Oocytes के सूक्ष्मदर्शन के माध्यम से आनुवंशिक रूप से संशोधित चूहे का उत्पादन

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

माउज़ ऑक्साइट्स का माइक्रोिनजेक्शन सामान्यतः दोनों क्लासिक ट्रांसजेनेसिस ( यानी, ट्रांसजेनेन्स का यादृच्छिक एकीकरण) और सीआरआईएसपीआर-मध्यस्थता वाले जीन लक्ष्यीकरण के लिए प्रयोग किया जाता है। यह प्रोटोकॉल माइक्रोइन्जेक्शन में नवीनतम घटनाओं की समीक्षा करता है, गुणवत्ता नियंत्रण और जीनोटाइपिंग रणनीतियों पर विशेष बल देता है।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Delerue, F., Ittner, L. M. Generation of Genetically Modified Mice through the Microinjection of Oocytes. J. Vis. Exp. (124), e55765, doi:10.3791/55765 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

आनुवांशिक रूप से संशोधित चूहों के उपयोग ने विवो प्रक्रियाओं में शारीरिक और रोग दोनों पर अध्ययन के लिए महत्वपूर्ण योगदान दिया है। डीएनए अभिव्यक्ति के विस्फोटक इंजेक्शन उर्वरित ऑक्साइट्स में निर्माण होता है, अत्यधिक अव्यवस्था के लिए ट्रांसजेनिक चूहों को उत्पन्न करने के लिए सबसे अधिक इस्तेमाल किया जाने वाला तकनीक है। जीन को लक्षित करने के लिए सीआरआईएसएसआर तकनीक की शुरुआत के साथ, निषेचित अयस्कों में विस्फोटक इंजेक्शन दोनों पीटा और नॉकिन चूहों की पीढ़ी तक बढ़ा दिया गया है। यह काम इंजेक्शन के लिए डीएनए की तैयारी और जीन लक्ष्यीकरण के लिए सीआरएसआरपी गाइड की पीढ़ी का वर्णन करता है, जो गुणवत्ता नियंत्रण पर विशेष बल देता है। संभावित संस्थापकों की पहचान के लिए आवश्यक जीनोटाइपिंग प्रक्रिया महत्वपूर्ण हैं। अभिनव जीनोटाइपिंग रणनीतियां जो कि सीआरआईएसपीआर की "बहुसंकेतन" क्षमताओं का लाभ उठाती हैं, यहां प्रस्तुत की जाती हैं। सर्जिकल प्रक्रियाओं को भी रेखांकित किया जाता है। साथ में, प्रोटोकॉल के चरण सामान्य जनरेशन के लिए अनुमति देगाएटिनीलॉजी, न्यूरोसाइंस, कैंसर, फिजियोलॉजी, डेवलपमेंट, और अन्य सहित, अनुसंधान क्षेत्रों के लिए एटिस्टिक रूप से संशोधित चूहों और माउस कॉलोनियों की बाद की स्थापना के लिए।

Introduction

मस्तिष्क और अपरिवर्तक दोनों में पशु मॉडल, अल्जाइमर रोग 1 , 2 जैसे मानव स्थितियों के रोगक्षेत्र विज्ञान की जांच करने के लिए महत्वपूर्ण हैं। वे बीमारी संशोधकों की खोज के लिए अन्वेषण उपकरण भी हैं और अंततः इलाज की आशा में उपन्यास उपचार रणनीतियों का विकास करते हैं। हालांकि प्रत्येक मॉडल में आंतरिक सीमाएं हैं, पूरे सिस्टमिक मॉडल के रूप में पशुओं का उपयोग जैव-चिकित्सा अनुसंधान के लिए महत्वपूर्ण है इसका कारण यह है कि चयापचय और जटिल शारीरिक वातावरण टिशू कल्चर में पूरी तरह से सिम्युलेटेड नहीं हो सकते।

तिथि करने के लिए, माउस आनुवांशिक हेरफेर के लिए उपयोग की जाने वाली सबसे आम स्तनधारी प्रजातियां बनी हुई है क्योंकि इसमें कई फायदे हैं। बीमारियों से संबंधित शारीरिक प्रक्रियाएं और जीन चूहों और मनुष्यों के बीच अत्यधिक संरक्षित हैं मानव जीनोओ के एक साल पहले, पूरे जीनोम अनुक्रम (2002) के लिए माउस पहला स्तनधार थामे (2003) आनुवांशिक जानकारी के इस धन के अलावा, माउस को अच्छी प्रजनन क्षमताएं, एक तेजी से विकास चक्र (निषेचन के लिए 6 सप्ताह की मात्रा), और एक उचित आकार है। इन सभी फायदे, शारीरिक संकेतकों के साथ मिलकर, जैसे कि अलग कोट रंग (पार करने की रणनीति के लिए आवश्यक) ने माउस को आनुवांशिक हेरफेर के लिए एक आकर्षक मॉडल बना दिया। विशेषकर, आधुनिक आनुवंशिकी के शुरुआती युग में, ग्रेगर मेंडल ने पौधों में जाने से पहले चूहों पर काम करना शुरू कर दिया।

जीन ट्रांसफर तकनीक के परिणामस्वरूप तीन दशक पहले तीन ट्रांसजेनिक माउस की उत्पत्ति हुई थी, शुरू में वायरल डिलीवरी का उपयोग कर बनाया गया था। हालांकि, शोधकर्ताओं ने जल्द ही यह महसूस किया कि माउस ट्रांसजेनेसिस की मुख्य चुनौतियों में से एक बाहरी डीएनए के भाग्य को नियंत्रित करने में असमर्थता थी। चूंकि माउस oocytes में ट्रांसजेनेस की वायरल डिलीवरी परिणामस्वरूप कई प्रतियां जीनोम में अनियमित रूप से एकीकृत होती हैं, संभावनाबाद में ट्रांसजेनिक लाइनों की स्थापना के वाई सीमित थे।

एक ऐसी सीमा को दूर कर दिया गया जब गॉर्डन एट अल माइक्रोइंजेंसी 5 , 6 द्वारा पहली ट्रांसजेनिक माउस लाइन उत्पन्न की। इसने पुनः संयोजक डीएनए प्रौद्योगिकी का युग शुरू किया, और माइक्रोिनगेक्शन सत्र के परिणाम को प्रभावित करने वाले पैरामीटर का व्यापक अध्ययन किया गया है 7 । यद्यपि microinjection transgene के एकीकरण साइट (जो अंततः प्रत्येक संस्थापक माउस के लिए विशिष्ट अभिव्यक्ति के स्तर में परिणाम) पर नियंत्रण के लिए अनुमति नहीं देता है, हालांकि, एक्सक्ल्यूअम microinjection का मुख्य लाभ concatemers ( यानी, transgene की कई प्रतियों के arrays, श्रृंखला में जुड़ा हुआ है) जीनोमिक एकीकरण से पहले 5 हजारों ट्रांसजेनिक माउस लाइनों को स्थापित करने के लिए वर्षों में इस विशेषता का उपयोग किया गया है कि ब्याज की एक जीन को अस्वाभाव कीजिए। तब से, ट्रांसजेनेसिस, एएक जीव जीनोम के rtificial संशोधन, बड़े पैमाने पर रोगों की घटना में एक जीन की भूमिका की पहचान करने के लिए बड़े पैमाने पर उपयोग किया गया है।

माउस जीनोम को छेड़छाड़ करने के लिए एक और महत्वपूर्ण उपलब्धि तब पहुंची थी जब मारियो केपकेची ने 8 में जीन लक्ष्यीकरण के युग को खोलकर सफलतापूर्वक माउस में एक एकल जीन को बाधित किया था। हालांकि, एसई कोशिका आधारित कोशिकाओं की चुनौतियों सहित ईएस कोशिका-आधारित जीन लक्ष्यीकरण से शीघ्रता से बड़ी खामियां निकलती हैं, कुछ प्रकार की चिमारीवाद की गति, और प्रक्रिया की लंबाई ( यानी, 12-18 महीने, न्यूनतम, माउस प्राप्त करने के लिए) ।

हाल ही में, नई प्रौद्योगिकियों में अग्रिम, जैसे इंजीनियर एंडोन्यूक्ल्यूज़ ( जैसे, जस्ता फिंगर न्यूक्लियोज़ज़ (जेडएफएन), ट्रांस्क्रिप्शन एक्टिवेटर-जैसे एफ़ायर न्यूक्लेअसेज़ (टीएएलएन), और संकुल नियमित रूप से अंतःस्थापित लघु रिल्लींड्रोमिक दोहराता (सीआरआईएसपी / सीएस 9) वैकल्पिक तरीकों के रूप में उभरा है Mic में जीन लक्ष्यीकरण की प्रक्रिया में तेजी लाने के लिएई 9 , 10 इन एंडोन्यूक्ल्यूज़ को आसानी से माइक्रोएक्जेक्शन द्वारा माउस ओक्साइट्स में इंजेक्ट किया जा सकता है, जो कि 6 सप्ताह तक जीन-लक्षित चूहों की पीढ़ी के लिए अनुमति देता है।

जीनोम संपादन 11 के लिए सीआरआईएसपीआर के इस्तेमाल पर पहली रिपोर्ट के बाद से, यह बैक्टीरियल अनुकूली प्रतिरक्षा प्रणाली ने अपने कई फायदे के कारण ज़ीडएफ़एन और टालेन को छोड़ दिया है, जिसमें संश्लेषण की आसानी और एक बार में कई जगहों को लक्षित करने की क्षमता शामिल है ("बहुसंकेतन ")। सीआरआईएसपीआर पहली बार चूहों 12 में जीन को लक्षित करने के लिए इस्तेमाल किया गया था और उसके बाद से अनगिनत प्रजातियों के लिए पौधों से मनुष्यों 13 , 14 को लागू किया गया है। आज तक, सीआरआईएसपीआर जीनोम संपादन के प्रति प्रतिरोधी एक प्रजाति की कोई रिपोर्ट नहीं है।

ट्रांसजेनिक चूहों की पीढ़ी के दो मुख्य चरणों में oocytes और reimplantation के इंजेक्शन हैंछद्म गर्भवती मादाओं में इन oocytes की। यद्यपि इस तकनीक का हमारे द्वारा 15 और 16 अन्य लोगों द्वारा वर्णित किया गया है, हाल ही में माउस भ्रूणविज्ञान और जीन ट्रांसफर तकनीक में तकनीकी सुधार ने आनुवंशिक रूप से संशोधित चूहों को पैदा करने की प्रक्रिया में क्रांति ला दी है। इन सुधारों को यहां वर्णित किया जाएगा।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

सभी प्रक्रियाएं न्यू साउथ वेल्स के पशु देखभाल और नैतिकता समिति विश्वविद्यालय द्वारा अनुमोदित कर दी गई हैं।

1. ट्रांसजीने की तैयारी (रैंडम एकीकरण)

  1. विश्लेषणात्मक agarose जेल वैद्युतकणसंचलन
    1. निर्माता की सिफारिशों ( चित्रा 2 ए और उसके पौराणिक कथा देखें) के बाद एक थर्मोसाइक्लर में उचित एंजाइमों (1 एच ऊष्मायन) या फास्ट-डाइजेस्ट एंजाइम (15 से 30 मिनट ऊष्मायन) का उपयोग करके ट्रांसजीने को उत्पादित करने के लिए डाइजेस्ट करें।
    2. 1% ट्राइस-एसीटेट-एथिलीनियाइनेटेट्रैसिटिक एसिड (ईडीटीए) (टीईए) agarose जेल, 0.5-1.0 माइक्रोग्राम / एमएल एथिडियम ब्रोमाइड (एटीबीआर) के साथ दाग डालना।
      नोट: EtBr का उपयोग करते समय सावधानी रखें; यह एक शक्तिशाली उत्परिवर्ती है कृपया उपयुक्त व्यक्तिगत सुरक्षा उपकरण का उपयोग करें (सामग्री सुरक्षा डेटा शीट देखें)
    3. 1 केबी आणविक वजन मार्कर लोड करें।
    4. रैखिक टुकड़े लोड करें ( यानी, ट्रांसजेन और बैकबोन)। 45 मिनट के लिए 100 वी पर वैद्युतकणसंचलन चलाएं
    5. जेल को एक पराबैंगनी (यूवी) ट्रांसिल्युमिनेटर पर विज़ुअलाइज़ करने के लिए जांच करें कि पाचन पूर्ण हो गया है और ट्रांसजीने के सही आकार की पुष्टि करने के लिए ( यानी, 7,338 बीपी, चित्रा 2 ए देखें)।
  2. तैयारी agarose जेल वैद्युतकणसंचलन
    1. एक 1% TAE agarose जेल एक कम विषाक्तता जेल दाग के साथ दाग डाली। एक आणविक वजन चिह्नक के बिना 8 अलग-अलग (1 माइक्रोग्राम प्रत्येक) लाइनरिज्ड ट्रांसजीन लोड करें और 100 वी के लिए 45 मिनट में वैद्युतकणसंचलन चलाएं। लाइनरिज्ड ट्रांसजीने से संबंधित सभी 8 बैंडों को एक्साइज करने के लिए एक स्केलपेल का उपयोग करें।
    2. निर्माता की सिफारिशों (सामग्री की तालिका देखें) का पालन करके एक जेल निष्कर्षण किट का उपयोग करके डीएनए निकालें।
      1. कम से कम 15 मिनट के लिए 1.5 मिलीलीटर ट्यूबों में 50 डिग्री सेल्सियस पर जेल टुकड़े पिगलो इसे isopropanol के साथ तरक्की और फिर बाध्यकारी बफर जोड़ें।
      2. संपूर्ण डी का मिश्रण करेंएनए द्वारा यह एक कॉलम में सभी pipetting। Nuclease- मुक्त microinjection बफर (8 मिमी Tris- एचसीएल और 0.15 मिमी EDTA) में Elute। एक 0.22 सुक्ष्ममापी microcentrifuge फिल्टर और 60 के लिए 12,000 x जी पर अपकेंद्रित्र के माध्यम से फ़िल्टर करें
    3. एक स्पेक्ट्रोफोटोमीटर का उपयोग करके एकाग्रता और डीएनए की गुणवत्ता को मापें। जांच लें कि ए 260 / ए 280 अनुपात 1.8 है ( यानी, प्रोटीन द्वारा कोई संदूषण नहीं) और ए 260 / ए 230 अनुपात कम से कम 2.0 है ( यानी, कार्बनिक सॉल्वैंट्स द्वारा कोई संदूषण नहीं)। 3 एनजी / μL तक न्युकले-फ्री माइक्रोइन्ग्जन बफर, ऑल्कोट (20-50 μL) में, और -20 डिग्री सेल्सियस पर फ्रीज करें।

2. सीआरएसपीआर अवयवों का संश्लेषण (जीन लक्ष्यीकरण)

  1. कैस 9 एमआरएनए
    1. कैस 9 एमआरएनए (एक वाणिज्यिक स्रोत से प्राप्त किया गया, सामग्री की तालिका देखें) को 1 माइक्रोग्राम / μ एल की एकाग्रता के लिए एन्यूकेलीज-फ्री माइक्रोएन्गेनाइजेशन बफर में पतला करें।
    2. 2 μL में विभाज्य और मुफ्त -80 डिग्री सेल्सियस पर ज़ी
  2. एकल-गाइड आरएनए (एसजीआरएनए)
    1. एक कॉम्प्युटेशनल डिज़ाइन टूल का इस्तेमाल करके वांछित दो-लक्ष्य जीनोमिक अनुक्रमों (गाइड) को पहचानें, जो कि न्यूनतम संभावित ऑफ-टाईप गतिविधि 17 को सक्षम करता है
      1. जीन नॉकआउट के लिए, व्यवस्थित रूप से विपरीत दिशाओं में कुछ सौ बेस-जोड़े (बीपी) अलग-अलग दो गाइडों का चयन करें, और रुचि के जीन के प्रारंभ कोडन को शामिल करें। समरूपता के लिए सीधे मरम्मत के लिए, दो अतिव्यापी गाइड (जब भी संभव हो), विपरीत दिशाओं में चुनें।
        नोट: एक उदाहरण के रूप में, निम्नलिखित गाइडों को हाल ही में टीपीएम 4.2 जीन के पहले एक्ज़ॉन को बाधित करने के लिए सफलतापूर्वक सह-इंजेक्शन दिया गया है:
        गाइड 1: 5 'CGCCATCCAGTTCGCGCTGC 3';
        गाइड 2: 5 'कैगैकगैग्काटैटजीजीसी 3'
    2. तालिका 1 में वर्णित प्राइमरों का एक सेट ऑर्डर करें
    3. एक रैखिक डीएनए टेम्पलेट को संश्लेषित करें
      1. पतला px330रिफ "> 10 एनजी / μL से 12 प्लाज्मिड नूसलेज़-फ्री पानी में।
      2. तालिका 1 में बताए अनुसार मुख्य मिश्रण तैयार करें अंत में पोलीमरेज़ जोड़ें और बर्फ पर मास्टर मिश्रण रखें।
      3. इसे 8 पीसीआर ट्यूबों (19 μL / ट्यूब) में मिलाकर विभाजित करें। प्रति ट्यूब 1 μL प्रति पीएलसी 330 जोड़ें और पीसीआर को निम्नलिखित शर्तों के तहत चलाएं: 1 मिनट 98 डिग्री सेल्सियस; 10 एस के लिए 98 डिग्री सेल्सियस के 40 चक्र, 30 एस के लिए 64 डिग्री सेल्सियस और 15 डिग्री के लिए 72 डिग्री सेल्सियस; और 5 मिनट के लिए 72 डिग्री सेल्सियस पर अंतिम वृद्धि 4 डिग्री सेल्सियस पर पकड़ो
      4. एक पीसीआर शुद्धि किट (सामग्री की सारणी देखें), एक मैनिफोल्ड और एक वैक्यूम स्रोत (तेज प्रसंस्करण के लिए) का उपयोग करके पीसीआर उत्पादों को शुद्ध करें। अधिकतम वैक्यूम ताकत ( यानी, 8 एमबार) को लागू करें।
        1. पीसीआर नमूने के 1 वॉल्यूम को 5 वॉल्यूम (100 μL) बाइंडिंग बफर जोड़ें और मिश्रण करें।
        2. सेंट्रिफ्यूगेशन के लिए (प्रदान) 2 एमएल संग्रह ट्यूब में एक (प्रदान) सिलिका झिल्ली स्पिन कॉलम रखें, या वैक्यूम प्रक्रिया के लिए मैनिफोल्ड परआईएनजी। डीएनए को बांधने के लिए, प्रत्येक लोड के लिए 1200 xg पर 60 के लिए स्तंभ और वैक्यूम या अपकेंद्रित्र के सभी 8 नमूनों को क्रमिक रूप से लागू करें
        3. धोने के लिए, 0.75 एमएल की वॉश बफर (बफर पीई) को कॉलम और वैक्यूम या सेंट्रीफ्यूज को 60 एस पर 12,000 x जी में जोड़ें। अवशिष्ट एथनॉल को खत्म करने के लिए 12,000 xg में 60 के लिए स्तंभ को अपकेंद्रित्र।
        4. एक साफ 1.5-एमएल माइक्रोसेंट्रफ़्यूज ट्यूब में स्तंभ रखें। डीएनए को नम करने के लिए, झिल्ली के केंद्र में 30 μL न्युकेलेज फ्री पानी को जोड़ने के लिए, कॉलम 1 मिनट के लिए खड़ा होना चाहिए, और 12,000 ग्राम में 60 से 60 डिग्री के लिए अपकेंद्रित्र
      5. स्पेक्ट्रोफोटोमीटर का उपयोग कर एकाग्रता को मापें; आमतौर पर, एकाग्रता 100 एनजी / μL या अधिक होनी चाहिए। जांच लें कि ए 260 / ए 280 अनुपात 1.8 है ( यानी, प्रोटीन द्वारा कोई संदूषण नहीं) और ए 260 / ए 230 अनुपात कम से कम 2.0 है ( यानी, कार्बनिक सॉल्वैंट्स द्वारा कोई संदूषण नहीं)।
    4. टी 7 आरएनए संश्लेषण किट का प्रयोग करके इन विट्रो प्रतिलेखन में
      1. टी तैयार करेंवह मास्टर मैक्स, जैसा टेबल 1 में दर्शाया गया है, और थर्मोसायक्लर में 37 डिग्री सेल्सियस पर 3 घंटे के लिए सेते हैं। न्युकेलेज-मुक्त पानी के 28 μL और डीएनस I के 2 μL जोड़ें और थर्मोसायक्लर में 37 डिग्री सेल्सियस पर और 15 मिनट के लिए सेवन करें।
    5. स्पिन स्तंभों का उपयोग करते हुए आरएनए शुद्धि
      1. 650 μL न्युकेलेज-फ्री माइक्रोएन्गेनाइजेशन बफर में दिए गए स्पिन कॉलम में निहित पाउडर को भंग करें, सभी हवाई बुलबुले को ध्यानपूर्वक हटा दें कमरे के तापमान पर 5-15 मिनट के लिए ट्यूब और हाइड्रेट कैप करें।
      2. नीचे नीली टोपी निकालें और 2-एमएल ट्यूब में कॉलम रखें। 750 मिनट और कमरे के तापमान पर 2 मिनट के लिए अपकेंद्रित्र। स्तंभ को एक ताजा 1.5-एमएल ट्यूब में रखें और स्तंभ की दीवार को छूने के बिना, केंद्र को छोड़कर 50 से 50 मिलीलीटर आरएनए समाधान को लागू करें। 2 मिनट के लिए कॉलम को 750 x जी पर स्पिन करें
      3. स्पेक्ट्रोफोटोमीटर (एक प्रतिक्रिया की सामान्य उपज 30 - 50 माइक्रोग्राम) का उपयोग कर आरएनए एकाग्रता को मापें। जांचें कि A260 / A280 अनुपात एक हैगोल 2.0 ( यानी प्रोटीन द्वारा कोई संदूषण नहीं) और ए 260 / ए 230 अनुपात कम से कम 2.0 है ( यानी, कार्बनिक सॉल्वैंट्स द्वारा कोई दूषित नहीं)। इस्तेमाल होने तक -80 डिग्री सेल्सियस पर एसजीआरएनए स्टोर करें।
      4. डीएनए वैद्युतकणसंचलन के लिए नियमित रूप से उपयोग 1% TAE जैल का उपयोग करके आरएनए की गुणवत्ता का आकलन करें। डीएनए टेम्पलेट के 200-400 एनजी और समान एसजीआरएनए को समानांतर में चलाएं। आरएनए बैंड (≈ 100 बीपी) डीएनए बैंड ( चित्रा 3 ए देखें) की तुलना में थोड़ा बड़ा होना चाहिए।

3. दाता टेम्पलेट

  1. क्रमिक रूप से उत्परिवर्तन के लिए या 50 बीपी तक छोटे अनुक्रमों के एकीकरण के लिए व्यावसायिक रूप से संश्लेषित एकल-फंसे ओलिगोन्यूक्लियोटाइड्स (एसएसओलिगोस, सामग्री की तालिका देखें) समरूपता के हथियार आम तौर पर 60-90 बीपी लंबा होते हैं
  2. बड़ा सम्मिलन के लिए, एक टेम्पलेट के रूप में दाता प्लाज्मिड का उपयोग करें एक क्लासिक क्लोनिंग विधि या डीओवो संश्लेषण का उपयोग करके एक उपयुक्त प्लाज्मिड उत्पन्न करेंवाणिज्यिक स्रोत
    नोट: कम से कम 800 बीपी प्रति अनुरूपण शाखा की सिफारिश की है। रीढ़ की हड्डी का आकार समरूपता की सीधे मरम्मत (एचडीआर) की दक्षता पर कोई प्रभाव नहीं है।

4. इंजेक्शन मिक्स

  1. जीन नॉकआउट प्रयोगों के लिए न्यूकेलीज-फ्री माइक्रोएन्गेनाइजेशन बफर का उपयोग करके सीएस 9 एमआरएनए को 50 एनजी / μ एल और एसजीआरएनए को 12.5 एनजी / μ एल (कुल में 25 एनजी / μ एल) में पतला करें। समरूपता के आधार पर जीनोम संपादन प्रयोगों के लिए 200 एनजी / μ एल की एकाग्रता में दाता टेम्पलेट (एसएसओलिगो या प्लाज्मिड) को जोड़ें।
    नोट: डीलाऊशन वॉल्यूम आसानी से ऑनलाइन टूल्स का उपयोग करके निर्धारित किया जा सकता है, जैसे रिस्पांस पेन कैलकुलेटर 18
  2. माइक्रोइन्जेक्शन सत्र के दौरान बर्फ पर प्रत्येक विभाजक को रखें और बाद में त्याग दें (इंजेक्शन मिश्रण फिर से रुकें)

5. स्कॉटल वैसेctomy

नोट: दो प्रकार के पुरुष नसबंदी आमतौर पर चूहों में की जाती हैं: पेट और चूर्ण बाद वालाकम आक्रामक है और इसे पहले 15 वर्णित किया गया है

  1. सभी स्टेनलेस स्टील सर्जिकल उपकरणों आटोक्लेव।
  2. तौलना पैमाने का उपयोग करके माउस के वजन का निर्धारण करें और इंजेक्शन (इंटैक्टेबल एनेस्थेटिक्स) के साथ इंट्राटेरिटोनियल (आईपी) इंजेक्शन (केटामाइन 100 मिलीग्राम / किग्रा, xylazine 10 mg / kg) द्वारा पुरुषों को अनैतिक बनाना।
  3. पैर की अंगुली को चुटकी पलटा के नुकसान की निगरानी करें और एक बार माउस को गरम किया जाता है तो इसे एक हीटिंग पैड के ऊपर रख दिया जाता है।
  4. चौरसाइक्साइडिन और 70% इथेनॉल जैसे एक सामयिक एंटीसेप्टिक के वैकल्पिक पोंछे के साथ टेस्ट्स के चारों ओर की त्वचा कीटाणुरहित।
  5. टेस्टोस को स्क्रोटल थैली में पुश करें और स्केलपेल के साथ एक त्वचा चीरा बनाएं।
  6. वृषण, पुच्छ एपिडाइमिस और वास डिफरेंस को कल्पना करो।
  7. वास डीफ्रेंसिंग के 3 मिमी को निकालने के लिए संदंश के साथ वास डिफरेंस पकड़ो, पकड़ो, और संदंश के प्रत्येक पक्ष पर दाग़ना करें।
  8. दूसरी वृषण पर एक ही प्रक्रिया करें
  9. घाव क्लिप के साथ त्वचा चीरों को बंद करें और मॉनिटर करेंपूर्ण वसूली से जब तक माउस ठीक से न हो।

6. सुपरव्यूलेशन (ओससाइट्स दाताओं) और समय-संभोग (छद्म-गर्भवती महिलाओं)

नोट: निषेचित ओकसाइट्स की एक उपयुक्त संख्या उत्पन्न करने के लिए तकनीक और फिर से प्रत्यारोपण के लिए पालक मादाओं को जोड़ा गया है, कहीं और 15 का वर्णन किया गया है।

  1. दिन 1 पर 12 बजे के आसपास गर्भवती घोड़ी के सीरम गोनैडोोट्रोपिन (पीएमएसजी; 100 μL में) के 5 आईयू के साथ 10 महिला आईपी इंजेक्ट करें।
  2. मानव कोरियोनिक गोनाडोट्रोपिन के 5 IU (एचसीजी; 100 μL में) 46-48 घंटे बाद (सुबह 3 बजे सुबह 11 बजे) के साथ महिला आईपी को इंजेक्ट करें।
  3. रातोंरात एकल-पुरूष पुरुषों के साथ महिलाओं को तुरंत मुहैया कराएं।

7. प्रणनात्मक (यादृच्छिक-एकीकरण) और साइटोप्लास्मेनिक (जीन-लक्ष्यीकरण) इंजेक्शन

  1. गर्भाशय ग्रीवा की अव्यवस्था से सुगंधित चूहों को हटा दें, पेट का पर्दाफाश करें, और अंडाशय और ओविडुक्ट्स का उपयोग करें, जैसा कि पहले 15 वर्णित है। ओ काटनाएक स्टिरिओमिसिकोस्कोप 15 के तहत कॉम्युलस-ओक्साइट-कॉम्प्लेक्स (सीओसी) का उपयोग करके फसल काटना पारंपरिक विधि 15 के बाद उन्हें एमिनो एसिड (केएसओएमए) के साथ पूरक पोटेशियम सिम्प्लेक्स अनुकूलन माध्यम की एक बूंद में रखें।
  2. एस्क्वाटर मुंह के टुकड़े का उपयोग करके केएसओमा माध्यम की बूंद के लिए लगभग 1 μL हायलूरोनिडास (10 मिलीग्राम / एमएल) जोड़कर ओओसाइट्स शुद्ध करें और 30 से 1 मिनट तक 37 डिग्री सेल्सियस / 5% सीओ 2 इनक्यूबेटर में डिश रखें।
  3. एस्प्रेटर मुंह टुकड़ा का उपयोग करके केएसओमा माध्यम के 4 ताजे बूंदों के साथ ओओसीइट्स को धो लें और उन्हें खनिज तेल (लगभग 2 एमएल) के साथ केएसओमा माध्यम के मध्याह्न की एक अंतिम बूंद में स्थानांतरित करें। ऑक्साईट इंजेक्शन के लिए तैयार होने तक 37 डिग्री सेल्सियस / 5% सीओ 2 इनक्यूबेटर में डिश रखें।
  4. Pronuclear इंजेक्शन (यादृच्छिक एकीकरण)
    1. त्रिविम सूक्ष्मदर्शी के तहत अंडे को विज़ुअलाइज़ करें और लगभग 50 अंडे इंजेक्शन चैम्बर (एक डॉरोएपीपीटर मुंह टुकड़ा का उपयोग करते हुए खनिज तेल के साथ मिलाकर एम 2 मध्यम के पी।
    2. इंजेक्शन चैम्बर को इन्वर्टेड माइक्रोस्कोप में ट्रांसफर और इंजेक्शन मिश्रण के कुछ picoliters के साथ निषेचित oocytes (दो दृश्यमान pronuclei) इंजेक्षन, एक pronucleus लक्ष्यीकरण (किसी भी pronuclei लक्षित किया जा सकता है)। प्रचलन के सूजन को देखकर एक सफल इंजेक्शन की कल्पना करें।
  5. Cytoplasmic इंजेक्शन (जीन लक्ष्यीकरण)।
    1. केएसओएएमए की एक बूंद के लिए लगभग 50 अंडे को स्थानांतरित करें जिसमें 5 μg / mL सिटोचालासिन बी होता है जो मुंह का टुकड़ा और 37 डिग्री सेल्सियस / 5% सीओ 2 इनक्यूबेटर में 5 मिनट तक होता है।
    2. मुंह टुकड़ा का उपयोग करके इंजेक्शन चैंबर में अंडे को स्थानांतरित करें।
    3. जहां संभव हो, स्वचालित माइक्रोइन्ग्जर के मुआवज़े दबाव का उपयोग करके, बहुत कम दबाव (50-100 एचपीए) पर कोशिका द्रव्य में इंजेक्शन मिश्रण के कुछ पिकोल्टर डालें।
    4. इंजेक्शन के बाद, oocytes को KSO की एक बूंद में वापस स्थानांतरित करेंमाँ (मुंह के टुकड़े का उपयोग करके) और उन्हें 37 डिग्री सेल्सियस / 5% सीओ 2 इनक्यूबेटर में रखें, जब तक छद्म गर्भवती मादाओं के गर्भधारण में पुन: प्रत्यारोपण नहीं किया जाता।

8. Reimplantation

  1. सभी स्टेनलेस स्टील सर्जिकल उपकरणों आटोक्लेव।
  2. वजन पैमाने का उपयोग करके माउस का वजन निर्धारित करें और इंजेक्शन (इंटैक्टेबल एनेस्थेटिक्स) के साथ इंटराइरेटिओनायल (आईपी) इंजेक्शन द्वारा महिलाओं को एनेस्थेटिज्म करें (केटामाइन 100 मिलीग्राम / किग्रा, एक्सलालिएन 10 मिलीग्राम / किग्रा)।
  3. पैर की अंगुली को चुटकी पलटा के नुकसान की निगरानी करें और एक बार माउस को गरम किया जाता है तो इसे एक हीटिंग पैड के ऊपर रख दिया जाता है।
  4. महिला माउस के पृष्ठीय midline के आसपास फर के एक बड़े क्षेत्र क्लिप।
  5. क्लोरहेक्सिडाइन और 70% इथेनॉल जैसे सामयिक एंटीसेप्टिक के वैकल्पिक पोंछे के साथ उजागर त्वचा की सूजन।
  6. पारंपरिक विधि 15 के अनुसार प्रजनन पथ का खुलासा करें पृष्ठीय midline के लिए एक 1 सेमी लंबा त्वचा चीरा समानांतर करें, मांसपेशियों को काट लें और वसा पैड वाई को पकड़ोएक संदंश, फिर धीरे से अंडाशय बाहर खींच जब तक उसके संलग्न गर्भाशय ग्रीवा और गर्भाशय स्पष्ट रूप से दिखाई दे रहे हैं।
  7. एक पोत दबाना के साथ वसा पैड को ठीक करें। त्रिविम सूक्ष्मदर्शी के तहत ओविडक्ट को विज़ुअलाइज़ करें और सूक्ष्म-कैंची की एक जोड़ी का उपयोग करके ampulluct की दीवार में एक चीरा ढककर कुछ मिलीमीटर अपुल्लम की अपस्ट्रीम बनाता है।
  8. त्रिविम सूक्ष्मदर्शी के तहत, 25 सूक्ष्मनिर्मित अंडों को मुंह टुकड़ा (केशिका का आंतरिक व्यास 120 माइक्रोग्राम चौड़ा होना चाहिए) से जुड़ा गिलास केशिका में लोड करें। ओविडड में गिलास केशिका का परिचय दें और जब तक एक हवाई बबल दिखाई नहीं देता तब तक निकालें।
  9. धीरे से कांच केशिका को हटा दें और पेट में प्रजनन पथ वापस रखें। 3-0 के गैर-अवशोषित सर्जिकल टांके के साथ चीरा सिवनी, फिर घाव क्लिप के साथ बंद करें। पूर्ण पुनर्प्राप्ति तक माउस की निगरानी करें

9. जीनोटाइपिंग रणनीतियाँ / अनुक्रमण

नोट: जीनोमिक अलग करें2-एमएम पूंछ या कान बायोप्सी से डीएनए, संबंधित पशु नैतिकता नियमों के तहत।

  1. फास्ट जीनोमिक डीएनए निकासी (यादृच्छिक एकीकरण)
    1. 100 μL क्षारीय विश्लेषण अभिकर्मक (25 मिमी सोडियम हाइड्रोक्साइड और 0.2 मिमी ईडीटीए, पीएच = 12) में 1 घंटे के लिए 95 डिग्री सेल्सियस पर ऊतक के नमूने (~ 2 मिमी) ल्यूस करें।
    2. 100 μL प्रतिरक्षित अभिकर्मक (40 मिमी त्रि-एचसीएल, पीएच = 5) में जोड़ें।
    3. 5 मिनट के लिए 12,000 ग्राम और 4 डिग्री सेल्सियस के लिए अपकेंद्रित्र
  2. उच्च गुणवत्ता वाला जीनोमिक डीएनए निष्कर्षण (जीन लक्ष्यीकरण)।
    1. 500 μL पूंछ बफर (50 मिमी ट्राइस, पीएच = 8; 100 मिमी ईडीटीए, पीएच = 8; 100 मिमी NaCl; 1% एसडीएस, और 0.5 मिलीग्राम / एमएल प्रोटीनेस के, ताजा जोड़े) में जोड़ें।
    2. 55 डिग्री सेल्सियस पर रातोंरात सेते हैं
    3. Inverting (भंवर मत) द्वारा 5 मिनट के लिए मिक्स।
    4. 250 μL संतृप्त NaCl (6 एम) जोड़ें और 5 मिनट के लिए बेदखल (भंवर न करें) के साथ मिलाएं।
    5. 5-10 मिनट के लिए 12,000 xg और 4 डिग्री सेल्सियस पर स्पिन और नई ट्यूब में सतह पर तैरनेवाला डालना। 500 μL isopropanol जोड़ें और inverting (भंवर मत) द्वारा 5 मिनट के लिए मिश्रण।
    6. 10 मिनट के लिए 12,000 xg और कमरे के तापमान पर स्पिन करें
    7. सतह पर तैरनेवाला को हटाना (गोली अदृश्य है और ट्यूब पर चिपक जाती है)
    8. 1 एमएल 70% इथेनॉल के साथ धो लें
    9. 5-10 मिनट के लिए 12,000 XG और कमरे के तापमान पर स्पिन करें सतह पर तैरने वाले को ध्यान से निकालें, क्योंकि सफेद गोली अब चिपचिपा नहीं है और खोई जा सकती है।
    10. वायु को ~ 1 घ के लिए सूखा।
    11. ते बफर के 400 μL (10 मिमी ट्रिस और 1 मिमी EDTA, पीएच = 8) जोड़ें
    12. 2 घंटे के लिए 55-60 डिग्री सेल्सियस पर डीएनए भंग करें।
  3. प्राइमर डिजाइन
    1. एक कम्प्यूटेशनल टूल 19 का उपयोग करके डिजाइन प्राइमरों में न्यूनतम 20 बीपी लंबा है
      नोट: यादृच्छिक एकीकरण के लिए, प्राइमरों को ट्रांसजीने के साथ हाइब्रिज्ड करना चाहिए, जो कि 200-800 बीपी का एक अलग टुकड़ा पैदा करेगा। जीन को लक्षित करने के लिए, प्राइमरों को डिज़ाइन करें ताकि वे जीनोमिक डीएनए के साथ संकर कर सकें, जिससे एक विशिष्ट एफ उत्पन्न होकट साइट्स के आसपास कुछ सौ बीपी लगाए। बड़े सम्मिलन के लिए, प्राइमरों ट्रांसजीन पर बैठ सकते हैं, लेकिन लक्षित एकीकरण की पुष्टि बाद में प्राइमर वॉशिंग या इसी तरह की तकनीक का उपयोग करके किया जाना चाहिए।
  4. पीसीआर जीनोटाइपिंग
    1. प्रत्येक जीनोमिक संशोधन के लिए, एक नया पीसीआर प्रोटोकॉल डिज़ाइन करें और यह अनुभवपूर्वक परीक्षण करें। प्राइमरों के प्रत्येक जोड़ी के उत्पन्न खंड और पिघलने के तापमान (टीएम) की लंबाई पर विचार करें।
  5. अनुक्रमण।
    1. जीन लक्ष्यीकरण के लिए, सेंगर अनुक्रमण सेवा प्रदाता को पीसीआर उत्पादों को भेजें।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

नीचे, यादृच्छिक एकीकरण और सीआरआईएसपीआर-मध्यस्थता वाले जीन लक्ष्यीकरण के मामले में माइक्रोइंजेक्शन के वर्कफ़्लो का वर्णन किया गया है ( चित्रा 1 )।

आकृति 1
चित्रा 1: आनुवांशिक रूप से संशोधित चूहे की पीढ़ी के लिए विशिष्ट कार्यप्रवाह। यादृच्छिक एकीकरण के लिए, शुद्ध किए गए ट्रांसजेन को फॉस्टर्ड मादाओं में प्लग किए गए ओविडक्ट ट्रांसफर से पहले निषेचित ओक्साइट्स के प्रचलन में लगाया जाता है। संप्रदाय का विश्लेषण पीसीआर द्वारा त्वरित जीनोमिक डीएनए निष्कर्षण के बाद किया जाता है। सीआरआईएसपीआर जीन को लक्षित करने के लिए, एसजीआरएनए को यहाँ वर्णित गैर-क्लोनिंग विधि का उपयोग करके संश्लेषित किया गया है, और दो गाइडों को सह-इंजेक्शन (एक साथ सीसी 9 एमआरएनए के साथ) निषेचित अयस्क्यट्स के साइटलोप्लाज़ में है। इस रणनीति का उपयोग संतान के बाद के पीसीआर-आधारित विश्लेषण के लिए किया जाता है, जिसकी आवश्यकता अत्यधिक शुद्ध ग्राएनोमिक डीएनए इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

यद्यपि ओक्साइट्स के सूक्ष्मविराम और इन इंजेक्ट अंडे के पुनर्मूल्यांकन दो मुख्य सीमित चरणों होते हैं जिनके लिए तकनीकी कौशल और प्रशिक्षण की आवश्यकता होती है, इंजेक्शन मिश्रण की गुणवत्ता आनुवंशिक रूप से संशोधित चूहों को सफलतापूर्वक उत्पन्न करने के लिए अत्यंत महत्वपूर्ण है। ट्रांजिनेन शुद्धि की गुणवत्ता ( चित्रा 2 ए ) और एसजीआरएनए संश्लेषण ( चित्रा 3 ए ) को विश्लेषणात्मक agarose जैल पर व्यवस्थित रूप से मूल्यांकन किया जाना चाहिए। स्पेक्ट्रोफोटोमीटर के साथ सांद्रता को मापने के दौरान मिश्रण की संभावित संदूषण भी जांच की जानी चाहिए, क्योंकि अवशोषण के विभिन्न मूल्य सीधे समाधान की शुद्धता पर निर्भर करते हैं (चरण 1.2.3, 2.2.3.5, और 2.2.5.3 देखें)।

चित्रा 2 बी ) और जीन लक्ष्यीकरण ( चित्रा 3 बी ) के लिए, एक माइक्रोइन्ग्जेक्शन सत्र के एक विशिष्ट पढ़ाते दिखाता है। डीएनए निष्कर्षण प्रोटोकॉल भी प्रयोगों के प्रकार के आधार पर भिन्न होते हैं; बाद में पीसीआर प्री-प्राइमरों पर भरोसा करते हैं जो क्रमशः ट्रांसजीने या जीनोमिक डीएनए पर क्रमबद्ध होते हैं। यहां प्रस्तुत रणनीतियां आनुवंशिक रूप से संशोधित चूहों के उत्पादन के लिए आवश्यक प्रत्येक चरण की आसान समस्या निवारण और व्यवस्थित करने की अनुमति देती हैं।

हालांकि माइक्रोिनगेक्शन सत्र का मात्रात्मक परिणाम प्रयोगकर्ता के अनुभव के आधार पर अलग-अलग होता है, एक बार जब प्रोटोकॉल का प्रत्येक चरण अनुकूलित होता है, तो प्राप्त ट्रांसजेनिक पिल्शों का प्रतिशत आम तौर पर यादृच्छिक इंटिज के लिए 10-25% तक पहुंच जाता हैराशन, जैसा कि चित्रा 2 बी में दिखाया गया है (15% पैदा हुए पिल्ले = 26.6% के संस्थापक)। यह कुछ "कम" दक्षता माउस जीनोम को संपादित करने के लिए CRISPR घटकों की विश्वसनीय क्षमता के साथ विरोधाभासी है। दरअसल, जीन लक्ष्यीकरण के लिए सीआरआईएसपीआर का इस्तेमाल करते हुए और 25-100% से लेकर ( आकृति 3 बी देखें; 13 पिल्ले = 23% में से 3 संस्थापक ) देखें तो उत्पन्न संस्थापकों की संख्या आम तौर पर अधिक है। सीआरआईएसपीआर का इस्तेमाल करते हुए पूरी तरह से समरूप जनजाति प्राप्त करने के लिए असाधारण नहीं है।

चित्र 2
चित्रा 2: ओव्हरक्प्रेसशन के लिए ट्रांसजेनिक चूहे के सफल उत्पादन के लिए गुणवत्ता नियंत्रण और जीनोटाइपिंग रणनीति। ( ) प्लाज्मिड को 1 वी के लिए प्वूआई और नोटिअस के साथ पच जाता है पूर्ण पाचन और सही आकार ( यानी, ट्रांसजीने = 7,338 बीपी, बैकबोन = 1,440+ 896 बीपी) एक विश्लेषणात्मक जेल (1) पर जांच की जाती है। प्रारंभिक जेल (2) से कई पाचन उत्पादों की निकासी ट्रांसजेन की बढ़ती एकाग्रता उत्पन्न करती है। यूवी के लिए लंबे समय तक संपर्क से बचा जाना चाहिए, और यूवी ट्रांसिलमिनेटर के बदले एक नीली रोशनी का उपयोग करने की सिफारिश की जाती है। (बी) जीनोटाइपिंग रणनीति (1): प्राइमरों को ट्रांसजीने पर बैठाना चाहिए और इसे 200 से 800 बीपी के टुकड़े उत्पन्न करने के लिए डिज़ाइन किया जाना चाहिए। जब जीनोटाइपिंग किया जाता है (2), तो यह एक सकारात्मक नियंत्रण ( यानी, माइक्रो इंजेक्शन के लिए इस्तेमाल इंजेक्शन मिश्रण) और एक नकारात्मक नियंत्रण ( यानी, डब्ल्यूटी माउस से जीनोमिक डीएनए) को शामिल करने की सिफारिश की जाती है। इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

चित्र तीन
चित्रा 3: गुणवत्ता नियंत्रण और जीनोटाइपिंग स्ट्रॉजीन-लक्षित (केओ) चूहे के सफल उत्पादन के लिए टीजी ( ) इन विट्रो प्रतिलेखन द्वारा निर्मित एसजीआरएनए की गुणवत्ता को प्रत्येक गाइड के लिए डीएनए टेम्पलेट और समान आरएनए चलाकर मूल्यांकन किया जाता है। डीएनए की तुलना में आरएनए का आकार थोड़ा बड़ा है। गुणवत्ता को संतोषजनक होना चाहिए ( यानी, कोई धब्बा बैंड नहीं) सांद्रता मापा जाता है ( बी ) (1) एक्ज़ोन 1 में प्रारंभ कोडन को शामिल करने वाले दो गाइड (विपरीत दिशाओं) का डिजाइन। प्राइमरों को दो गाइडों द्वारा अंततः क्षेत्र के बाहर जीनोमिक डीएनए के साथ संकरित करने के लिए चुना जाता है। आमतौर पर, यह रणनीति पीसीआर (2) का उपयोग करने वाले हेरेरोजीजस (# 5 और 9) और होमोजीगस (# 3) केए संस्थापकों की प्रत्यक्ष पहचान की अनुमति देती है। होम्योजीज जानवरों के पीसीआर उत्पाद किसी भी डब्ल्यूटी बैंड को प्रदर्शित नहीं करते हैं इस आंकड़े के एक बड़े संस्करण को देखने के लिए कृपया यहां क्लिक करें

प्रतिक्रिया अवयव आयतन ध्यान दें रैखिक डीएनए टेम्पलेट के संश्लेषण
(2.5) Nuclease मुक्त पानी 97.2 μL 5x एचएफ बफर 36 μL MgCl2 9 μL 10 मिमी डीएनटीपी 9 μL 10 माइक्रोन एफवेडी प्राइमर 9 μL 5'टीटाएटैगैक्टसीएक्टैटेगन 20
gttttagagctagaaatagcaagttaaaata
एग्रीगेटैक 3 ' 10 सुक्ष्ममापी रीम प्राइमर 9 μL 5 'एएएएजीसीएसीएसीजीसीटीसीजीजीटीजीसीसी 3' पीआरओफ़-वाचन पोलीमरेज़ 1.8 μL एक टी 7 आरएनए संश्लेषण किट का प्रयोग करके आईवीटी
(2.6) Nuclease मुक्त पानी एक्स μL अधिकतम 20 μL तक मात्रा बनाएं एनटीपी बफर मिश्रण 10 μL टेम्पलेट डीएनए ≈ 300 एनजी टी 7 आरएनए पोलीमरेज़ 2 μL

तालिका 1: इस अध्ययन में प्रयुक्त विभिन्न मास्टर मिक्स की संरचना। रैखिक डीएनए टेम्पलेट के संश्लेषण: टी 7 प्रमोटर न्यूनतम अनुक्रम (टीटीएटीएसीएजीएटीसीएकाटाटाएग) 20 बीपी अनुक्रम (गाइड, एन 20 को सीआरआईएसपीआर डिज़ाइन टूल का उपयोग करके पहचाना गया है) की अभिव्यक्ति है और अभिव्यक्ति वेक्टर (जीटीटीग्गग्टागैटागकागेटाइएटैगैगटागटसी) के अनुक्रम के पूरक हैं। कृत्रिम परिवेशीयप्रतिलेखन (आईवीटी): डीएनए टेम्पलेट की एकाग्रता पर निर्भर करते हुए, अंतिम मात्रा में न्युकले-मुक्त पानी के साथ 20 μL को समायोजित किया जाना चाहिए।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

प्रोटोकॉल के भीतर महत्वपूर्ण कदम

आनुवांशिक रूप से संशोधित चूहों की पीढ़ी तकनीकी रूप से चुनौतीपूर्ण है हालांकि, यहां प्रस्तुत प्रोटोकॉल एक अनुकूलित और सरलीकृत विधि है जो एक को मास्टर करने और रिकॉर्ड समय में तकनीक का निवारण करने की अनुमति देता है। तकनीक के सफल समापन के लिए दो चरण आवश्यक हैं। सबसे पहले, रैखिक डीएनए टेम्पलेट्स के संश्लेषण (एसजीआरएनए के संश्लेषण के लिए) मैग्नीशियम क्लोराइड (एमजीसीएल 2 ) के बिना हासिल किया जा सकता है। हालांकि, एमजीसीएल 2 को मास्टर मैनेजमेंट में व्यवस्थित रूप से जोड़ने के लिए अत्यधिक सिफारिश की जाती है क्योंकि अग्रिम प्राइमर के आंशिक संकरण अक्सर एमजीसीएल 2 के अभाव में रोका जाता है। इसके अलावा, लक्षित जीनोमिक अनुक्रम के लिए महत्वपूर्ण है जो दाता टेम्पलेट के किसी भी हिस्से में मौजूद नहीं है (लक्षित एकीकरण के मामले में), अन्यथा कैस 9 एन्यूकेलीज इसे काट देगा, एचडीआर की घटना को रोकना होगा।

संशोधनऔर समस्या निवारण

यद्यपि आनुवंशिक रूप से संशोधित चूहों को पैदा करने के लिए इस प्रोटोकॉल का अनुकूलन और वर्षों से सुव्यवस्थित किया गया है, हालांकि माइक्रोइन्जेन्सी के लिए अच्छी गुणवत्ता वाली अयस्क्यइट्स और फोस्टर मादाओं की प्लगिंग दर से संबंधित कुछ विचार हैं। एक माइक्रोिनगेक्शन सत्र के परिणामस्वरूप लाइव पिल्श की संख्या के संबंध में पृष्ठभूमि तनाव का विकल्प महत्वपूर्ण है। C57BL / 6 रोगों के माउस मॉडल के लिए सबसे अधिक इस्तेमाल किया पृष्ठभूमि है। हालांकि, माइक्रोिनैक्शन 20 के प्रतिरोध के मामले में यह कम कुशल पृष्ठभूमि में से एक है। इसके अलावा, महिला की आयु भी बड़ी संख्या में oocytes पैदा करने के लिए महत्वपूर्ण है; यह 5-8 सप्ताह की उम्र से बचने के लिए सिफारिश की जाती है चाहे पृष्ठभूमि की परवाह किए बिना, क्योंकि यह हार्मोनल उत्तेजना 21 की प्रतिक्रिया का कम अनुकूल समय है। हमारे अनुभव में, 3 से 4 सप्ताह के पुराने C57BL / 6 चूहों को मज़बूती से प्रति महिला 20-30 अंडें अर्जित करते हैं। के लिए महत्वपूर्ण हैध्यान दें कि एक नई तकनीक (अल्ट्रा सुपरव्यूलेशन के रूप में संदर्भित) ने प्रति महिला 100 अंडे तक का उत्पादन किया है और हाल ही में माइक्रोइन्जेक्शन 22 के लिए oocytes उत्पन्न करने के लिए उपयोग किया गया है। हालांकि, सूक्ष्मविराम के लिए अल्ट्रा सुपरव्यूलेशन का उपयोग आम तौर पर कृत्रिम रूप से निषेचन ( इन विट्रो निषेचन में) जैसे बड़ी संख्या में अंडे की आवश्यकता से प्रभावित होता है

पुर्नोत्थान के लिए उपयुक्त पालक मादाओं को प्राप्त करने के लिए, मादा चूहों vasectomized पुरुषों (इन चूहों की पृष्ठभूमि महत्वपूर्ण नहीं है) के साथ मेल खाए हैं। प्लग किए गए प्राप्तकर्ताओं की संख्या में वृद्धि करने के लिए, एस्ट्रोजन के स्तर की सावधानीपूर्वक जांच और उपयुक्त महिलाओं का चयन 23 किया जा सकता है। महिलाओं के चक्रों के सिंक्रनाइज़ेशन को भी संभोग (दोबारा "व्हाइटन इफेक्ट") के 24 दिनों के पहले पुरुष के सामने वसीक्तोमाकृत पुरुषों को उजागर करके प्रेरित किया जा सकता है।

तकनीक की सीमाएं

बहुत ही छोटे जीनोमिक संशोधनों, जैसे कि बिंदु के उत्परिवर्तन, उत्पन्न करने के लिए अपेक्षाकृत आसान हैं, लेकिन उन्हें पहचानना मुश्किल है। जब जीनोटाइपिंग किया जाता है, पीसीआर उत्पादों को सीधे सेंगर अनुक्रमण से क्रमबद्ध किया जाता है। हालांकि, माउस ऑकाइट में सीआरआईएसपी घटक के सीधा माइक्रोिनगेक्शन अक्सर मोज़ेक जानवरों को उत्पन्न करता है क्योंकि कैस 9 कुछ समय के लिए सक्रिय रहता है और oocyte के पहले डिवीजन के बाद अलग जीनोमिक संशोधन हो सकते हैं। यह भ्रष्ट प्रभाव विभिन्न alleles के बीच असतत उत्परिवर्तन की पहचान को जटिल बनाता है, और अगली पीढ़ी के अनुक्रमण (एनजीएस) चुनौतीपूर्ण readouts के साथ मदद कर सकता है। संवेदनशील तकनीक, जैसे कि टेट्रा-प्राइमरएआरएमएस-पीसीआर, 25 भी क्रमशः द्वारा संस्थापकों की पहचान के बाद कॉलोनी को जीनोटाइप करने में मदद कर सकता है।

इसके विपरीत, एक लक्षित फ़ैशन में डीएनए के बड़े टुकड़े डालने में चुनौतीपूर्ण है। एक्सोजेनियस डीएनए बड़ा, एचडीआर की दक्षता कम। नतीजतन, नई रणनीतियां, जैसे लंबे समय तक एसएसओलिगो दाताओं (प्लास्मिड के बदले) या एचडीआर-स्वतंत्र लक्षित एकीकरण 27 , का उपयोग वर्तमान में विकसित किया जा रहा है।

प्रोटोकॉल का महत्व

यह प्रोटोकॉल महत्वपूर्ण प्रगति प्रस्तुत करता है क्योंकि चार मुख्य कदम ( यानी, ट्रांसजीने या सीआरआईएसपी घटक, माइक्रोइन्ग्नाइजेशन, रीइम्प्लांटेशन और जीनोटाइपिंग की तैयारी) हमारी प्रयोगशाला में अनुकूलित, परीक्षण और मान्य है।

दो मुख्य कारणों के लिए ओवरेक्सेशन अध्ययन के लिए ट्रांसजेन का यादृच्छिक एकीकरण व्यापक रूप से उपयोग किया जाता है। सबसे पहले, एवो के लिए"सुरक्षित हार्बर" लोकी में सीआरआईएसपीआर का इस्तेमाल करते हुए ट्रांसजीने का संभावित "स्थिति प्रभाव" आईडी, जैसे रोसा 26 28 और कोल 129 लोकी, बेहद चुनौतीपूर्ण रहे, क्योंकि एचडीआर की दक्षता कम है। इस समस्या पर काबू पाने के लिए रणनीतियां आगामी 26 , 27 हैं , लेकिन यादृच्छिक एकीकरण अब तक और अधिक कुशल साबित हो चुका है। इसके अलावा, कई ट्रांसजेनिक लाइनों की पीढ़ी अभिव्यक्ति के विभिन्न स्तरों के साथ एक ही ट्रांसजीने को अतिरंजित करती है, जो एक फेनोटाइप 30 को उल्टा करने के लिए उपचार रणनीतियों से जुड़े अध्ययनों में रुचि है। ब्लेड के प्रोटीन की अभिव्यक्ति के लिए आवश्यक टुकड़ों को इकट्ठा करने के लिए तदर्थ अवरोध एंजाइम का उपयोग करते हुए, क्लोनिंग के माध्यम से प्लाज्मिड-आधारित ट्रांसजेनेस उत्पन्न होते हैं। आम तौर पर, एक ट्रांसजीन कम से कम तीन तत्वों से बना होता है: एक उपयुक्त प्रमोटर (अतिरिक्त क्षेत्रों को कभी-कभी जोड़ा जाता है); कोडिंगअनुक्रम (सीडीएनए), अंतर्निहित क्षेत्रों के साथ या बिना; और एमएलएनए अभिव्यक्ति 31 को स्थिर करने के लिए पॉलीए पूंछ

एक बार इकट्ठा होने पर ट्रांसजेन को एक प्लाज्मिड युक्त बैक्टीरियल प्रतिकृति तत्वों में डाला जाता है और रूपांतरण के बाद संस्कृति में विस्तारित किया जाता है (आमतौर पर गर्मी-झटका आधारित)। माइक्रोइन्जेन्सी के लिए ट्रांसजेनेस की शुद्धि पद्धति महत्वपूर्ण है। यह काम जेल पर ब्याज के टुकड़े (पारंपरिक क्रिस्टल बैंगनी की तुलना में) और कम म्यूटेजेनिक जोखिम (एथिडियम ब्रोमाइड की तुलना में) के अधिक सटीक दृश्य के लिए नई-पीढ़ी (कम-विषाक्तता) डीएनए दागों के उपयोग का वर्णन करता है।

जीन लक्ष्यीकरण के लिए वर्णित गैर क्लोनिंग विधि बहुत तेज है और कई एसजीआरएनए के संश्लेषण के लिए केवल 5-6 घंटे में अनुमति देता है। केवल चार चरणों की आवश्यकता है: लक्षित अनुक्रम की पहचान, एक रेखीय डीएनए टेम्प्लेट के संश्लेषण जिसमें एक T7 प्रमोटर और चयनित लक्ष्य अनुक्रम होता है, संश्लेषणच इनग्रो प्रतिलेखन (आईवीटी) में एसजीआरएनए, और स्पिन कॉलम का उपयोग करते हुए एसजीआरएनए की शुद्धि।

सीआरआईएसपीआर माउस जीनोम संपादन की शुरुआती उम्र में, संभावित ऑफ-टैब्स प्रभाव का व्यवस्थित रूप से मूल्यांकन किया गया था, हालांकि इसे माउस भ्रूण 32 में बहुत सीमित दिखाया गया है और इसे आसानी से एक प्रजनन योजना के माध्यम से पतला किया जा सकता है जिसमें चयनित चूहों में केवल वांछित जीनोमिक संशोधन इन-लक्ष्य गतिविधि को भी इन विट्रो में पूर्व-मूल्यांकन किया गया था, विभिन्न मार्गदर्शकों का उपयोग करके और अधिक सक्रिय ( 12 ) का चयन करना कई कारणों से यह अभ्यास अब कम आम है। सबसे पहले, पर-लक्ष्य गतिविधि को सीआरएसपीआर-एन्कोडिंग प्लास्मिड के साथ अमर सेल सेल लाइनों (आमतौर पर एन 2 ए या एनआईएच 3 टी 3) के अभिकर्मक का उपयोग करके मूल्यांकन किया जाता है। यह सीआरएसआरआर आरएनए घटकों के माउस ओक्साइट्स में इंजेक्शन की तुलना में एक अलग तरीका है। इसलिए, इन विट्रो में पाए गए परिणाम हमेशा समान रूप से अनुवाद नहीं करते हैंOocytes के लिए इसके अलावा, उच्च-थ्रूपुट प्रयोगों से पता चला है कि अधिकांश मार्गदर्शक 33 सक्रिय हैं। नतीजतन, पर-लक्ष्य गतिविधि का आकलन नहीं किया जाता है, और इस प्रकार अब तक, कोई गाइड का कोई सबूत नहीं है जो माउस ओक्साइट्स में कोई गतिविधि प्रदर्शित नहीं करता है। यहां प्रस्तुत, एसजीआरएनए को संश्लेषित करने के लिए गैर क्लोनिंग विधि के साथ, यह वर्कफ़्लो को सरल और सरल बनाता है, और कई सक्रिय मार्गदर्शिकाएं एक दिन में मूल रूप से संश्लेषित हो सकती हैं।

सीआरआईएसपीआर को एक "विघटनकारी तकनीक" माना जाता है, जो कि एक नवीनता है जो तकनीक की पद्धति को बदलती है। जब माइक्रोइन्जेन्ग्ज की स्थापना हुई थी, ब्रिनस्टर एट अल दिखाया गया कि सीओप्लास्मेक ट्रांसजेनेस, हालांकि प्राप्त करने योग्य है, ज्यादातर अक्षम 7 बने रहे। नतीजतन, चूहों में लक्षित एक सफल क्रिस्पक जीन के पहले प्रदर्शन तक, लगभग 30 वर्षों तक, केवल एक ही आम प्रिक्र्या में अणुविभिन्न microinjection बने रहे। इस अध्ययन से पता चला है कि cytoplasmic microinject आयन ने एक्सक्ल्यूक डिलीवरी 12 की तुलना में समान या बेहतर परिणाम उत्पन्न कर सकता है। जाहिर है, क्योंकि सीआरआईएसपी घटक आम तौर पर आरएनए से बने होते हैं, यह स्पष्ट है कि साइटलोप्लाज्म को लक्षित किया गया है। हालांकि, जब भी साइटोप्लाज्म में इंजेक्ट किया जाता है, दाता टेम्पलेट एचडीआर को सफलतापूर्वक प्रेरित कर सकता है। टेम्पलेट्स के एक उच्च साइटोप्लाजिकिक एकाग्रता ने न्यूक्लियस में अपने प्रसार को सक्षम किया है। इसके अलावा, पाइज़ो-संचालित साइोपैस्स्मिक मायक्रोइन्जेक्शन 16 का उपयोग एक आवश्यकता नहीं है। साइटोस्केलेटन अवरोधक, जैसे सिटोचालासिन बी के साथ oocytes के एक छोटे से ऊष्मायन, ozoites 34 , 35 के अस्तित्व को बढ़ाता है, जिससे पाइज़ो प्रभाव ड्राइव सिस्टम के बिना cytoplasmic इंजेक्शन का प्रदर्शन करने के लिए पर्याप्त हो जाता है। इसी तरह, एक बेहतर संस्कृति माध्यम का उपयोग, जैसे कि सोमा, दो-स्तरीय चरण में अवरोध को कम करता है और एम 16 माध्यम की तुलना में भ्रूण की विकास क्षमता में सुधार करता हैXref "> 36

एक-सेल या दो-कोशिका (जब रातोंरात खेती की जाती है) भ्रूण को ओविडक्ट में स्थानांतरित किया जा सकता है। परंपरागत प्रक्रिया काफी आक्रामक है, क्योंकि इसके लिए बर्सा को फाड़ना पड़ता है जो अंडाशय की रक्षा करता है। यह तकनीकी रूप से भी चुनौतीपूर्ण है, क्योंकि गिल्ट केशिका को infundibulum 15 में डालने की जरूरत है यहां प्रस्तुत विधि जानने के लिए बहुत आसान है, संभावित खून बह रहा है, और अंडाशय की अखंडता को संरक्षित नहीं करता है। यह कुमामोटो विश्वविद्यालय 37 में विकसित कार्य पर आधारित है।

जीनोटाइपिंग रणनीतियों और अनुक्रमण तकनीक महत्वपूर्ण संस्थापकों की पहचान करने के लिए महत्वपूर्ण हैं यादृच्छिक एकीकरण के लिए, जीनोमिक डीएनए की निकासी एक सरल विधि के आधार पर होती है जिसे ट्रॉयट एट अल 38 इस तरह की त्वरित निकासी विधि संभावित संस्थापकों की पहचान करने के लिए पर्याप्त है, क्योंकि प्राइमरों को ट्रांसजीने (अक्सर एकीकृतकई प्रतियों के रूप में) इसके विपरीत, जीन लक्ष्यीकरण को अत्यधिक शुद्ध जीनोमिक डीएनए की आवश्यकता है, क्योंकि पीसीआर उत्पाद संशोधित जीनोमिक क्षेत्र को शामिल करता है।

जीन नॉकआउट के लिए, एक एकल एसजीआरएनए इंजेक्शन की पारंपरिक विधि छोटे विलोपन (इंडल्स) या सम्मिलन उत्पन्न करती है, अंत में ब्याज की जीन को बाहर खिसकाने 12 । इन छोटे संशोधनों को पहचानना मुश्किल है और अक्सर इन म्यूटेशनों की प्रकृति की पुष्टि करने के लिए समय लेने वाली, लेगेज-स्वतंत्र क्लोनिंग और अनुक्रमण की आवश्यकता होती है।

इस प्रोटोकॉल में, हम दो एसजीआरएनए के व्यवस्थित सह-इंजेक्शन विकसित करने के लिए सीआरआईएसपीआर मल्टीप्लेक्सिंग का फायदा उठाते हुए ब्याज की एक जीन के प्रारंभ कोडो को शामिल करते थे। यह न केवल जीन नॉकआउट की समानता को बढ़ाता है, बल्कि एक पूर्वनिर्धारित आकार (100-300 बीपी) के जीनोमिक डीएनए का एक टुकड़ा भी देता है, जो सरल पीसीआर द्वारा संस्थापकों की आसान पहचान की अनुमति देता है। नोट, पिल्ले जो उम्मीद जीनोमिक ई नहीं लेते हैंजब भी एक एसजीआरएनए सक्रिय साबित हो गया, तब भी एक्स फ़िस्सीफ्ट म्यूटेशन के लिए एक्सिस का विश्लेषण किया जा सकता था। इसी तरह, जीन संपादन के मामले में, विपरीत दिशा में दो ओवरलैपिंग एसजीआरएनए का व्यवस्थित सह-इंजेक्शन एचडीआर की दक्षता में वृद्धि करना चाहिए, क्योंकि सेल की मरम्मत के तंत्रों को प्राथमिकता से दो किस्में 39 में से एक का उपयोग करना चाहिए।

भविष्य के अनुप्रयोग

वर्तमान प्रोटोकॉल ने माउस भ्रूणविज्ञान और जीन में नवीनतम घटनाओं का लाभ उठाया है ताकि मानव परिस्थितियों के विभिन्न परिष्कृत माउस मॉडलों को बनाने की प्रक्रिया को सरल और सरल बनाने के लिए 40 को लक्षित किया जा सके। इन मॉडलों में पथ्यक्रियाओं की हमारी समझ को विकसित करने में मदद करने में एक महत्वपूर्ण भूमिका निभाई जाती है, अंततः चिकित्सीय रणनीतियों के विकास में सहायता करना 2 । जीन लक्ष्यीकरण या यादृच्छिक एकीकरण के लिए आवश्यक अभिकर्मकों के अनुकूलन और सुव्यवस्थित व्यापक रूप से और आसानी से लागू होते हैंचूहों, खरगोशों, और यहां तक ​​कि बड़े जानवरों जैसे मवेशी जैसे अन्य स्तनधारी प्रजातियों के लिए।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखक न्यू साउथ वेल्स के मार्क वेनराइट एनालिटिकल सेंटर के माध्यम से चूहों में अकादमिक ट्रांसजेनेसिस सेवाएं प्रदान करते हैं

Acknowledgments

लेखक अपने चल रहे समर्थन के लिए पशु सुविधा (बीआरसी) के स्टाफ का धन्यवाद करते हैं। यह काम राष्ट्रीय स्वास्थ्य और चिकित्सा अनुसंधान परिषद और ऑस्ट्रेलियाई अनुसंधान परिषद द्वारा वित्त पोषित किया गया था।

Materials

Name Company Catalog Number Comments
Micropipette 0.1-2.5 μL Eppendorf 4920000016
Micropipette 2 - 20 μL Eppendorf 4920000040
Micropipette 20 - 200 μL Eppendorf 4920000067
Micropipette 100 - 1,000 μL Eppendorf 4920000083
Molecular weight marker  Bioline BIO-33025 HyperLadder 1 kb
Molecular weight marker  Bioline BIO-33056 HyperLadder 100 bp
Agarose Bioline BIO-41025
EDTA buffer Sigma-Aldrich 93296 10x - Dilute to 1x
Ethidium bromide Thermo Fisher Scientific 15585011
SYBR Safe gel stain Invitrogen S33102
Gel extraction kit Qiagen 28706
PCR purification kit (Qiaquick) Qiagen 28106
Vacuum system (Manifold) Promega A7231
Nuclease-free microinjection buffer  Millipore MR-095-10F
Ultrafree-MC microcentrifuge filter  Millipore UFC30GV00
Cas9 mRNA Sigma-Aldrich CAS9MRNA
CRISPR expressing plasmid (px330) Addgene 42230
Nuclease free water Sigma-Aldrich W4502
Phusion polymerase New England Biolabs M0530L
T7 Quick High Yield RNA kit New England Biolabs E2050S
RNA purification spin columns (NucAway) Thermo Fisher Scientific AM10070
ssOligos Sigma-Aldrich OLIGO STANDARD
Donor plasmid Thermo Fisher Scientific GeneArt
Hyaluronidase Sigma-Aldrich H3884
KSOMaa embryo culture medium Zenith Biotech  ZEKS-100
Mineral oil Zenith Biotech  ZSCO-100
M2 Medium Sigma-Aldrich M7167
Cytochalasin B Sigma-Aldrich C6762
Mouthpiece Sigma-Aldrich A5177
Glass microcapillaries Sutter Instrument BF100-78-10
Proteinase K Applichem A3830.0100
Dumont #5 forceps Fine Science Tools  91150-20
Iris scissors Fine Science Tools  91460-11
Vessel clamp Fine Science Tools  18374-43
Wound clips  Fine Science Tools  12040-01
Clips applier  Fine Science Tools  12018-12
Micro-scissors  Fine Science Tools  15000-03
Cauterizer Fine Science Tools  18000-00
Non-absorbable surgical sutures (Ethilon 3-0) Ethicon 1691H
5% CO2 incubator MG Scientific Galaxy 14S
Spectrophotometer Thermo Fisher Scientific Nanodrop 2000c
Thermocycler Eppendorf 6321 000.515
Electrophoresis set up BioRad 1640300
UV Transilluminator BioRad 1708110EDU
Thermocycler Eppendorf 6334000069
Stereoscopic microscope Olympus SZX7
Inverted microscope Olympus IX71
2x Micromanipulators Eppendorf 5188000.012
Oocytes manipulator Eppendorf 5176000.025
Microinjector (Femtojet) Eppendorf 5247000.013
Mice C57BL/6J strain Australian BioResources C57BL/6JAusb 

DOWNLOAD MATERIALS LIST

References

  1. Ittner, L. M. Dendritic function of tau mediates amyloid-beta toxicity in Alzheimer's disease mouse models. Cell. 142, (3), 387-397 (2010).
  2. Ittner, A. Site-specific phosphorylation of tau inhibits amyloid-beta toxicity in Alzheimer's mice. Science. 354, (6314), 904-908 (2016).
  3. Marantz Henig, R. The Monk in the Garden. Mariner books. (2000).
  4. Jaenisch, R., Mintz, B. Simian virus 40 DNA sequences in DNA of healthy adult mice derived from preimplantation blastocysts injected with viral DNA. Proc Natl Acad Sci U S A. 71, (4), 1250-1254 (1974).
  5. Gordon, J. W., Ruddle, F. H. Integration and stable germ line transmission of genes injected into mouse pronuclei. Science. 214, (4526), 1244-1246 (1981).
  6. Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A., Ruddle, F. H. Genetic transformation of mouse embryos by microinjection of purified DNA. Proc Natl Acad Sci U S A. 77, (12), 7380-7384 (1980).
  7. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Yagle, M. K., Palmiter, R. D. Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc Natl Acad Sci U S A. 82, (13), 4438-4442 (1985).
  8. Capecchi, M. R. Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century. Nat Rev Genet. 6, (6), 507-512 (2005).
  9. Carbery, I. D. Targeted genome modification in mice using zinc-finger nucleases. Genetics. 186, (2), 451-459 (2010).
  10. Sung, Y. H. Knockout mice created by TALEN-mediated gene targeting. Nat Biotechnol. 31, (1), 23-24 (2013).
  11. Jinek, M. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  12. Wang, H. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  13. Kang, X. Introducing precise genetic modifications into human 3PN embryos by CRISPR/Cas-mediated genome editing. J Assist Reprod Genet. 33, (5), 581-588 (2016).
  14. Liang, P. CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes. Protein Cell. 6, (5), 363-372 (2015).
  15. Ittner, L. M., Götz, J. Pronuclear injection for the production of transgenic mice. Nat Protoc. 2, (5), 1206-1215 (2007).
  16. Yang, H., Wang, H., Jaenisch, R. Generating genetically modified mice using CRISPR/Cas-mediated genome engineering. Nat Protoc. 9, (8), 1956-1968 (2014).
  17. CRISPR DESIGN. Available from: http://crispr.mit.edu (2017).
  18. Integrated DNA Technologies. Resuspension Calculator. Available from: https://sg.idtdna.com/calc/resuspension/ (2017).
  19. BioTools at UMass Medical School. Primer3: WWW primer tool. Available from: http://biotools.umassmed.edu/bioapps/primer3_www.cgi (2017).
  20. Auerbach, A. B. Strain-dependent differences in the efficiency of transgenic mouse production. Transgenic Res. 12, (1), 59-69 (2003).
  21. Merriman, J. A., Jennings, P. C., McLaughlin, E. A., Jones, K. T. Effect of aging on superovulation efficiency, aneuploidy rates, and sister chromatid cohesion in mice aged up to 15 months. Biol Reprod. 86, (2), 49 (2012).
  22. Nakagawa, Y., et al. Ultra-superovulation for the CRISPR-Cas9-mediated production of gene-knockout, single-amino-acid-substituted, and floxed mice. Biol Open. 5, (8), 1142-1148 (2016).
  23. Byers, S. L., Wiles, M. V., Dunn, S. L., Taft, R. A. Mouse estrous cycle identification tool and images. PLoS One. 7, (4), e35538 (2012).
  24. Whitten, W. K. Modification of the oestrous cycle of the mouse by external stimuli associated with the male. J Endocrinol. 13, (4), 399-404 (1956).
  25. Ye, S., Dhillon, S., Ke, X., Collins, A. R., Day, I. N. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 29, (17), E88 (2001).
  26. Yoshimi, K., et al. ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat Commun. 7, 10431 (2016).
  27. Suzuki, K., et al. In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. (2016).
  28. Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 21, 70-71 (1999).
  29. Liu, X., et al. A targeted mutation at the known collagenase cleavage site in mouse type I collagen impairs tissue remodeling. J Cell Biol. 130, (1), 227-237 (1995).
  30. Ke, Y. D. Short-term suppression of A315T mutant human TDP-43 expression improves functional deficits in a novel inducible transgenic mouse model of FTLD-TDP and ALS. Acta Neuropathol. 130, (5), 661-678 (2015).
  31. Auerbach, A. B. Production of functional transgenic mice by DNA pronuclear microinjection. Acta Biochim Pol. 51, (1), 9-31 (2004).
  32. Iyer, V., et al. Off-target mutations are rare in Cas9-modified mice. Nat Methods. 12, (6), 479 (2015).
  33. Zhou, Y. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 509, (7501), 487-491 (2014).
  34. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Avarbock, M. R. Translation of globin messenger RNA by the mouse ovum. Nature. 283, (5746), 499-501 (1980).
  35. Pinkert, C. A., Irwin, M. H., Johnson, L. W., Moffatt, R. J. Mitochondria transfer into mouse ova by microinjection. Transgenic Res. 6, (6), 379-383 (1997).
  36. Biggers, J. D., Summers, M. C. Choosing a culture medium: making informed choices. Fertil Steril. 90, (3), 473-483 (2008).
  37. Nakagata, N. Embryo transfer through the wall of the fallopian tube in mice. Jikken Dobutsu. 41, (3), 387-388 (1992).
  38. Truett, G. E. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  39. Richardson, C. D., Ray, G., DeWitt, M. A., Curie, G. L., Corn, J. E. Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 34, (3), 339-344 (2016).
  40. Delerue, F., Ittner, L. M. Genome Editing in Mice Using CRISPR/Cas9: Achievements and Prospects. Clon. Transgen. 4, (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics