämma. Visualisera ovidukten under det stereoskopiska mikroskopet och använd ett snitt med en snitt i snittet i ovidukten några millimeter uppströms ampullen.
  8. Under det stereoskopiska mikroskopet laddas 25 mikroinjicerade ägg i glaskapillären som är ansluten till munstycket (kapillärens inre diameter bör vara ca 120 μm bred). Introducera glaskapillären i ovidukten och skjut ut tills en luftbubbla är synlig inuti ampullen.
  9. Ta försiktigt bort glaskapillären och placera reproduktionsorganet tillbaka i buken. Sutur snittet med 3-0 icke absorberbara kirurgiska suturer och stäng sedan med sårklämmor. Övervaka musen noggrant tills full återhämtning.

9. Genotypstrategier / sekvensering

OBS: Isolera den genomiskaDNA från 2 mm svans eller öronbiopsier, enligt gällande regler för djuretik.

  1. Snabb genomisk DNA-extraktion (slumpmässig integration).
    1. Lyse vävnadsproverna (~ 2 mm) vid 95 ° C under 1 h i 100 | il alkalisk lysreagens (25 mM natriumhydroxid och 0,2 mM EDTA, pH = 12).
    2. Tillsätt 100 | il neutraliserande reagens (40 mM Tris-HCl, pH = 5).
    3. Centrifugera i 5 minuter vid 12 000 g och 4 ° C.
  2. Högkvalitativ genomisk DNA-extraktion (geninriktning).
    1. Tillsätt 500 μL svansbuffert (50 mM Tris, pH = 8; 100 mM EDTA, pH = 8; 100 mM NaCl; 1% SDS och 0,5 mg / ml proteinas K tillsattes nyligen).
    2. Inkubera över natten vid 55 ° C.
    3. Blanda i 5 minuter genom att vända in (inte virvel).
    4. Tillsätt 250 μL mättad NaCl (6 M) och blanda i 5 minuter genom inverterning (inte virvel).
    5. Snurra i 5-10 minuter vid 12 000 xg och 4 ° C och häll supernatanten i ett nytt rör. Tillsätt 500 μL isopropanol och blanda i 5 minuter genom att vända in (inte virvel).
    6. Spinn i 10 minuter vid 12 000 xg och rumstemperatur.
    7. Dekantera supernatanten (pelleten är osynlig och håller fast vid röret).
    8. Tvätta med 1 ml 70% etanol.
    9. Snurra i 5-10 min vid 12 000 xg och rumstemperatur. Ta bort supernatanten med försiktighet, eftersom den vita pelleten inte är klibbig längre och kan gå vilse.
    10. Lufttorka det här i ~ 1 h.
    11. Tillsätt 400 μl TE-buffert (10 mM Tris och 1 mM EDTA, pH = 8).
    12. Lös DNAet vid 55-60 ° C under 2 timmar.
  3. Primer design.
    1. Design primers minst 20 bp lång med hjälp av ett beräkningsverktyg 19 .
      ANMÄRKNING: För slumpmässig integration ska primrarna hybridisera med transgen, vilket genererar ett distinkt fragment på 200-800 bp. För genriktning, utforma primrarna så att de hybridiserar med det genomiska DNA, vilket genererar ett distinkt fRadera några hundra bp runt de skurna platserna. För stora insertioner kan primrarna sitta på transgenen, men bekräftelse av den riktade integrationen ska därefter utföras med primervandring eller liknande teknik.
  4. PCR genotyping.
    1. För varje genomisk modifiering, designa ett nytt PCR-protokoll och testa det empiriskt. Tänk längden på det genererade fragmentet och smälttemperaturen (Tm) för varje par av primrar.
  5. Sekvensering.
    1. För genriktning, skicka PCR-produkter till en Sanger-sekvenseringsleverantör.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Nedan beskrivs arbetsflödena för mikroinjektion i fallet med slumpmässig integration och CRISPR-medierad geninriktning ( Figur 1 ).

Figur 1
Figur 1: Typiskt arbetsflöde för generering av genetiskt modifierade möss. För slumpmässig integration injiceras den renade transgenen i pronucleus av befruktade oocyter före oviduktöverföring till pluggade fosterjur. Analys av avkomman sker genom PCR efter en snabb genomisk DNA-extraktion. För CRISPR-geninriktning syntetiseras sgRNA med användning av den icke-kloningsmetod som beskrivs här, och två guider injiceras (tillsammans med Cas9 mRNA) i cytoplasman av befruktade oocyter. Denna strategi används för den efterföljande PCR-baserade analysen av avkomman, vilket kräver högrenad gEnom-DNA. Vänligen klicka här för att se en större version av denna figur.

Även om mikroinjektionen av oocyter och reimplantationen av dessa injicerade ägg är de två huvudbegränsande stegen som kräver tekniska färdigheter och träning är kvaliteten på injektionsblandningen av yttersta vikt för att framgångsrikt generera genetiskt modifierade möss. Kvaliteten på transgenreningen ( Figur 2A ) och sgRNA-syntesen ( Figur 3A ) bör utvärderas systematiskt på analytiska agarosgeler. Potentiella föroreningar av blandningen bör också kontrolleras vid mätning av koncentrationerna med en spektrofotometer, eftersom de olika absorptionsvärdena beror direkt på lösningsgraden av lösningen (se steg 1.2.3, 2.2.3.5 och 2.2.5.3).

Figur 2B ) och gengenriktning ( Figur 3B ). DNA-extraktionsprotokollen är också olika beroende på typen av experiment; Efterföljande PCR beror på primrar som hybridiserar antingen på transgen eller på den genomiska DNA. De strategier som presenteras här möjliggör enkel felsökning och effektivisering av varje steg som krävs för att producera genetiskt modifierade möss.

Fastän det kvantitativa resultatet av en mikroinjektionssession varierar beroende på experimentets erfarenhet, när varje protokollsteg optimeras, bör procentandelen av transgena valpar som erhålles normalt nå 10-25% för slumpmässigt integreratRation, som illustreras i Figur 2B (4 grundare av 15 pups födda = 26,6%). Denna något "låg" effektivitet kontrasterar med den pålitliga förmågan hos CRISPR-komponenterna att redigera musgenomet. Faktum är att genererade grundare generellt är högre när man använder CRISPR för geninriktning och sträcker sig från 25-100% (se figur 3B ; 3 grundare av 13 pups = 23%). Det är inte ovanligt att få en hel avkomma som framgångsrikt är homozygot när de redigeras med hjälp av CRISPR.

Figur 2
Figur 2: Kvalitetskontroll och genotypstrategi för framgångsrik produktion av transgena möss för överuttryck. ( A ) Plasmiden digereras under 1 h med PvuI och NotI. Fullständig matsmältning och korrekta storlekar ( dvs transgen = 7,338 bp, ryggrad = 1,440+ 896 bp) kontrolleras på en analytisk gel (1). Utvinningen av flera digerationsprodukter från den preparativa gelén (2) alstrar en ökad koncentration av transgenen. Långvarig exponering för UV bör undvikas, och användningen av ett blått ljus i stället för en UV-transilluminator rekommenderas. (B) Genotypstrategi (1): Primerna bör sitta på transgenen och bör utformas för att generera ett fragment på 200 - 800 bp. När genotypning utförs (2) rekommenderas att inkludera en positiv kontroll ( dvs injektionsblandningen som används för mikroinjektion) och en negativ kontroll ( dvs genomiskt DNA från en WT-mus). Vänligen klicka här för att se en större version av denna figur.

Figur 3
Figur 3: Kvalitetskontroll och genotypning StraTegy för framgångsrik produktion av gen-riktade (KO) möss. ( A ) Kvaliteten hos sgRNA producerade genom in vitro transkription utvärderas genom att DNA-mallen och det genererade RNA parallellt körs för varje guide. Storleken på RNA är något större än DNA. Om kvaliteten är tillfredsställande ( dvs inga smörjband) mäts koncentrationerna. ( B ) (1) Design av de två guiderna (motsatta riktningar) som omfattar startkodonet i Exon 1. Primerna väljs för att hybridisera med det genomiska DNA utanför regionen som så småningom skärs av de två styrningarna. Typiskt möjliggör denna strategi att direkt identifiera heterozygote (# 5 och 9) och homozygote (# 3) KO-grundare med användning av PCR (2). PCR-produkter från homozygote djur uppvisar inte något WT-band. Vänligen klicka här för att se en större version av denna figur.

Reaktion Komponenter Volym Notera Syntes av linjär DNA-mall
(2,5) Nukleasfritt vatten 97,2 μl 5x HF-buffert 36 | il MgCl2 9 | il 10 mM dNTPs 9 | il 10 pM fwd-primer 9 | il 5'TTAATACGACTCACTATAGN 20
gttttagagctagaaatagcaagttaaaata
Aggctagtc 3 ' 10 μM rev primer 9 | il 5 'AAAAGCACCGACTCGGTGCC 3' PrOof-läsningspolymeras 1,8 μl IVT med användning av en T7 RNA-syntes kit
(2,6) Nukleasfritt vatten X ^ l Tillsätt upp till 20 μL total volym NTP-buffertblandning 10 | il Mall DNA ≈ 300 ng T7 RNA-polymeras 2 | il

Tabell 1: Sammansättning av de olika masterblandningarna som användes i denna studie. Syntes av den linjära DNA-mallen: T7-promotorns minsta sekvens (TTAATACGACTCACTATAG) är uppströms 20-bp-sekvensen (guide; N20 identifierad med användning av CRISPR-designverktyget) och en sekvens komplementär till expressionsvektorn (gttttagagctagaaatagcaagttaaaataaggctagtc). In vitroTranskription (IVT): Beroende på koncentrationen av DNA-mallen bör slutvolymen justeras till 20 | il med nukleasfritt vatten.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Kritiska steg inom protokollet

Genereringen av genetiskt modifierade möss är känt att vara tekniskt utmanande. Protokollet som presenteras här är dock en optimerad och förenklad metod som gör att man kan behärska och felsöka tekniken i rekordtid. Det finns två steg som krävs för att tekniken ska kunna slutföras. För det första kan syntesen av linjära DNA-mallar (för syntesen av sgRNA) uppnås utan magnesiumklorid (MgCl2). Det är emellertid starkt rekommenderat att systematiskt tillsätta MgCl2 till masterblandningen, eftersom den partiella hybridiseringen av den främre primeren ofta förebygges i frånvaro av MgCl2. Dessutom är det kritiskt att den riktade genomiska sekvensen inte är närvarande i någon del av donormallen (vid målriktad integration), annars kommer Cas9-nukleaset att skära det, vilket förhindrar förekomst av HDR.

ändringarOch felsökning

Även om detta protokoll för att generera genetiskt modifierade möss har optimerats och strömlinjeformat genom åren, finns det vissa överväganden som hänför sig till utbytet av oocyter av god kvalitet för mikroinjektion och plugghastigheten hos fosterhona. Valet av bakgrundsstammen är kritiskt med avseende på antalet levande ungar som härrör från en mikroinjektionssession. C57BL / 6 är den vanligaste bakgrunden för musmodeller av sjukdomar. Det är emellertid också en av de mindre effektiva bakgrunderna när det gäller resistans mot mikroinjektion 20 . Vidare är kvinnans ålder också kritisk för att ge ett stort antal oocyter; Det är rekommenderat att undvika möss 5-8 veckor, oavsett bakgrund, eftersom detta är den minst gynnsamma reaktionsperioden på hormonell stimulering 21 . Enligt vår erfarenhet ger 3 till 4 veckor gamla C57BL / 6 möss tillförlitligt 20-30 ägg per hona. Det är viktigt attNotera att en ny teknik (kallad ultra superovulation) har producerat upp till 100 ägg per kvinna och har nyligen använts för att generera oocyter för mikroinjektion 22 . Användningen av ultra-superovulering för mikroinjektion hindras emellertid generellt av behovet av artificiellt befruktning ( in vitro fertilisering) ett så stort antal ägg.

För att få pluggade fosterhumor som är lämpliga för reimplantation, möts kvinnliga möss med vasektomiserade män (bakgrunden hos dessa möss är inte kritisk). För att öka antalet pluggade mottagare kan en noggrann undersökning av estrusstadiet och val av lämpliga honor utförs 23 . Synkronisering av kvinnornas cykler kan också induceras genom att exponera kvinnorna för vasektomiserade män två dagar före parning (den så kallade "Whitten effect") 24 .

Begränsningar av tekniken

Mycket små genomiska modifieringar, såsom punktmutationer, är relativt lätta att generera, men de är svåra att identifiera. När genotypning utförs sekvenseras PCR-produkterna direkt genom Sanger-sekvensering. Den direkta mikroinjektionen av CRISPR-komponenter i mus-oocyter genererar emellertid ofta mosaikdjur eftersom Cas9 förblir aktiv under ganska lång tid och olika genomiska modifieringar kan inträffa efter den första uppdelningen av oocyten. Denna konfronterande effekt komplicerar identifieringen av diskreta mutationer bland olika alleler, och nästa generations sekvensering (NGS) kan hjälpa till med utmanande läsningar. Känsliga tekniker, såsom tetra-primerARMS-PCR, 25 kan också hjälpa till med genotypning av kolonin efter identifieringen av grundarna genom sekvensering.

Omvänt är införandet av stora bitar av DNA på ett målinriktat sätt fortfarande utmanande. Ju större det exogena DNA, desto mindre effektiviseras HDR. Följaktligen utvecklas nya strategier, såsom användningen av långa ssOligos-donatorer (i stället för plasmider) 26 eller HDR-oberoende riktade integration 27 , för närvarande.

Betydelsen av protokollet

Detta protokoll presenterar betydande framsteg, eftersom de fyra huvudstegen ( dvs beredning av transgen- eller CRISPR-komponenterna, mikroinjektion, reimplantation och genotypning) har optimerats, testats och validerats i vårt laboratorium.

Den slumpmässiga integrationen av transgener används i stor utsträckning för överexpressionsstudier av två huvudskäl. Först att undvikaId den potentiella "positioneffekten", är den riktade integrationen av en transgen med CRISPR i "safe harbor" -länder, såsom Rosa26 28 och Col1a 29 loci, fortfarande notoriskt utmanande, eftersom effektiviteten hos HDR är låg. Strategier för att lösa detta problem är kommande 26-27 , men slumpmässig integration har hittills visat sig vara effektivare. Dessutom är generationen av multipla transgena linjer som överuttrycker samma transgen med olika expressionsnivåer av intresse för studier som inbegriper behandlingsstrategier för att reversera en fenotyp 30 . Plasmidbaserade transgener alstras genom medelvärde av kloning med användning av ad hoc- restriktionsenzymer för att montera essentiella fragment för expression av ett protein av intresse. Generellt är en transgen tillverkad av åtminstone tre element: en lämplig promotor (förhöjningsregioner är ibland tillsatta); KodningenSekvens (cDNA), med eller utan introna regioner; Och en PolyA-svans för att stabilisera mRNA-uttryck 31 .

När en gång är monterad införs transgenen i en plasmid innehållande bakterie replikationselement och expanderas i odling efter transformation (typiskt värmekokbaserad). Reningen av transgenerna för mikroinjektion är kritisk. I detta arbete beskrivs användningen av DNA-fläckar med ny generation (lågtoxicitet) för en mer exakt visualisering av fragmentet av intresse på gelén (jämfört med traditionell kristallviolett) och en låg mutagen exponering (jämfört med etidiumbromid).

Den icke-kloningsmetod som beskrivs häri för genriktning är mycket snabb och möjliggör syntesen av flera sgRNA på endast 5-6 timmar. Endast fyra steg krävs: identifieringen av den riktade sekvensen, syntesen av en linjär DNA-mall innehållande en T7-promotor och den valda målsekvensen, syntesen oF sgRNA genom in vitro transkription (IVT) och rening av sgRNA med användning av spin-kolonner.

I den tidiga åldern av CRISPR-musgenomredigeringen utvärderades den potentiella off-target-effekten systematiskt, fastän den har visat sig vara mycket begränsad i musembryon 32 och lätt kan spädas ut medelst ett avelsschema där valda möss endast bär Den önskade genomiska modifieringen. På-målaktiviteten utvärderades också systematiskt in vitro , med hjälp av olika guider och val av de mer aktiva (en) 12 . Denna praxis är nu mindre vanligt, av flera skäl. Först utvärderas aktivitetsaktiviteten med användning av transfektion av immortaliserade muscellinjer (typiskt N2a eller NIH3T3) med CRISPR-kodande plasmider. Detta är en annan metod än injektionen av CRISPR RNA-komponenter i musocyter. Därför översättas inte alltid resultaten i vitroTill oocyter. Vidare visade hög genomströmningsförsök att de flesta guider är aktiva 33 . Följaktligen bedöms inte målmätningsaktivitet, och hittills har det inte funnits några bevis på en guide som inte visar någon aktivitet i mus-oocyter. Tillsammans med icke-kloningsmetoden för att syntetisera sgRNA, presenteras här, förenklar och effektiviserar arbetsflödet i hög grad, och flera aktiva guider kan sömlöst syntetiseras på en dag.

CRISPR anses vara en "störande teknik", vilket är en innovation som förändrar sättet teknikerna utförs. När mikroinjektion upprättades, Brinster et al. Visade att cytoplasmatisk transgenes, även om det var uppnåelig, förblev mestadels ineffektivt 7 . Följaktligen förblev pronukleär mikroinjektion den enda vanliga praxisen i nästan 30 år fram till den första demonstrationen av en framgångsrik CRISPR-geninriktning hos möss. Denna studie visade att cytoplasmisk mikroinjektion Jon kan generera ett liknande eller överlägset resultat jämfört med pronukleär administrering 12 . Eftersom CRISPR-komponenter vanligen är gjorda av RNA är det uppenbart att cytoplasmen är riktade. Men även när det injiceras i cytoplasman kan donatormallar också framgångsrikt inducera HDR. En hög cytoplasmatisk koncentration av mallar möjliggör deras diffusion i kärnan. Dessutom är användningen av piezo-driven cytoplasmisk mikroinjektion 16 inte ett krav. En kort inkubation av oocyterna med en cytoskeletonhämmare, såsom Cytochalasin B, ökar överlevnaden av oocyterna 34 , 35 , vilket gör det tillräckligt att utföra cytoplasmatiska injektioner utan ett piezo-slagdrivsystem. På samma sätt minskar användningen av ett förbättrat odlingsmedium, såsom KSOMaa, blockeringen i tvåcellsteget och förbättrar embryonernas utvecklingsförmåga jämfört med M16-mediumXref "> 36.

Encell eller tvåceller (när de odlas över natten) kan embryon överföras till ovidukten. Det konventionella förfarandet är ganska invasivt, eftersom det kräver att bursa som skyddar äggstocken slits. Det är också tekniskt utmanande, eftersom glaskapillären måste införas i infundibulum 15 . Metoden som presenteras här är mycket lättare att lära, inducerar inte potentiell blödning och bevarar äggstockarnas integritet. Det bygger på arbete som utvecklats på Kumamoto University 37 .

Genotypstrategier och sekvenseringstekniker är kritiska för att identifiera potentiella grundare. För slumpmässig integration baseras extraktionen av genomiskt DNA på en enkel metod anpassad från Truett et al. 38 . En sådan snabb extraktionsmetod är tillräcklig för att identifiera potentiella grundare, eftersom primrama är utformade att hybridisera med transgenen (ofta integreraSom flera kopior). Omvänt kräver genriktning mycket renat genomiskt DNA, eftersom PCR-produkten omfattar den modifierade genomiska regionen.

För genknockout genererar den traditionella metoden för injicering av ett enda sgRNA små deletioner (indeler) eller insertioner, så småningom slår ut genen av intresse 12 . Dessa små modifikationer är svåra att identifiera och kräver ofta tidskrävande, ligasoberoende kloning och sekvensering för att bekräfta arten av dessa mutationer.

I detta protokoll utnyttjade vi CRISPR-multiplexering för att utveckla den systematiska saminjektionen av två sgRNA som omfattar startkodonet av en gen av intresse. Detta ökar inte bara sannolikheten för en genknockout utan också excisionen av en bit av genomiskt DNA med en fördefinierad storlek (100-300 bp), vilket möjliggör enkel identifiering av grundarna med enkel PCR. Observera att ungar som inte bär den förväntade genomiska eXcision kan fortfarande analyseras för små framväxlingsmutationer, när endast en sgRNA visade sig vara aktiv. På samma sätt, i fallet med genredigering, bör den systematiska saminjektionen av två överlappande sgRNA i motsatta riktningar öka effektiviteten hos HDR, eftersom cellreparationsmekanismerna företrädesvis använder en av de två strängarna 39 .

Framtida applikationer

Det föreliggande protokollet utnyttjar de senaste utvecklingen inom musembryologi och genriktning 40 för att förenkla och effektivisera processen att generera olika sofistikerade musmodeller av mänskliga förhållanden. Dessa modeller spelar en central roll för att hjälpa till att utveckla vår förståelse för patomekanismer, i sista hand hjälpa till med utvecklingen av terapeutiska strategier 2 . Optimeringen och effektiviseringen av reagensen som krävs för geninriktning eller slumpmässig integration är allmänt och lätt applicabLe till andra däggdjursarter, såsom råttor, kaniner och till och med till stora djur som nötkreatur.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna tillhandahåller akademiska transgeneservice i möss via University of New South Wales Mark Wainwright Analytical Center.

Acknowledgments

Författarna tackar personalen hos djuranläggningen (BRC) för deras pågående stöd. Detta arbete finansierades av National Health and Medical Research Council och Australian Research Council.

Materials

Name Company Catalog Number Comments
Micropipette 0.1-2.5 μL Eppendorf 4920000016
Micropipette 2 - 20 μL Eppendorf 4920000040
Micropipette 20 - 200 μL Eppendorf 4920000067
Micropipette 100 - 1,000 μL Eppendorf 4920000083
Molecular weight marker  Bioline BIO-33025 HyperLadder 1 kb
Molecular weight marker  Bioline BIO-33056 HyperLadder 100 bp
Agarose Bioline BIO-41025
EDTA buffer Sigma-Aldrich 93296 10x - Dilute to 1x
Ethidium bromide Thermo Fisher Scientific 15585011
SYBR Safe gel stain Invitrogen S33102
Gel extraction kit Qiagen 28706
PCR purification kit (Qiaquick) Qiagen 28106
Vacuum system (Manifold) Promega A7231
Nuclease-free microinjection buffer  Millipore MR-095-10F
Ultrafree-MC microcentrifuge filter  Millipore UFC30GV00
Cas9 mRNA Sigma-Aldrich CAS9MRNA
CRISPR expressing plasmid (px330) Addgene 42230
Nuclease free water Sigma-Aldrich W4502
Phusion polymerase New England Biolabs M0530L
T7 Quick High Yield RNA kit New England Biolabs E2050S
RNA purification spin columns (NucAway) Thermo Fisher Scientific AM10070
ssOligos Sigma-Aldrich OLIGO STANDARD
Donor plasmid Thermo Fisher Scientific GeneArt
Hyaluronidase Sigma-Aldrich H3884
KSOMaa embryo culture medium Zenith Biotech  ZEKS-100
Mineral oil Zenith Biotech  ZSCO-100
M2 Medium Sigma-Aldrich M7167
Cytochalasin B Sigma-Aldrich C6762
Mouthpiece Sigma-Aldrich A5177
Glass microcapillaries Sutter Instrument BF100-78-10
Proteinase K Applichem A3830.0100
Dumont #5 forceps Fine Science Tools  91150-20
Iris scissors Fine Science Tools  91460-11
Vessel clamp Fine Science Tools  18374-43
Wound clips  Fine Science Tools  12040-01
Clips applier  Fine Science Tools  12018-12
Micro-scissors  Fine Science Tools  15000-03
Cauterizer Fine Science Tools  18000-00
Non-absorbable surgical sutures (Ethilon 3-0) Ethicon 1691H
5% CO2 incubator MG Scientific Galaxy 14S
Spectrophotometer Thermo Fisher Scientific Nanodrop 2000c
Thermocycler Eppendorf 6321 000.515
Electrophoresis set up BioRad 1640300
UV Transilluminator BioRad 1708110EDU
Thermocycler Eppendorf 6334000069
Stereoscopic microscope Olympus SZX7
Inverted microscope Olympus IX71
2x Micromanipulators Eppendorf 5188000.012
Oocytes manipulator Eppendorf 5176000.025
Microinjector (Femtojet) Eppendorf 5247000.013
Mice C57BL/6J strain Australian BioResources C57BL/6JAusb 

DOWNLOAD MATERIALS LIST

References

  1. Ittner, L. M. Dendritic function of tau mediates amyloid-beta toxicity in Alzheimer's disease mouse models. Cell. 142, (3), 387-397 (2010).
  2. Ittner, A. Site-specific phosphorylation of tau inhibits amyloid-beta toxicity in Alzheimer's mice. Science. 354, (6314), 904-908 (2016).
  3. Marantz Henig, R. The Monk in the Garden. Mariner books. (2000).
  4. Jaenisch, R., Mintz, B. Simian virus 40 DNA sequences in DNA of healthy adult mice derived from preimplantation blastocysts injected with viral DNA. Proc Natl Acad Sci U S A. 71, (4), 1250-1254 (1974).
  5. Gordon, J. W., Ruddle, F. H. Integration and stable germ line transmission of genes injected into mouse pronuclei. Science. 214, (4526), 1244-1246 (1981).
  6. Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A., Ruddle, F. H. Genetic transformation of mouse embryos by microinjection of purified DNA. Proc Natl Acad Sci U S A. 77, (12), 7380-7384 (1980).
  7. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Yagle, M. K., Palmiter, R. D. Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc Natl Acad Sci U S A. 82, (13), 4438-4442 (1985).
  8. Capecchi, M. R. Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century. Nat Rev Genet. 6, (6), 507-512 (2005).
  9. Carbery, I. D. Targeted genome modification in mice using zinc-finger nucleases. Genetics. 186, (2), 451-459 (2010).
  10. Sung, Y. H. Knockout mice created by TALEN-mediated gene targeting. Nat Biotechnol. 31, (1), 23-24 (2013).
  11. Jinek, M. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  12. Wang, H. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  13. Kang, X. Introducing precise genetic modifications into human 3PN embryos by CRISPR/Cas-mediated genome editing. J Assist Reprod Genet. 33, (5), 581-588 (2016).
  14. Liang, P. CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes. Protein Cell. 6, (5), 363-372 (2015).
  15. Ittner, L. M., Götz, J. Pronuclear injection for the production of transgenic mice. Nat Protoc. 2, (5), 1206-1215 (2007).
  16. Yang, H., Wang, H., Jaenisch, R. Generating genetically modified mice using CRISPR/Cas-mediated genome engineering. Nat Protoc. 9, (8), 1956-1968 (2014).
  17. CRISPR DESIGN. Available from: http://crispr.mit.edu (2017).
  18. Integrated DNA Technologies. Resuspension Calculator. Available from: https://sg.idtdna.com/calc/resuspension/ (2017).
  19. BioTools at UMass Medical School. Primer3: WWW primer tool. Available from: http://biotools.umassmed.edu/bioapps/primer3_www.cgi (2017).
  20. Auerbach, A. B. Strain-dependent differences in the efficiency of transgenic mouse production. Transgenic Res. 12, (1), 59-69 (2003).
  21. Merriman, J. A., Jennings, P. C., McLaughlin, E. A., Jones, K. T. Effect of aging on superovulation efficiency, aneuploidy rates, and sister chromatid cohesion in mice aged up to 15 months. Biol Reprod. 86, (2), 49 (2012).
  22. Nakagawa, Y., et al. Ultra-superovulation for the CRISPR-Cas9-mediated production of gene-knockout, single-amino-acid-substituted, and floxed mice. Biol Open. 5, (8), 1142-1148 (2016).
  23. Byers, S. L., Wiles, M. V., Dunn, S. L., Taft, R. A. Mouse estrous cycle identification tool and images. PLoS One. 7, (4), e35538 (2012).
  24. Whitten, W. K. Modification of the oestrous cycle of the mouse by external stimuli associated with the male. J Endocrinol. 13, (4), 399-404 (1956).
  25. Ye, S., Dhillon, S., Ke, X., Collins, A. R., Day, I. N. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 29, (17), E88 (2001).
  26. Yoshimi, K., et al. ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat Commun. 7, 10431 (2016).
  27. Suzuki, K., et al. In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. (2016).
  28. Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 21, 70-71 (1999).
  29. Liu, X., et al. A targeted mutation at the known collagenase cleavage site in mouse type I collagen impairs tissue remodeling. J Cell Biol. 130, (1), 227-237 (1995).
  30. Ke, Y. D. Short-term suppression of A315T mutant human TDP-43 expression improves functional deficits in a novel inducible transgenic mouse model of FTLD-TDP and ALS. Acta Neuropathol. 130, (5), 661-678 (2015).
  31. Auerbach, A. B. Production of functional transgenic mice by DNA pronuclear microinjection. Acta Biochim Pol. 51, (1), 9-31 (2004).
  32. Iyer, V., et al. Off-target mutations are rare in Cas9-modified mice. Nat Methods. 12, (6), 479 (2015).
  33. Zhou, Y. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 509, (7501), 487-491 (2014).
  34. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Avarbock, M. R. Translation of globin messenger RNA by the mouse ovum. Nature. 283, (5746), 499-501 (1980).
  35. Pinkert, C. A., Irwin, M. H., Johnson, L. W., Moffatt, R. J. Mitochondria transfer into mouse ova by microinjection. Transgenic Res. 6, (6), 379-383 (1997).
  36. Biggers, J. D., Summers, M. C. Choosing a culture medium: making informed choices. Fertil Steril. 90, (3), 473-483 (2008).
  37. Nakagata, N. Embryo transfer through the wall of the fallopian tube in mice. Jikken Dobutsu. 41, (3), 387-388 (1992).
  38. Truett, G. E. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  39. Richardson, C. D., Ray, G., DeWitt, M. A., Curie, G. L., Corn, J. E. Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 34, (3), 339-344 (2016).
  40. Delerue, F., Ittner, L. M. Genome Editing in Mice Using CRISPR/Cas9: Achievements and Prospects. Clon. Transgen. 4, (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics