Geração de ratos geneticamente modificados através da microinjecção de oócitos

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

A microinjecção de oócitos de rato é comumente utilizada tanto para a transgênese clássica ( ou seja, a integração aleatória de transgenes) e a segmentação de genes mediada por CRISPR. Este protocolo analisa os últimos desenvolvimentos em microinjeção, com ênfase particular no controle de qualidade e estratégias de genotipagem.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Delerue, F., Ittner, L. M. Generation of Genetically Modified Mice through the Microinjection of Oocytes. J. Vis. Exp. (124), e55765, doi:10.3791/55765 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

O uso de camundongos geneticamente modificados tem contribuído significativamente para estudos em processos fisiológicos e patológicos in vivo . A injeção pronuclear de construções de expressão de DNA em oócitos fertilizados continua a ser a técnica mais utilizada para gerar camundongos transgênicos para superexpressão. Com a introdução da tecnologia CRISPR para segmentação gênica, a injeção pronuclear em oócitos fertilizados foi estendida à geração de camundongos knockout e knockin. Este trabalho descreve a preparação de DNA para injeção e a geração de guias CRISPR para segmentação gênica, com especial ênfase no controle de qualidade. Os procedimentos de genotipagem necessários para a identificação de potenciais fundadores são críticos. Estratégias inovadoras de genotipagem que aproveitam as capacidades de "multiplexação" do CRISPR são aqui apresentadas. Os procedimentos cirúrgicos também são delineados. Juntos, as etapas do protocolo permitirão a geração de genCamundongos eticamente modificados e para o estabelecimento subseqüente de colônias de ratos para uma infinidade de campos de pesquisa, incluindo imunologia, neurociência, câncer, fisiologia, desenvolvimento e outros.

Introduction

Os modelos animais, tanto em vertebrados quanto em invertebrados, têm sido fundamentais para examinar a fisiopatologia das condições humanas, como a doença de Alzheimer 1 , 2 . Eles também são ferramentas inestimáveis ​​para procurar modificadores de doenças e, em última instância, desenvolver novas estratégias de tratamento na esperança de uma cura. Embora cada modelo tenha limitações intrínsecas, o uso de animais como modelos sistêmicos inteiros é vital para a pesquisa biomédica. Isso ocorre porque o ambiente fisiológico metabólico e complexo não pode ser totalmente simulado na cultura de tecidos.

Até à data, o rato continua a ser a espécie de mamífero mais comum usada para manipulação genética porque apresenta várias vantagens. Os processos fisiológicos e os genes associados a doenças são altamente conservados entre camundongos e seres humanos. O mouse foi o primeiro mamífero a ter seu genoma completo seqüenciado (2002), um ano antes do geno humanoEu (2003). Além dessa riqueza de informações genéticas, o mouse possui boas capacidades de criação, um ciclo de desenvolvimento rápido (6 semanas desde a fertilização até o desmame) e um tamanho razoável. Todas essas vantagens, juntamente com indicadores fisiológicos, como cores de revestimento distintas (necessárias para estratégias de cruzamento), fizeram do mouse um modelo atraente para manipulação genética. Notavelmente, na era mais precoce da genética moderna, Gregor Mendel começou a trabalhar em camundongos antes de se mudar para as plantas 3 .

As técnicas de transferência de genes resultaram na geração do primeiro rato transgênico há mais de três décadas 4 , inicialmente criado usando a entrega viral. No entanto, os pesquisadores logo perceberam que um dos principais desafios da transgênese do mouse era a incapacidade de controlar o destino do DNA exógeno. Como a distribuição viral de transgenes em oócitos de ratos resultou em cópias múltiplas integradas aleatoriamente no genoma, o possibilitO estabelecimento de linhas transgênicas subsequentes foi limitado.

Uma dessas limitações foi superada quando Gordon et al. Gerou a primeira linha de mouse transgênica por microinjeção 5 , 6 . Isso começou a era da tecnologia de DNA recombinante, e os parâmetros que influenciam o resultado de uma sessão de microinjeção foram amplamente estudados 7 . Embora a microinjeção não permita o controle sobre o site de integração do transgene (que eventualmente resulta em níveis de expressão específicos para cada mouse fundador), a principal vantagem da microinjeção pronuclear continua sendo a formação de concatemers ( ou seja, matrizes de múltiplas cópias do transgene, Ligado em série) antes da integração genômica 5 . Esta característica tem sido utilizada ao longo dos anos para estabelecer milhares de linhas de mouse transgênicas que sobre-expressam um gene de interesse. Desde então, a transgênese, aModificação artificial do genoma de um organismo, tem sido amplamente utilizada para identificar o papel de genes únicos na ocorrência de doenças.

Uma outra conquista chave na manipulação do genoma do mouse foi alcançada quando o Mario Capecchi interrompeu com sucesso um único gene no mouse, abrindo a era da segmentação gênica 8 . No entanto, as principais desvantagens emergiram rapidamente da segmentação por células baseadas em células ES, incluindo os desafios de cultivar células ES, o grau de quimerismo um tanto variável e o comprimento do processo ( ou seja, 12-18 meses, mínimo, para obter o mouse) .

Recentemente, os avanços nas novas tecnologias, tais como endonucleases de engenharia ( por exemplo, nucleases de zinco (ZFN), efetoras nucleas efectoras de transcrição (TALEN), e repetições palindrômicas curtas (CRISPR / Cas9) agrupadas regularmente foram emergentes como métodos alternativos para Acelerar o processo de segmentação de genes no microfoneE 9 , 10 . Estas endonucleases podem ser facilmente injetadas em oócitos de ratinho por microinjeção, permitindo a geração de camundongos alvo de genes em apenas 6 semanas.

Desde o primeiro relatório sobre o uso do CRISPR para a edição do genoma 11 , este sistema imunológico adaptativo bacteriano substituiu ZFN e TALEN por suas muitas vantagens, incluindo a facilidade de síntese e a capacidade de segmentar múltiplos loci de uma vez (referido como "multiplexação "). O CRISPR foi utilizado pela primeira vez para segmentação gênica em camundongos 12 e desde então foi aplicado a inúmeras espécies, de plantas a seres humanos 13 , 14 . Até à data, não há relatório de uma única espécie resistente à edição do genoma CRISPR.

Os dois principais passos limitantes da geração de camundongos transgênicos são a injeção de oócitos eo reimplanteDesses oócitos em fêmeas pseudo-grávidas. Embora esta técnica tenha sido descrita por nós 15 e outros 16 , as melhorias técnicas recentes em embriologia de ratos e técnicas de transferência de genes revolucionaram o processo de geração de camundongos geneticamente modificados. Essas melhorias serão descritas aqui.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Todos os procedimentos foram aprovados pelo Comitê de Ética e Cuidados Animais da Universidade de Nova Gales do Sul.

1. Preparação do Transgene (Integração Aleatória)

  1. Eletroforese analítica em gel de agarose.
    1. Digite o plasmídeo para acelerar o transgene usando enzimas apropriadas (incubação de 1 hora) ou enzimas de rápida digestão (15 a 30 min de incubação) em um termociclador seguindo as recomendações do fabricante (veja a Figura 2A e sua legenda).
    2. Juntar um gel de agarose de ácido tris-acetato-etilenodiaminotetraacetico a 1% (TEA), corado com 0,5-1,0 μg / mL de brometo de etidio (EtBr).
      NOTA: Tenha cuidado ao usar EtBr; É um mutagênico potente. Use o equipamento de proteção pessoal apropriado (consulte a folha de dados de segurança do material).
    3. Carregar um marcador de peso molecular de 1 kb.
    4. Carregue os fragmentos linearizados ( ie, transgene e espinha dorsal). Execute a eletroforese a 100 V por 45 min.
    5. Visualize o gel em um transiluminador ultravioleta (UV) para verificar se a digestão está completa e para confirmar o tamanho correto do transgene ( ou seja, 7,338 pb, veja a Figura 2A ).
  2. Electroforese preparada em gel de agarose.
    1. Elimine um gel de agarose TAE a 1% corado com uma mancha de gel de baixa toxicidade. Carregar 8 alíquotas (1 μg cada) de transgene linearizado sem marcador de peso molecular e executar a eletroforese a 100 V durante 45 min. Use um bisturi para excluir todas as 8 bandas correspondentes ao transgene linearizado.
    2. Extraia o DNA usando um kit de extração de gel seguindo as recomendações do fabricante (veja a Tabela de Materiais ).
      1. Derreta os fragmentos de gel a 50 ° C em tubos de 1,5 mL durante pelo menos 15 min. Precipitar com isopropanol e depois adicionar o tampão de ligação.
      2. Combine todo o DNA, pipetando tudo em uma coluna. Eluir em tampão de microinjecção livre de nuclease (8 mM Tris-HCl e 0,15 mM EDTA). Filtrar através de um filtro de microcentrífuga de 0,22 μm e centrifugação por 60 s a 12 000 x g.
    3. Medir a concentração e a qualidade do DNA usando um espectrofotômetro. Verifique se a relação A260 / A280 é de cerca de 1,8 ( ou seja, nenhuma contaminação por proteínas) e a relação A260 / A230 é pelo menos 2,0 ( ou seja, não há contaminação por solventes orgânicos). Diluir até 3 ng / μL em tampão de microinjecção livre de nuclease, alíquota (20-50 μL) e congelar a -20 ° C.

2. Síntese de Componentes CRISPR (Gene Targeting)

  1. Cas9 mRNA.
    1. Diluir o ARNm Cas9 (obtido a partir de uma fonte comercial, ver a Tabela de Materiais ) a uma concentração de 1 μg / μL em tampão de microinjeção livre de nucleases.
    2. Alíquota em 2 μL e livre Ze a -80 ° C.
  2. RNA de guia único (SgRNA).
    1. Identifique as seqüências genômicas desejadas de dois lados (guias) utilizando uma ferramenta de projeto computacional que permita o potencial mínimo de atividade fora do alvo 17 .
      1. Para o knockout de genes, selecione sistematicamente duas guias localizadas a poucas centenas de pares de bases (pb) separadas, em direções opostas, e incluem o codão de início do gene de interesse. Para reparo direto de homologia, selecione duas guias sobrepostas (sempre que possível), em direções opostas.
        NOTA: Como exemplo, os seguintes guias foram recentemente co-injetados com sucesso para interromper o primeiro exão do gene TPM4.2 :
        Guia 1: 5 'CGCCATCCAGTTCGCGCTGC 3';
        Guia 2: 5 'CAGAACGATTGAGCTATGGC 3'
    2. Peça um conjunto de iniciadores conforme descrito na Tabela 1 .
    3. Sintetizar um modelo de DNA linear.
      1. Diluir px330Ref "> 12 plasmídeo a 10 ng / μL em água livre de nucleases.
      2. Prepare a mistura principal conforme indicado na Tabela 1 . Adicione a polimerase no final e mantenha a mistura principal no gelo.
      3. Misture e divida isso em 8 tubos de PCR (19 μL / tubo). Adicione 1 μL de px330 por tubo e execute o PCR nas seguintes condições: 1 min a 98 ° C; 40 ciclos de 98 ° C durante 10 s, 64 ° C durante 30 s e 72 ° C durante 15 s; E um alongamento final a 72 ° C durante 5 min. Segure a 4 ° C.
      4. Purifique os produtos de PCR usando um kit de purificação por PCR (veja a Tabela de Materiais ), um colector e uma fonte de vácuo (para um processamento mais rápido). Aplique a força máxima no vácuo ( ou seja, 8 mbar).
        1. Adicione 5 volumes (100 μL) de tampão de ligação a 1 volume da amostra de PCR e misture.
        2. Coloque uma coluna de rotação de membrana de sílica (fornecida) em um tubo de coleta (fornecido) de 2 mL para centrifugação ou no colector para processo de vácuoIng. Para ligar o DNA, aplique sucessivamente todas as 8 amostras à coluna e vácuo ou centrifugadora por 60 s a 12.000 xg por cada carga.
        3. Para lavar, adicione 0,75 mL de tampão de lavagem (PE tampão) à coluna e vácuo ou centrífuga por 60 s a 12.000 x g. Centrifugue a coluna por 60 s a 12.000 xg para eliminar o etanol residual.
        4. Coloque a coluna em um tubo de microcentrífuga limpo de 1,5 mL. Para eluir o DNA, adicione 30 μL de água livre de nuclease ao centro da membrana, deixe a coluna repousar durante 1 min e centrifugue por 60 s a 12 000 g.
      5. Medir a concentração usando um espectrofotômetro; Tipicamente, a concentração deve ser 100 ng / μL ou superior. Verifique se a relação A260 / A280 é de cerca de 1,8 ( ou seja, nenhuma contaminação por proteínas) e a relação A260 / A230 é pelo menos 2,0 ( ou seja, não há contaminação por solventes orgânicos).
    4. Transcrição in vitro usando um kit de síntese de RNA T7.
      1. Prepare tEle mestre mistura, como indicado na Tabela 1 , e incuba durante 3 h a 37 ° C num termociclador. Adicione 28 μL de água livre de nuclease e 2 μL de DNase I e incube durante mais 15 min a 37 ° C num termociclador.
    5. Purificação de ARN usando colunas de rotação.
      1. Dissolver o pó contido na coluna de rotação fornecida em 650 μL de tampão de microinjeção livre de nuclease, removendo cuidadosamente todas as bolhas de ar. Capte o tubo e hidrata durante 5 a 15 min à temperatura ambiente.
      2. Remova a tampa azul na parte inferior e coloque a coluna em um tubo de 2 mL. Centrifugar durante 2 min a 750 xg e temperatura ambiente. Coloque a coluna em um tubo fresco de 1,5 mL e aplique gota a gota 50 μL da solução de ARN no centro, sem tocar na parede da coluna. Gire a coluna durante 2 min a 750 x g.
      3. Medir a concentração de ARN usando um espectrofotômetro (o rendimento típico de uma reação é de 30 a 50 μg). Verifique se a relação A260 / A280 é umaA ronda 2.0 ( ou seja, nenhuma contaminação por proteínas) ea relação A260 / A230 é de pelo menos 2,0 ( ou seja, não há contaminação por solventes orgânicos). Armazene os sgRNAs em -80 ° C até o uso.
      4. Avalie a qualidade do RNA usando os géis de TAE de 1% rotineiramente utilizados para a eletroforese de DNA. Execute 200-400 ng do modelo de DNA e o sgRNA correspondente em paralelo. A banda de RNA (≈ 100 pb) deve ser ligeiramente maior que a banda de DNA (ver Figura 3A ).

3. Modelo do doador

  1. Peça oligonucleótidos de cadeia simples sintetizados comercialmente (ssOligos, veja a Tabela de Materiais ) para mutações pontuais ou para a integração de pequenas sequências até 50 pb; Os braços de homologia são normalmente de 60 a 90 pb de comprimento.
  2. Para inserções maiores, use um plasmídeo doador como modelo. Gerar um plasmídeo adequado usando o método clássico de clonagem ou síntese de novo a partir de umFonte comercial.
    NOTA: Recomenda-se um mínimo de 800 pb por braço de homologia. O tamanho da espinha dorsal não tem influência na eficiência do reparo direto de homologia (HDR).

4. Mistura por injeção

  1. Diluir o ARNm de Cas9 a 50 ng / μL e os sgRNAs para 12,5 ng / μL (25 ng / μL no total) usando tampão de microinjeção livre de nucleases para experiências de nocaute de genes. Adicione o modelo de doador (ssOligo ou plasmídeo) a uma concentração de 200 ng / μL para experiências de edição de genoma com base em reparo direto de homologia.
    NOTA: Os volumes de diluição podem ser facilmente determinados usando ferramentas on-line, como uma calculadora de ressuspensão 18 .
  2. Mantenha cada alíquota no gelo durante a sessão de microinjeção e descarte depois (não re-congelar a mistura de injeção).

5. Vasectomia Scrotal

NOTA: Dois tipos de vasectomia são comumente realizados em camundongos: abdominal e escrotal. O últimoÉ menos invasivo e já foi descrito anteriormente 15 .

  1. Autoclave todos os instrumentos cirúrgicos de aço inoxidável.
  2. Determine o peso do mouse usando uma escala de pesagem e anestesize os machos por injeção intraperitoneal (ip) com anestésicos injetáveis ​​(ketamina 100 mg / kg, xilazina 10 mg / kg).
  3. Monitore a perda do reflexo de pitada do dedo do pé e, uma vez que o mouse é sedado, coloque-o sobre uma almofada de aquecimento.
  4. Desinfecte a pele em torno dos testículos com toalhetes alternados de um anti-séptico tópico, como a clorhexidina e 70% de etanol.
  5. Empurre os testículos no saco escrotal e faça uma incisão da pele com um bisturi.
  6. Visualize o testículo, a cauda epidídima e o canal deferente.
  7. Pegue o canal deferente com fórceps, segure-o e cauterize em cada lado da pinça para remover 3 mm do canal deferente.
  8. Execute o mesmo procedimento no segundo testículo.
  9. Feche as incisões da pele com clipes de ferida e monitore aMouse de perto até recuperação completa.

6. Superovulação (Doadores de Oócitos) e Time-Mating (Fêmeas Pseudo-grávidas)

NOTA: A técnica para gerar um número adequado de oócitos fertilizados e fêmeas adotivas obstruídas para reimplante foi descrita em outro lugar 15 .

  1. Injectar 10 fêmeas ip com 5 UI de gonadotrofina sérica da égua grávida (PMSG em 100 μL) em torno de 12 horas no dia 1.
  2. Injete as fêmeas ip com 5 UI de gonadotrofina coriônica humana (hCG em 100 μL) 46-48 h depois (cerca de 11 horas no dia 3).
  3. Imediatamente mate as fêmeas com machos solteiros durante a noite.

7. Injeções Pronucleares (de integração aleatória) e citoplasmáticas (Gene-targeting)

  1. Retire os camundongos superovulados por deslocamento cervical, exponha o abdômen e acesse os ovários e ovidutos, conforme descrito anteriormente 15 . Dissecte o oViducos e colhe os complexos cumulus-oócitos (COCs) sob um estereomicorscópio 15 . Coloque-os em uma gota de meio de otimização de potássio simplex suplementado com aminoácidos (KSOMaa) seguindo o método tradicional 15 .
  2. Purifique os oócitos adicionando aproximadamente 1 μL de hialuronidase (10 mg / mL) à gota do meio de KSOMaa usando uma bocal de aspirador e coloque o prato em uma incubadora de CO 2 de 37 ° C / 5% durante 30 s a 1 min.
  3. Lave os oócitos com 4 gotas frescas de meio KSOMaa usando a boca da aspiradora e transfira-as para uma gota final de meio KSOMaa sobreposta com óleo mineral (cerca de 2 mL). Coloque o prato na incubadora de CO 2 de 37 ° C / 5% até que os oócitos estejam prontos para injeção.
  4. Injeção pronuclear (integração aleatória).
    1. Visualize os ovos sob o microscópio estereoscópico e transfira aproximadamente 50 ovos para a câmara de injeção (uma droP de meio M2 coberto com óleo mineral) usando a peça de boca do aspirador.
    2. Transfira a câmara de injeção para o microscópio invertido e injete os oócitos fertilizados (dois pronúcleos visíveis) com alguns picolitros da mistura de injeção, visando um pronúcleo (qualquer dos pronúcleos pode ser direcionado). Visualize uma injeção bem sucedida observando o inchaço do pronúcleo.
  5. Injeção citoplasmática (segmentação gênica).
    1. Transfira aproximadamente 50 ovos para uma gota de KSOMaa contendo 5 μg / mL de Citotinase B utilizando a peça bucal e incubar durante 5 min na incubadora a 37 ° C / 5% de CO 2 .
    2. Transfira os ovos para a câmara de injeção usando a peça da boca.
    3. Injetar poucos picolitros da mistura de injeção no citoplasma a uma pressão muito baixa (50-100 hPa), usando a pressão de compensação do microinjetor automatizado sempre que possível.
    4. Após a injeção, transfira os oócitos de volta para uma gota de KSOMaa (usando a peça de boca) e mantê-los na incubadora de CO 2 de 37 ° C / 5%, até serem carregados para reimplante no oviduto de fêmeas pseudo-grávidas.

8. Reimplante

  1. Autoclave todos os instrumentos cirúrgicos de aço inoxidável.
  2. Determine o peso do mouse usando a escala de pesagem e anestesize as fêmeas por injeção intraperitoneal (ip) com anestésicos injetáveis ​​(ketamina 100 mg / kg, xilazina 10 mg / kg).
  3. Monitore a perda do reflexo de pitada do dedo do pé e, uma vez que o mouse é sedado, coloque-o sobre uma almofada de aquecimento.
  4. Inclua uma grande área da pele ao redor da linha média dorsal do mouse feminino.
  5. Desinfecte a pele exposta com toalhetes alternados de um anti-séptico tópico, como a clorhexidina e 70% de etanol.
  6. Exponha o trato reprodutivo seguindo o método tradicional 15 . Faça uma incisão de pele de 1 cm de comprimento paralela à linha média dorsal, corte o músculo e pegue a almofada de gordura.Uma pinça, depois puxe suavemente o ovário até que o seu oviducto e o útero sejam claramente visíveis.
  7. Corrija a almofada gorda com um grampo de vaso. Visualize o oviduto sob o microscópio estereoscópico e usando um par de micro-tesouras faça uma incisão na parede do oviducto alguns milímetros a montante da ampola.
  8. Sob o microscópio estereoscópico, carregue 25 ovos microinjetados no capilar de vidro conectado à boca (o diâmetro interno do capilar deve ter cerca de 120 um de largura). Introduza o capilar de vidro no tubo de ovidação e expulse até que uma bolha de ar seja visível dentro da ampola.
  9. Remova cuidadosamente o capilar de vidro e coloque o trato reprodutivo no abdômen. Suturar a incisão com suturas cirúrgicas não absorvíveis 3-0, depois fechar com clipes de ferida. Monitore o mouse de perto até recuperar completamente.

9. Estratégias de Genotipagem / Seqüenciamento

NOTA: Isolar o genômicoDNA de biópsias de cauda ou orelha de 2 mm, seguindo os regulamentos relevantes de ética animal.

  1. Extração rápida de DNA genômico (integração aleatória).
    1. Leve as amostras de tecido (~ 2 mm) a 95 ° C durante 1 h em 100 μL de reagente de lise alcalino (hidróxido de sódio 25 mM e EDTA 0,2 mM, pH = 12).
    2. Adicionar 100 μL de reagente neutralizante (Tris-HCl 40 mM, pH = 5).
    3. Centrifugar durante 5 minutos a 12.000 g e 4 ° C.
  2. Extração de DNA genômico de alta qualidade (segmentação de genes).
    1. Adicionar 500 μL de tampão de cauda (Tris 50 mM, pH = 8, EDTA 100 mM, pH = 8; NaCl 100 mM, SDS a 1% e 0,5% de proteinasa K, adicionada recentemente).
    2. Incubar durante a noite a 55 ° C.
    3. Misture por 5 minutos com a inversão (não vortex).
    4. Adicione 250 μL de NaCl saturado (6 M) e misture durante 5 minutos invadindo (não vortex).
    5. Girar por 5-10 min a 12.000 xg e 4 ° C e despeje o sobrenadante para o novo tubo. Adicione 500 μL de isopropanol e misture por 5 minutos com inversão (não vortex).
    6. Gire durante 10 minutos a 12.000 xg e temperatura ambiente.
    7. Decantar o sobrenadante (o pellet é invisível e fica com o tubo).
    8. Lavar com 1 mL de etanol a 70%.
    9. Rotação por 5-10 min a 12.000 xg e temperatura ambiente. Remova o sobrenadante com cuidado, já que o sedimento branco não é mais pegajoso e pode ser perdido.
    10. Seque o ar por ~ 1 h.
    11. Adicionar 400 μL de tampão TE (Tris 10 mM e EDTA 1 mM, pH = 8).
    12. Dissolver o DNA a 55-60 ° C durante 2 h.
  3. Desenho inicial.
    1. Desenhe primers com um mínimo de 20 pb de comprimento usando uma ferramenta computacional 19 .
      NOTA: Para a integração aleatória, os primers devem se hibridizar com o transgene, gerando um fragmento distinto de 200-800 pb. Para a segmentação por genes, crie os primers para que eles hibridem com o DNA genômico, gerando um f distintoAumentando algumas centenas de bp em torno dos locais cortados. Para inserções grandes, os iniciadores podem se sentar no transgene, mas a confirmação da integração direcionada deve ser realizada subsequentemente usando uma caminhada de iniciador ou uma técnica similar.
  4. Genotipagem por PCR.
    1. Para cada modificação genômica, crie um novo protocolo de PCR e teste-o empiricamente. Considere o comprimento do fragmento gerado e a temperatura de fusão (Tm) de cada par de primers.
  5. Seqüenciamento.
    1. Para a segmentação por genes, envie produtos de PCR para um provedor de serviços de seqüestro Sanger.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Abaixo, descrevem-se os fluxos de trabalho para microinjecção no caso de integração aleatória e orientação de genes mediada por CRISPR ( Figura 1 ).

figura 1
Figura 1: Fluxo de trabalho típico para a geração de ratos modificados genéticamente. Para a integração aleatória, o transgene purificado é injetado no pronúcleo de oócitos fertilizados antes da transferência de oviduto em fêmeas adotivas obstruídas. A análise da progênie é realizada por PCR após uma rápida extração de DNA genômico. Para o alvo de genes CRISPR, os sgRNAs são sintetizados usando o método de não clonagem descrito aqui e duas guias são co-injetadas (juntamente com o ARNm Cas9) no citoplasma de oócitos fertilizados. Esta estratégia é utilizada para análise subsequente baseada em PCR da progênie, que requer g altamente purificadoDNA enomático. Clique aqui para ver uma versão maior desta figura.

Embora a microinjecção de oócitos e o reimplante destes ovos injetados sejam os dois principais passos limitantes que exigem habilidades técnicas e treinamento, a qualidade da mistura de injeção é de extrema importância para gerar com sucesso camundongos modificados. A qualidade da purificação de transgene ( Figura 2A ) e a síntese de sgRNAs ( Figura 3A ) devem ser avaliadas sistematicamente em géis de agarose analíticos. As contaminações potenciais da mistura também devem ser verificadas ao medir as concentrações com um espectrofotômetro, uma vez que os diferentes valores de absorção dependem diretamente do grau de pureza da solução (ver etapas 1.2.3, 2.2.3.5 e 2.2.5.3).

Figura 2B ) quanto para segmentação de genes ( Figura 3B ). Os protocolos de extração de DNA também são diferentes dependendo do tipo de experiências; PCRs subseqüentes dependem de iniciadores que se hibridam quer no transgene quanto no DNA genômico, respectivamente. As estratégias apresentadas aqui permitem a solução de problemas fácil e a racionalização de cada passo necessário para produzir camundongos geneticamente modificados.

Embora o resultado quantitativo de uma sessão de microinjeção varie dependendo da experiência do experimentador, uma vez que cada etapa do protocolo é otimizada, a porcentagem de cachorros transgênicos obtidos geralmente deve atingir 10-25% para entérgio aleatórioComo ilustrado na Figura 2B (4 fundadores de 15 cachorros nascidos = 26,6%). Essa eficiência um pouco "baixa" contrasta com a capacidade confiável dos componentes CRISPR para editar o genoma do mouse. De fato, o número de fundadores gerados é geralmente maior quando se usa CRISPR para segmentação gênica e varia de 25-100% (ver Figura 3B ; 3 fundadores de 13 filhotes = 23%). Não é incomum obter uma progênie inteira que seja homozigoto com sucesso quando são editados usando CRISPR.

Figura 2
Figura 2: Estratégia de controle de qualidade e genotipagem para a produção bem sucedida de ratos transgênicos para superexpressão. ( A ) O plasmídeo é digerido durante 1 h com PvuI e NotI. Digestão completa e tamanhos corretos ( ou seja, transgene = 7,338 pb, espinha dorsal = 1,440+ 896 pb) são verificados em um gel analítico (1). A extração de vários produtos de digestão a partir do gel preparatório (2) gera uma concentração aumentada do transgene. A exposição prolongada a UV deve ser evitada e é recomendável o uso de uma luz azul em vez de um transiluminador UV. (B) Estratégia de genotipagem (1): Os iniciadores devem se sentar no transgene e devem ser projetados para gerar um fragmento de 200 a 800 pb. Quando a genotipagem é realizada (2), recomenda-se que inclua um controle positivo ( ou seja, a mistura de injeção usada para microinjeção) e um controle negativo ( ou seja, DNA genômico de um mouse WT). Clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3: Controle de Qualidade e Genotipagem StraPara a produção bem-sucedida de ratos geneticamente orientados (KO). ( A ) A qualidade dos sgRNAs produzidos por transcrição in vitro é avaliada executando o modelo de DNA e o ARN gerado em paralelo para cada guia. O tamanho do ARN é um pouco maior do que o DNA. Se a qualidade for satisfatória ( ou seja, sem bandas de esfregaço), as concentrações são medidas. ( B ) (1) Desenho das duas guias (direções opostas) abrangendo o codão Start em Exon 1. Os iniciadores são selecionados para hibridar com o DNA genômico fora da região eventualmente excisado pelos dois guias. Normalmente, esta estratégia permite a identificação direta de fundadores de KO heterozigotos (# 5 e 9) e homozigóticos (# 3) usando PCR (2). Os produtos de PCR de animais homozigotos não exibem qualquer banda WT. Clique aqui para ver uma versão maior desta figura.

Reação Componentes Volume Nota Síntese de modelo de DNA linear
(2.5) Água livre de nuclease 97,2 μL 5x tampão HF 36 μL MgCl2 9 μL DNTPs 10 mM 9 μL Iniciador Fwd 10 μM 9 μL 5'TTAATACGACTCACTATAGN 20
Gttttagagctagaaatagcaagttaaaata
Aggctagtc 3 ' Iniciador de revolução 10 μM 9 μL 5 'AAAAGCACCGACTCGGTGCC 3' PrPolimerase de leitura 1,8 μL IVT usando um kit de síntese de RNA T7
(2.6) Água livre de nuclease X μL Faça até 20 μL de volume total Mistura tampão NTP 10 μL DNA de modelo ≈ 300 ng T7 RNA polimerase 2 μL

Tabela 1: Composição das diferentes misturas mestre usadas neste estudo. Síntese do modelo linear de DNA: a sequência mínima do promotor T7 (TTAATACGACTCACTATAG) é a montante da sequência de 20 pb (guia N, identificado usando a ferramenta de projeto CRISPR) e uma seqüência complementar ao vetor de expressão (gttttagagctagaaatagcaagttaaaataaggctagtc). Em vitroTranscrição (IVT): Dependendo da concentração do modelo de DNA, o volume final deve ser ajustado para 20 μL com água livre de nuclease.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Passos críticos dentro do protocolo

A geração de camundongos geneticamente modificados é conhecida por ser tecnicamente desafiadora. No entanto, o protocolo apresentado aqui é um método otimizado e simplificado que permite dominar e solucionar a técnica em tempo recorde. Há duas etapas necessárias para a conclusão bem-sucedida da técnica. Primeiro, a síntese de modelos de DNA linear (para a síntese de sgRNAs) pode ser conseguida sem cloreto de magnésio (MgCl2). No entanto, é altamente recomendado adicionar de forma sistemática MgCl 2 à mistura principal porque a hibridação parcial do iniciador direto é frequentemente evitada na ausência de MgCl2. Além disso, é fundamental que a sequência genômica alvo não esteja presente em nenhuma parte do modelo do doador (no caso de integração direcionada), caso contrário, a nuclease Cas9 irá cortá-la, evitando a ocorrência de HDR.

ModificaçõesE solução de problemas

Embora este protocolo para a geração de ratos geneticamente modificados tenha sido otimizado e simplificado ao longo dos anos, existem algumas considerações relacionadas ao rendimento de oócitos de boa qualidade para microinjeção e à taxa de conexão de fêmeas adotivas. A escolha da tensão de fundo é crítica em relação ao número de cachorros vivos resultantes de uma sessão de microinjeção. C57BL / 6 é o fundo mais utilizado para modelos de doenças de ratos. No entanto, é também um dos fundos menos eficientes em termos de resistência à microinjeção 20 . Além disso, a idade da fêmea também é crítica para produzir um grande número de oócitos; Recomenda-se evitar ratos 5-8 semanas de idade, independentemente do contexto, pois este é o período menos favorável de resposta à estimulação hormonal 21 . Na nossa experiência, ratinhos C57BL / 6 de 3 a 4 semanas de idade confiam em 20-30 ovos por fêmea. É importanteNote que uma nova técnica (referida como ultra-superovulação) produziu até 100 ovos por fêmea e recentemente foi usada para gerar oócitos para microinjeção 22 . No entanto, o uso de ultra-superovulação para microinjecção geralmente é dificultado pela necessidade de fertilizar artificialmente (fertilização in vitro ) como um grande número de ovos.

Para obter fêmeas adotivas encapsuladas adequadas para o reimplante, os camundongos são acasalados com machos vasectomizados (o fundo desses ratos não é crítico). Para aumentar o número de receptores conectados, pode-se realizar um exame cuidadoso do estágio do estro e a seleção de fêmeas adequadas 23 . A sincronização dos ciclos das fêmeas também pode ser induzida pela exposição das fêmeas aos machos vasectomizados dois dias antes do acasalamento (o chamado "efeito Whitten") 24 .

Limitações da técnica

Modificações genômicas muito pequenas, como mutações pontuais, são relativamente fáceis de gerar, mas são difíceis de identificar. Quando a genotipagem é realizada, os produtos de PCR são sequenciados diretamente pelo seqüenciamento de Sanger. No entanto, a microinjecção direta de componentes de CRISPR em oócitos de ratos geralmente gera animais de mosaico porque o Cas9 permanece ativo por algum tempo e diferentes modificações genômicas podem ocorrer após a primeira divisão do oócito. Esse efeito de confusão complica a identificação de mutações discretas entre vários alelos e a sequenciação da próxima geração (NGS) pode ajudar com leituras desafiadoras. Técnicas sensíveis, como o tetra-primerARMS-PCR, 25 também pode ajudar na genotipagem da colônia após a identificação dos fundadores por seqüência.

Por outro lado, a inserção de grandes pedaços de DNA de forma direcionada continua sendo desafiadora. Quanto maior o DNA exógeno, menor a eficiência do HDR. Consequentemente, estão sendo desenvolvidas novas estratégias, como o uso de dadores de ssOligos longos (em vez de plasmídeos) 26 ou integração direta independente de HDR 27 .

Significado do protocolo

Este protocolo apresenta avanços significativos porque as quatro etapas principais ( ie, preparação do transgene ou componentes CRISPR, microinjeção, reimplantação e genotipagem) foram otimizadas, testadas e validadas em nosso laboratório.

A integração aleatória de transgenes é amplamente utilizada para estudos de sobreexpressão por duas razões principais. Primeiro, para avoO potencial "efeito de posição", a integração direcionada de um transgene usando CRISPR em loci "safe harbor", como os loci Rosa26 28 e Col1a 29 , permanece notoriamente desafiador, uma vez que a eficiência do HDR é baixa. Estratégias para superar este problema são 26 , 27 , mas a integração aleatória até agora se mostrou mais eficiente. Além disso, a geração de múltiplas linhas transgênicas que sobre-expressam o mesmo transgene com diferentes níveis de expressão é de interesse em estudos envolvendo estratégias de tratamento para reverter um fenótipo 30 . Os transgenes à base de plasmídeo são gerados por meio de clonagem, utilizando enzimas de restrição ad hoc para reunir fragmentos essenciais para a expressão de uma proteína de interesse. Geralmente, um transgene é feito de pelo menos três elementos: um promotor adequado (as regiões de intensificador são por vezes adicionadas); A codificaçãoSequência (cDNA), com ou sem regiões intrónicas; E uma cauda PolyA para estabilizar a expressão de mRNA 31 .

Uma vez montado, o transgene é inserido em um plasmídeo contendo elementos de replicação bacteriana e expandido em cultura após transformação (tipicamente baseado em choque de calor). O método de purificação dos transgenes para microinjecção é crítico. Este trabalho descreve o uso de manchas de DNA de nova geração (baixa toxicidade) para a visualização mais precisa do fragmento de interesse no gel (em comparação com a violeta de cristal tradicional) e de baixa exposição mutagênica (em comparação com o brometo de etidio).

O método de não clonagem aqui descrito para segmentação gênica é muito rápido e permite a síntese de vários sgRNAs em apenas 5-6 h. São necessários apenas quatro passos: a identificação da sequência alvo, a síntese de um modelo de DNA linear contendo um promotor T7 e a sequência alvo escolhida, a síntese oF o sgRNA por transcrição in vitro (IVT), e a purificação do sgRNA usando colunas de rotação.

Na idade precoce da edição do genoma do mouse CRISPR, o efeito potencial fora do alvo foi sistematicamente avaliado, embora tenha sido demonstrado que seja muito limitado em embriões de camundongos 32 e pode ser facilmente diluído por meio de um esquema de reprodução em que os ratos selecionados apenas carregam A modificação genômica desejada. A atividade no alvo também foi sistematicamente pré-avaliada in vitro , usando guias diferentes e selecionando a (s) mais ativa (s) 12 . Esta prática é agora menos comum, por vários motivos. Primeiro, a atividade no alvo é avaliada usando a transfecção de linhas de células de mouse imortalizadas (tipicamente N2a ou NIH3T3) com plasmídeos codificadores de CRISPR. Este é um método diferente do que a injeção de componentes CRISPR RNA em oócitos de ratos. Portanto, os resultados encontrados in vitro nem sempre se traduzem igualmenteAos oócitos. Além disso, experiências de alto rendimento mostraram que a maioria dos guias está ativa 33 . Conseqüentemente, a atividade no alvo não é avaliada e, até agora, não houve evidência de um guia que não mostre atividade em oócitos de rato. Juntamente com o método de não clonagem para sintetizar sgRNAs, apresentado aqui, isso simplifica e agiliza o fluxo de trabalho, e vários guias ativos podem ser sintetizados em um dia.

O CRISPR é considerado uma "tecnologia disruptiva", que é uma inovação que altera a maneira como as técnicas são realizadas. Quando a microinjecção foi estabelecida, Brinster et al. Mostraram que a transgênese citoplasmática, embora realizável, permaneceu na maior parte ineficiente 7 . Conseqüentemente, a microinjeção pronuclear permaneceu a única prática comum por quase 30 anos, até a primeira demonstração de um gene CRISPR bem sucedido visando em camundongos. Este estudo mostrou que o microinjetor citoplasmático Ion poderia gerar um resultado semelhante ou superior em comparação com a entrega pronuclear 12 . Obviamente, porque os componentes CRISPR são tipicamente feitos de RNA, é evidente que o citoplasma é alvo. No entanto, mesmo quando injetados no citoplasma, os modelos de doadores também podem induzir HDR com sucesso. Uma alta concentração citoplasmática de modelos permite a sua difusão no núcleo. Além disso, o uso de microinjeção citoplasmática direcionada a piezo 16 não é um requisito. Uma pequena incubação dos oócitos com um inibidor do citoesqueleto, como a citocalasina B, aumenta a sobrevivência dos oócitos 34 , 35 , tornando-se suficiente para realizar injeções citoplasmáticas sem sistema de acionamento de impacto piezoelétrico. Do mesmo modo, o uso de um meio de cultura melhorado, como KSOMaa, diminui o bloqueio no estágio de duas células e melhora as capacidades de desenvolvimento dos embriões em comparação com o meio M16Xref "> 36.

Os embriões de uma célula ou de duas células (quando cultivados durante a noite) podem ser transferidos para o oviduto. O procedimento convencional é bastante invasivo, pois requer quebrar a bursa que protege o ovário. Também é tecnicamente desafiador, porque o capilar de vidro precisa ser inserido no infundíbulo 15 . O método aqui apresentado é muito mais fácil de aprender, não induz o sangramento potencial e preserva a integridade do ovário. Baseia-se no trabalho desenvolvido na Universidade Kumamoto 37 .

As estratégias de genotipagem e as técnicas de sequenciação são fundamentais para identificar potenciais fundadores. Para a integração aleatória, a extração de DNA genômico é baseada em um método simples, adaptado de Truett et al. 38 . Esse método de extração rápida é suficiente para identificar potenciais fundadores, uma vez que os primers são projetados para hibridar com o transgene (muitas vezes integradoComo múltiplas cópias). Por outro lado, o alvo de genes requer DNA genômico altamente purificado, uma vez que o produto de PCR engloba a região genômica modificada.

Para o knockout de genes, o método tradicional de injetar um único sgRNA gera pequenas deleções (indels) ou inserções, eventualmente eliminando o gene de interesse 12 . Essas pequenas modificações são difíceis de identificar e, muitas vezes, exigem uma clonagem e seqüenciamento que consome tempo, dependendo da ligase, para confirmar a natureza dessas mutações.

Neste protocolo, aproveitamos a multiplexação CRISPR para desenvolver a co-injeção sistemática de dois sgRNAs abrangendo o codão de início de um gene de interesse. Isso não só aumenta a probabilidade de um nocaute de genes, mas também a excisão de um pedaço de DNA genômico de um tamanho predefinido (100-300 pb), permitindo a identificação fácil dos fundadores por PCR simples. De notar, filhotes que não carregam o esperado genômico eA xcision ainda pode ser analisada para pequenas mutações de deslocamento de quadros, quando apenas um sgRNA se mostrou ativo. Da mesma forma, no caso da edição de genes, a co-injeção sistemática de dois sgRNAs sobrepostos em direções opostas deve aumentar a eficiência do HDR, uma vez que os mecanismos de reparo celular preferencialmente usam um dos dois fios 39 .

Aplicações futuras

O presente protocolo aproveita os últimos desenvolvimentos em embriologia de mouse e segmentação gênica 40 para simplificar e agilizar o processo de geração de vários modelos de mouse sofisticados de condições humanas. Esses modelos desempenham um papel fundamental para ajudar a desenvolver nossa compreensão dos mecanismos patogênicos, auxiliando, em última análise, no desenvolvimento de estratégias terapêuticas 2 . A otimização e racionalização dos reagentes necessários para a segmentação gênica ou a integração aleatória são amplamente e prontamente aplicáveis.Para outras espécies de mamíferos, como ratos, coelhos e até animais grandes, como o gado.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores fornecem serviços de transgênese acadêmica em camundongos através do Centro Analítico Mark Wainwright da Universidade de Nova Gales do Sul.

Acknowledgments

Os autores agradecem a equipe da instalação animal (BRC) por seu apoio contínuo. Este trabalho foi financiado pelo National Health and Medical Research Council e pelo Australian Research Council.

Materials

Name Company Catalog Number Comments
Micropipette 0.1-2.5 μL Eppendorf 4920000016
Micropipette 2 - 20 μL Eppendorf 4920000040
Micropipette 20 - 200 μL Eppendorf 4920000067
Micropipette 100 - 1,000 μL Eppendorf 4920000083
Molecular weight marker  Bioline BIO-33025 HyperLadder 1 kb
Molecular weight marker  Bioline BIO-33056 HyperLadder 100 bp
Agarose Bioline BIO-41025
EDTA buffer Sigma-Aldrich 93296 10x - Dilute to 1x
Ethidium bromide Thermo Fisher Scientific 15585011
SYBR Safe gel stain Invitrogen S33102
Gel extraction kit Qiagen 28706
PCR purification kit (Qiaquick) Qiagen 28106
Vacuum system (Manifold) Promega A7231
Nuclease-free microinjection buffer  Millipore MR-095-10F
Ultrafree-MC microcentrifuge filter  Millipore UFC30GV00
Cas9 mRNA Sigma-Aldrich CAS9MRNA
CRISPR expressing plasmid (px330) Addgene 42230
Nuclease free water Sigma-Aldrich W4502
Phusion polymerase New England Biolabs M0530L
T7 Quick High Yield RNA kit New England Biolabs E2050S
RNA purification spin columns (NucAway) Thermo Fisher Scientific AM10070
ssOligos Sigma-Aldrich OLIGO STANDARD
Donor plasmid Thermo Fisher Scientific GeneArt
Hyaluronidase Sigma-Aldrich H3884
KSOMaa embryo culture medium Zenith Biotech  ZEKS-100
Mineral oil Zenith Biotech  ZSCO-100
M2 Medium Sigma-Aldrich M7167
Cytochalasin B Sigma-Aldrich C6762
Mouthpiece Sigma-Aldrich A5177
Glass microcapillaries Sutter Instrument BF100-78-10
Proteinase K Applichem A3830.0100
Dumont #5 forceps Fine Science Tools  91150-20
Iris scissors Fine Science Tools  91460-11
Vessel clamp Fine Science Tools  18374-43
Wound clips  Fine Science Tools  12040-01
Clips applier  Fine Science Tools  12018-12
Micro-scissors  Fine Science Tools  15000-03
Cauterizer Fine Science Tools  18000-00
Non-absorbable surgical sutures (Ethilon 3-0) Ethicon 1691H
5% CO2 incubator MG Scientific Galaxy 14S
Spectrophotometer Thermo Fisher Scientific Nanodrop 2000c
Thermocycler Eppendorf 6321 000.515
Electrophoresis set up BioRad 1640300
UV Transilluminator BioRad 1708110EDU
Thermocycler Eppendorf 6334000069
Stereoscopic microscope Olympus SZX7
Inverted microscope Olympus IX71
2x Micromanipulators Eppendorf 5188000.012
Oocytes manipulator Eppendorf 5176000.025
Microinjector (Femtojet) Eppendorf 5247000.013
Mice C57BL/6J strain Australian BioResources C57BL/6JAusb 

DOWNLOAD MATERIALS LIST

References

  1. Ittner, L. M. Dendritic function of tau mediates amyloid-beta toxicity in Alzheimer's disease mouse models. Cell. 142, (3), 387-397 (2010).
  2. Ittner, A. Site-specific phosphorylation of tau inhibits amyloid-beta toxicity in Alzheimer's mice. Science. 354, (6314), 904-908 (2016).
  3. Marantz Henig, R. The Monk in the Garden. Mariner books. (2000).
  4. Jaenisch, R., Mintz, B. Simian virus 40 DNA sequences in DNA of healthy adult mice derived from preimplantation blastocysts injected with viral DNA. Proc Natl Acad Sci U S A. 71, (4), 1250-1254 (1974).
  5. Gordon, J. W., Ruddle, F. H. Integration and stable germ line transmission of genes injected into mouse pronuclei. Science. 214, (4526), 1244-1246 (1981).
  6. Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A., Ruddle, F. H. Genetic transformation of mouse embryos by microinjection of purified DNA. Proc Natl Acad Sci U S A. 77, (12), 7380-7384 (1980).
  7. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Yagle, M. K., Palmiter, R. D. Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc Natl Acad Sci U S A. 82, (13), 4438-4442 (1985).
  8. Capecchi, M. R. Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century. Nat Rev Genet. 6, (6), 507-512 (2005).
  9. Carbery, I. D. Targeted genome modification in mice using zinc-finger nucleases. Genetics. 186, (2), 451-459 (2010).
  10. Sung, Y. H. Knockout mice created by TALEN-mediated gene targeting. Nat Biotechnol. 31, (1), 23-24 (2013).
  11. Jinek, M. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  12. Wang, H. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  13. Kang, X. Introducing precise genetic modifications into human 3PN embryos by CRISPR/Cas-mediated genome editing. J Assist Reprod Genet. 33, (5), 581-588 (2016).
  14. Liang, P. CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes. Protein Cell. 6, (5), 363-372 (2015).
  15. Ittner, L. M., Götz, J. Pronuclear injection for the production of transgenic mice. Nat Protoc. 2, (5), 1206-1215 (2007).
  16. Yang, H., Wang, H., Jaenisch, R. Generating genetically modified mice using CRISPR/Cas-mediated genome engineering. Nat Protoc. 9, (8), 1956-1968 (2014).
  17. CRISPR DESIGN. Available from: http://crispr.mit.edu (2017).
  18. Integrated DNA Technologies. Resuspension Calculator. Available from: https://sg.idtdna.com/calc/resuspension/ (2017).
  19. BioTools at UMass Medical School. Primer3: WWW primer tool. Available from: http://biotools.umassmed.edu/bioapps/primer3_www.cgi (2017).
  20. Auerbach, A. B. Strain-dependent differences in the efficiency of transgenic mouse production. Transgenic Res. 12, (1), 59-69 (2003).
  21. Merriman, J. A., Jennings, P. C., McLaughlin, E. A., Jones, K. T. Effect of aging on superovulation efficiency, aneuploidy rates, and sister chromatid cohesion in mice aged up to 15 months. Biol Reprod. 86, (2), 49 (2012).
  22. Nakagawa, Y., et al. Ultra-superovulation for the CRISPR-Cas9-mediated production of gene-knockout, single-amino-acid-substituted, and floxed mice. Biol Open. 5, (8), 1142-1148 (2016).
  23. Byers, S. L., Wiles, M. V., Dunn, S. L., Taft, R. A. Mouse estrous cycle identification tool and images. PLoS One. 7, (4), e35538 (2012).
  24. Whitten, W. K. Modification of the oestrous cycle of the mouse by external stimuli associated with the male. J Endocrinol. 13, (4), 399-404 (1956).
  25. Ye, S., Dhillon, S., Ke, X., Collins, A. R., Day, I. N. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 29, (17), E88 (2001).
  26. Yoshimi, K., et al. ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat Commun. 7, 10431 (2016).
  27. Suzuki, K., et al. In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. (2016).
  28. Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 21, 70-71 (1999).
  29. Liu, X., et al. A targeted mutation at the known collagenase cleavage site in mouse type I collagen impairs tissue remodeling. J Cell Biol. 130, (1), 227-237 (1995).
  30. Ke, Y. D. Short-term suppression of A315T mutant human TDP-43 expression improves functional deficits in a novel inducible transgenic mouse model of FTLD-TDP and ALS. Acta Neuropathol. 130, (5), 661-678 (2015).
  31. Auerbach, A. B. Production of functional transgenic mice by DNA pronuclear microinjection. Acta Biochim Pol. 51, (1), 9-31 (2004).
  32. Iyer, V., et al. Off-target mutations are rare in Cas9-modified mice. Nat Methods. 12, (6), 479 (2015).
  33. Zhou, Y. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 509, (7501), 487-491 (2014).
  34. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Avarbock, M. R. Translation of globin messenger RNA by the mouse ovum. Nature. 283, (5746), 499-501 (1980).
  35. Pinkert, C. A., Irwin, M. H., Johnson, L. W., Moffatt, R. J. Mitochondria transfer into mouse ova by microinjection. Transgenic Res. 6, (6), 379-383 (1997).
  36. Biggers, J. D., Summers, M. C. Choosing a culture medium: making informed choices. Fertil Steril. 90, (3), 473-483 (2008).
  37. Nakagata, N. Embryo transfer through the wall of the fallopian tube in mice. Jikken Dobutsu. 41, (3), 387-388 (1992).
  38. Truett, G. E. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  39. Richardson, C. D., Ray, G., DeWitt, M. A., Curie, G. L., Corn, J. E. Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 34, (3), 339-344 (2016).
  40. Delerue, F., Ittner, L. M. Genome Editing in Mice Using CRISPR/Cas9: Achievements and Prospects. Clon. Transgen. 4, (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics