Bir CRISPR-konkantör kullanarak Fare Küçük Bağırsak Organoidleri Üzerinde Birden Fazla Gen Kıyamet Protokolü

Bioengineering
 

ERRATUM NOTICE

Summary

Bu protokol, CRISPR / Cas9 teknolojisini kullanarak çoklu gen nakavtları yaratmada özel olarak kullanılan bir kılavuz RNA konformemer vektörüne birden fazla tekli kılavuz RNA'yı klonlamak için gereken aşamaları açıklar. Bağırsak organoitlerinde çift nakavt üretimi bu yöntemin olası bir uygulaması olarak gösterilmiştir.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Merenda, A., Andersson-Rolf, A., Mustata, R. C., Li, T., Kim, H., Koo, B. K. A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. J. Vis. Exp. (125), e55916, doi:10.3791/55916 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

CRISPR / Cas9 teknolojisi, gen fonksiyonunu anlamada gerekli olan fonksiyon kaybı çalışmalarının fizibilitesini ve hızını büyük ölçüde geliştirmiştir. Yüksek ökaryotlarda, paralog genler, bir genin kaybını telafi ederek potansiyel bir fenotipi maskeleyebilir ve böylece, tek gen nakavtına dayanan genetik araştırmalardan elde edilebilecek bilgileri sınırlayabilir. Fare küçük bağırsak organoitlerinde tek bir transfeksiyon sonrasında çoklu gen nakavtları yaratmak için kılavuz RNA (gRNA) konsatemeri için yeni ve hızlı bir klonlama yöntemi geliştirdik. Stratejimiz, tavlanmış gRNA oligoları ve önceden tasarlanmış bir retroviral vektör ile tek bir Golden Gate karıştırma reaksiyonu gerçekleştirerek, dört tekil gRNA'yı tek bir vektöre konsatemerleştirebilmenizi sağlar. Bu, dört farklı genin aynı anda nakavmesine ya da bir genin birden fazla gRNA tarafından hedeflenmesini takiben arttırılmış nakavt etkinliğine izin verir. Bu protokolde, ayrıntılı olarak gösteriyoruzÇok sayıda gRNA'yı retroviral CRISPR-konkanteemer vektörüne verimli bir şekilde nasıl klonlayabilir ve bağırsak organoidlerinde yüksek verimli elektroporasyon nasıl elde edilir. Örnek olarak, Wnt sinyal yolağının (Axin1 / 2 ve Rnf43 / Znrf3) negatif regülatörlerini kodlayan iki çift genin aynı anda nakavt edilmesinin bağırsak organoidlerini temel büyüme faktörlerinin geri çekilmesine karşı dirençli hale getirdiğini gösteriyoruz.

Introduction

Ters genetik yaklaşım, bir genin işlevini araştırmak için yaygın olarak kullanılan bir yöntemdir. Özellikle, bir genin parçalanmasının fenotipik değişikliklere neden olduğu fonksiyon kaybı çalışmaları, biyolojik süreçler konusundaki anlayışımızı oluşturmakta önemli bir rol oynamaktadır. CRISPR / Cas9 yöntemi, genom mühendisliği teknolojisindeki en son ilerlemeyi temsil eder ve mevcut hücre ve organizma genetik pratiğini geliştirmiştir. Cas9, gRNA'ya komplementer spesifik bir DNA sekansına bağlanan ve bir çift telli kopuk (DSB) üreten bir RNA yönlendirmeli endonükleazdır. Bu DSB, homolog rekombinasyon için bir DNA şablonunun yokluğunda kesilen DNA iplikçiklerini hataya eğilimli, homolog olmayan bir uç birleştirme yoluyla yeniden bağlayacak olan DNA tamir makinelerini işe alıyor; bu da, nükleotid (ler) in eklenmesine veya silinmesine neden olabilir; FrameShift Mutasyonlarına Neden Olur 1 .

CRISPR / Cas9 uygulamasının büyük kolaylığı ve çok yönlülüğüOach, bilinmeyen gen fonksiyonlarının çözülmesini amaçlayan genom ölçekli nakavt ekranları için oldukça cazip bir araç yaptı. 2 , 3 . Bununla birlikte, gereksiz işlevlere sahip birden çok paralog varsa, tek genli nakavt yaklaşımları sınırlı bir şekilde kullanılmaktadır. Bu nedenle, tek bir gen ablasyon çok az veya hiç fenotipik değişiklik 4'te elde edilen paralogues mümkün dengeleme verilen gen fonksiyonunu belirlemek için yeterli olmayabilir. Bu nedenle, genetik kompozisyonun etkisinin üstesinden gelmek için farklı paralog genleri hedef alan birden çok gRNA vektörü göndererek paralogları paralel olarak ele geçirmek önemlidir.

CRISPR / Cas9'un paralog gen nakavtına kullanımını genişletmek için, son zamanlarda, dört önceden-tavlanmış gRNA'yı tek bir retroviral vektör 5'e klonlamak için hızlı, tek aşamalı bir klonlama yöntemi geliştirdik. CRISPR-konkantör adı verilen omurgaTekrarlayan gRNA ekspresyon kasetleri içeren bir MSCV retroviral plasmid üzerinde. Her bir kaset, tek bir tüpe 6'da bir Golden Gate karıştırma reaksiyonu kullanılarak çıkıntılar eşleşen eşzamanlı olarak tavlanmış bir gRNA oligo ile değiştirilebilen Type IIS kısıtlama enzimi Bbs I'in iki ters çevrilmiş tanıma bölgesi içerir. Bu klonlama yöntemi, Bbs I tarafından üretilen farklı çıkıntı diziliminden istifade ederek, birden fazla DNA fragmanının eşzamanlı olarak bir araya getirilmesine olanak sağlayan, sindirim ve ligasyonun tekrar eden döngülerinden oluşur. Bu enzimin eşsizliği, örneğin, tanımanın dışında asimetrik kesikler yapma kabiliyetidir sıra; Bu nedenle, her kaset, Bbs I çekirdeği alanını çevreleyen özel çıkıntılar ile farklı bir diziye sahip olabilir ve bu şekilde, her bir gRNA, konsatemer vektörünün belirli bir konumunda ve yönünde klonlanabilir.

Prensip belgesi olarak, bu stratejininFare elektroporasyon 5 bir tur ile eş zamanlı olarak, Wnt yolunun paralog negatif regülatörleri iki çift bozarak bağırsak organoids.

Son birkaç yılda pek çok başka grup, insan hücre çizgileri 8 , 9 , zebra balığı 10 ve Escherichia coli gibi çeşitli model sistemlerinde çoklu gen nakavtını başarmak için Golden Gate karıştırma 7 kullanılarak oluşturulan çoklu gRNA ekspresyon vektörlerine dayanan benzer stratejiler geliştirdi. 11 . Protokollerinde, gRNA'lar önce bireysel ara vektörlere klonlanır ve daha sonra bir araya getirilerek nihai bir ürün haline getirilir. Buna karşılık, CRISPR-concatemer stratejimizin en önemli avantajı, tek bir Bbs I karıştırma, klonlama basamağının kolaylığıdır. Diğer gRNA konkantemleri gibi, yöntemimiz de dört'e kadar eşzamanlı nakavt yapılmasını mümkün kılarFarklı genler veya birden fazla gRNA ile bir veya iki genin hedeflenmesini takiben artmış CRISPR nakavt etkinliği ( Şekil 1 ).

Bu protokolde, gRNA tasarımından Golden Gate reaksiyonuna kadar başarılı bir klonlamanın onaylanması için, CRISPR-konkantem vektörlerinin oluşumundaki her adımı ayrıntılı olarak açıklıyoruz. Ayrıca, elektroporasyon ve daha sonra büyüme faktörü geri çekme deneyleriyle, fare küçük bağırsak organoitlerine CRISPR-konkantemlerin transfeksiyonu için son derece verimli bir protokol sunuyoruz.

Protocol

1. CRISPR-concatemer Vector için gRNA Tasarımı

Not: Bu bölümün amacı, en iyi hedefleme stratejisini seçmeyi ve CRISPR-concatemer vektörü için belirli çıkıntıları içeren gRNA'ları nasıl tasarlayacağınızı açıklamaktır.

  1. Seçilen bir CRISPR gRNA tasarım aracını kullanarak ilgi genlerine karşı gRNA'lar tasarlayın. Bir örnek için Malzeme Tablosuna bakın.
    NOT: Paralog genlerin bir çiftini hedeflerken gen başına bir gRNA tasarlamak mümkün olsa da, çift knockout elde etme şansını artırmak için her gen için iki gRNA tasarlanması önerilir ( Şekil 1 ).
  2. GRNA'ların Bbs I tanıma sitesini içermediğinden emin olmak için bir kısıtlama haritalama aracı kullanın (örnek için Malzeme Tablosuna bakın).
  3. Tablo 1'de gösterildiği gibi her bir oligoya belirli CRISPR-konsatemer vektör çıkıntıları ekleyin.
"Fo: keep-together.within-page =" 1 "fo: keep-with-next.within-page =" always "> Kaset 1 Kaset 2 Kaset 3 Kaset 4 Sıra (5'-3 ') CACCGG [gRNA1] GT ACCGG [gRNA2] G CCGG [gRNA3] ACACCGG [gRNA4] GTT Sıra (5'-3 ') TAAAAC [RC-gRNA1] CC AAAAC [RC-gRNA2] Cı AAAC [RC-gRNA3] CTAAAAC [RC-gRNA4] CCG

Tablo 1: CRISPR-konsatemer Vektörünün Her Kaseti İçin Çıkıntılar.

2. CROSPR-konsatimer Vektörüne gRNA'ların klonlanması

  1. Oligosların fosforilasyonu ve tavlanması
    NOT: Bu adım, tO Her bir gRNA oligo için üst ve alt zincirleri tavlamak ve uçlarını tek bir reaksiyonda fosforile etmek.
    1. Tepkime karışımını, oligosları fosforile etme ve buz üzerinde üst ve alt ipliklerini tavlamak için aşağıdaki talimatlara göre hazırlayın.
      NOT: Tüm oligolar bir reaksiyona toplanabilir; Örneğin, 4 gRNA-konsatemer vektörü durumunda, birlikte 8 oligos bir araya getirilir.
    2. 3 concatemer için 3.0 μL gRNA üst iplikçik (her gRNA'dan 1.0 μL; 10 μM, 1 μL / gRNA), 3.0 μL gRNA alt ipi (her gRNA'dan 1.0 μL; 10 μM, 1 μL / gRNA), 2.0 μL T4 DNA ligaz tamponu (10x), 1.0 pL T4 PNK ve 20.0 uL toplam hacmine kadar H2O ilave edin.
    3. Pipetleme yöntemiyle iyice karıştırın ve aşağıdaki ayarları kullanarak bir termostatöre çalıştırın: 30 dakika için 37 ° C, 5 dakika için 95 ° C, 0.3 ° C'de dakikada 25 ° C'ye kadar rampa, 4 ° C'de tutun.
  2. Bbs ben tepki karışımı
    NOT: Bu bölümde, önceden tavlanmış gRNA oligoları, sindirim ve ligasyon döngüleri dönüşümlü olarak bir adımda konstemer vektörünün uygun pozisyonuna dahil edilir.
    1. 3 ve 4 gRNA-konsatemer vektörleri oluşturmak için DNase / RNaz içermeyen suda reaksiyon karışımını 1: 100 oranında inceltin.
      NOT: 2 gRNA-concatemers klonlandığında bu adım gerekli değildir .
    2. Aşağıdaki talimatlara uygun olarak, buz üzerinde Bbs I karıştırma reaksiyonunu bir araya toplayın . Yalnızca vektörü içeren bir negatif kontrol ekleyin.
    3. 100 ng CRISPR-concatemer vektörü, 10.0 μL oligo karışımı, 1.0 μL BSA içeren kısıtlama enzimi tamponu (10x), 1.0 uL DTT (10 mM), 1.0 uL ATP (10 mM), 1.0 μL Bbs I, 1.0 uL T7 ligaz 20.0 uL toplam hacmine kadar, ve H2O.
    4. Pipetleme yöntemiyle iyice karıştırın ve aşağıdaki ayarları kullanarak bir termostatöre uygulayın: 3 ve 4 gRNA-konsatremeri klonlamak için 50 döngü çalıştırın ve tutun .
  3. Exonuclease tedavisi
    NOT: Bu adım, doğrusallaştırılmış DNA'nın izlerini kaldırarak klonlamanın etkinliğini arttırdığı için önerilir.
    1. Bbs I shuffling reaksiyonunu bir DNA exonuclease (bkz . Malzeme Tablosu ) ile aşağıdaki gibi davranın.
    2. Önceki adımdan (2.2.3) 11.0 μL ligasyon karışımı alın, 1.5 uL ekzonükleaz tamponu (10x), 1.5 uL ATP (10 mM), 1.0 μL DNA ekzonükleaz ekleyin ve toplam su hacmi 15.0 μL'ye getirin. 37 ° C'de 30 dakika inkübe edip 70 ° C'de 30 dakika inkübe edin.
      NOT: Bu adım, karışımdaki artık doğrusallaştırılmış DNA'yı yok eder ve bu nedenle klonlama verimliliğini arttırır.
    3. Reaksiyon karışımının 2 μL'ini, kimyasal olarak dönüştürmek için dönüştürme için kullanın.Isı şoku ile E. coli bakterilerini çadır 12 .
      NOT: Alternatif olarak, reaksiyon -20 ° C'de bir hafta kadar saklanabilir.
  4. Restriksiyon sindirimi
    NOT: Bu adımın amacı kısıtlama sindirimiyle klonlama prosedürünün başarısını değerlendirmektir.
    1. CRISPR-concatemer vektöründe gRNA eklentilerinin varlığını teyit etmek için, aşılama döngüsü ile 4-8 bakteri kolonisini seçin, her klondan bir gece boyunca 37 ° C'de 4 mL LB ortamında bir orbital çalkalayıcıda büyütün. Üreticinin talimatlarına göre plazmid miniprep kiti kullanarak DNA'yı çıkarın (Malzeme Tablosuna bakın).
    2. Bir bakteri kuluçka makinesi içinde 3 saat boyunca 37 ° C'de inkübe ederek 10 uL reaksiyonda 10 U EcoR + 5 U Bgl II ile ~ 200 ng DNA'yı özümleyin . Büyüklük karşılaştırması için pozitif bir kontrol olarak ilgili orijinal vektör ile ayrı bir reaksiyon karışımı ekleyin.
      NOT: ThiS, bu iki kısıtlama enziminin tüm konkanteemleri tüketeceğinden, tüm konkanteemlerin var olup olmadığını teyit edecektir. Bunlar, her bir konstemer için beklenen boyutlardır: 2 gRNA-konkantem (800 bp), 3 gRNA-konkatem (1.2 kbp) ve 4 gRNA-konkatemer (1.6 kbp).
    3. Yaklaşık 20 dakika boyunca 90 V'de% 1 agaroz jel üzerinde sindirim reaksiyonlarını çalıştırın.
    4. UV transilluminator kullanarak jel görselleştirmek. Band örneklerinin orijinal vektörlerden biriyle eşleşmesini sağlayarak ve DNA merdiveni kullanarak her fragmanın beklenen boyuta sahip olduğundan klonları doğru ekleme boyutuyla tanımlayın.
    5. Seçilen klonları 37 ° C'de 5 U Bbs I ile bir bakteri inkübatöründe 3 saat boyunca sindirin. Bir kontrol olarak ilgili orijinal vektör ile ayrı bir reaksiyon karışımı ekleyin.
      NOT: Bu ek sindirim adımı, gRNA'ların doğru konuma klonlandığını teyit etmektir ve sonuç olarak tüm Bbs I tanıma siteleri kaybolmuştur.
    6. Üzerinde sindirim reaksiyonları çalıştırYaklaşık% 20 oranında 90 V'de% 1 agaroz jel. Yalnızca gRNA'lar içerdiği için Bbs I tarafından kesilmeyen vektörleri doğru olarak düşünün.
  5. Vektör dizilemesi
    NOT: Bu adımın amacı kısıtlama sindirim analizi ile doğru olarak tanımlanan vektörlerdeki gRNA sekanslarının varlığını doğrulamaktır.
    1. Aşağıdaki primerleri kullanarak Sanger sıralama 13 ile pozitif konkantem vektörlerini onaylayın:
      İletim: TCAAGCCCTTTGTACACCCTAAG (ilk gRNA kasetini kontrol etmek için)
      Linker1_Forward: GACTACAAGGACGACGATGACAA (ikinci gRNA kasetini kontrol etmek için)
      Linker2_Reverse: GGCGTAGTCGGGCACGTCGTAGGGGT (ikinci gRNA kasetini kontrol etmek için)
      Linker2_Forward: ACCCCTACGACGTGCCCGACTACGCC (üçüncü gRNA kasetini kontrol etmek için)
      Linker3_Reverse: TCCTCCTCTGAGATCAGCTTCTGCAT (üçüncü gRNA kasetini kontrol etmek için)
      Ters: AGGTGGCGCGAAGGGGCCACCAAAG (son gRNA'yı kontrol etmek için)kaset)
    2. Sıralanma okumalarındaki dizilerini araştırarak tüm gRNA'nın varlığını kontrol edin.

3. Bağırsak Organoidlerin Elektroporasyon ile Transfeksiyon Edilmesi

NOT: Lütfen bu prosedürün Fujii ve diğerleri tarafından yayınlanan protokole dayandığına dikkat edin. Fare küçük bağırsak organoid kültürleri için adaptasyon ile 2015 yılında 14 .

  1. Ön elektroporasyon
    NOT: Bu bölüm, fare bağırsak organoitlerinin elektroporasyon öncesinde, tüm antibiyotikleri ve kıvamlandırılmış ortamları kendi kültür ortamlarından çıkararak nasıl hazırlanacağı açıklanmaktadır. Bu, elektroporasyon sırasında olası toksik etkileri önleyecektir.
    1. Transfeksiyon prosedürünün 0 gününde organoidler 1: 2 oranda bölünürler.
      NOT: Bağırsak organoid kültürleri, önceden kurulmuş protokollere göre kript izolasyonu yaparak elde edilebilir 15 . Bakınız
    2. Organoidleri elektroporasyon için ayırırken, her transfeksiyon için 48 oyuklu bir plakadan en az 6 kuyu tohumlayın.
    3. 20 uL bodrum matris damla organoids Tohum ve 37 ° C 'de WENR + Nic ortamında (Wnt + EGF' + Noggin + R-spondin + Nikotinamit) bunları büyümesi, nemlendirilmiş bir kuluçka makinesi içinde% 5 CO2 (daha önce 15 tarif edilmiştir) .
  2. 2. günde, WENR + Nic'i antibiyotikler olmadan 250 μL EN (EGF + Noggin) + CHIR99021 (Glikojen Synthase Kinaz-3 inhibitörü) + Y-27632 (antibakteriyetsiz) ile değiştirerek değiştirin (bkz. Tablo 2 ).
    NOT: Bütün basamaklarda, 48 gözlü bir plakanın her oyuğuna eklenen ortam miktarı 250 mcL'dir.
  3. 3. günde, organoid maddeyi antibiyotiksiz EN + CHIR99021 + Y-27632 +% 1.25 v / v Dimetil sulfoksit (DMSO) olarak değiştirin.
  • Hücrelerin hazırlanması
    NOT:Burada, organoidlerin mekanik ve kimyasal ayrışma ile küçük hücre kümelerine nasıl parçalanacağını açıklıyoruz. Bu adımlar, işlemin başarısı için kritik öneme sahiptir.
    1. 4. günde, 1 mL'lik bir pipet ucu kullanarak bodrum matris kubbelerini bozun ve organoidleri 1.5 mL'lik bir tüp üzerine aktarın. Bir 48 gözlü plakanın dört oyuğunun bir tüpe alınması.
    2. Mekanik olarak organoidleri, yaklaşık 200 kez P200'lü bir pipet kullanarak aşağı ve yukarı pipetleyerek küçük parçalara ayırın. Oda sıcaklığında, 600 x g'de 5 dakika santrifüjleyin.
    3. Ortamı çıkarın ve pelleti bir hücre kültürü sınıfı rekombinant proteazın 1 mL'sinde tekrar süspanse edin (materyal tablosuna bakın). 37 ° C'de en fazla 5 dakika inkübe edin ve daha sonra 4x'lik bir objektifle ters ışık mikroskopu altında 50 μL'lik bir damla damlası kontrol edin.
      NOT: Elektroporasyondan sonra hücre hayatta kalmasını arttırdığı için 10-15 hücrenin kümeleri arzu edilir.
    4. Hücre süspansiyonunu düşük bağlayıcı 15 mL tüpe aktarın veAntibiyotiksiz bazal ortamdan 9 mL eklenerek ayrılma (bkz. Tablo 2 ). Oda sıcaklığında, 600 xg'de 5 dakika süreyle santrifüjleyin, sonra süpernatanı atın ve topağı 1 mL düşük serum ortamında tekrar süspansiyon haline getirin (Malzeme Listesine bakın ).
    5. Bürker'in odasıyla hücrelerin sayısını sayın ve elektroporasyon reaksiyonu başına en az 1 x 10 5 hücre kullanın. 9 mL düşürülmüş serum ortamı 15 mL tüp içine ilave edin ve 400 x g'de 3 dakika oda sıcaklığında santrifüjleyin.
  • Elektroporasyon
    NOT: Aşağıdaki bölümlerde, elektroporasyonun nasıl gerçekleştirileceği ve daha sonra organoidlerin iyileştirilmesi hakkında talimatlar verilmektedir.
    1. Süpernatanın tümünü çıkarın ve pelleti bir elektroporasyon çözeltisi içinde tekrar süspanse edin (bkz . Malzeme Listesi ). Hücre süspansiyonuna toplam 10 mikrogram DNA ekleyin ve 100 uL'lik bir son hacme elektroporasyon çözeltisi ekleyin ve hücre-DN'yi koruyunBuz üzerinde bir karışım. CRISPR-konektamer vektörlerini bir Cas9 ifade plazmidiyle ( örn. Addgene # 41815) 1: 1 oranında kullanın.
      NOT: Eklenen DNA'nın toplam hacmi, toplam reaksiyon hacminin% 10'undan az veya ona eşit olmalıdır.
    2. Transfeksiyon verimliliğini değerlendirmek için bir GFP plazmiti içeren ayrı bir transfeksiyon karışımı ekleyin ( örn. PCMV-GFP, Addgene # 11153 veya herhangi bir genel GFP ifade plasmidi).
    3. Hücre-DNA karışımını elektroporasyon küvetine ekleyin ve elektroporatör odasına yerleştirin. Elektroporatör üzerindeki uygun düğmeye basarak empedansı ölçün ve 0.030-0.055 Ω olduğundan emin olun. Tablo 3'te gösterilen ayarlara göre elektroporasyon uygulayın.
      NOT: Empedans değeri izin verilen aralığın dışına çıkarsa, küvet içindeki çözelti hacmini ayarlayın.
    4. Küvet üzerine 400 μL elektroporasyon tamponu + Y-27632 ekleyin ve daha sonra tümü 1.5 mL'lik bir tüpe aktarın. IncubaTe, oda sıcaklığında 30 dakika dinlendirilerek hücrelerin geri kazanılmasına ve daha sonra bunları 400 x g'de 3 dakika boyunca oda sıcaklığında döndürmeye bırakılmıştır.
    5. Süpernatantı çıkarın ve peleği 20 mcL / bodrum matrisinde tekrar süspanse edin. 48 oyuklu bir plakada göz başına yaklaşık 1 x 10 4 ila 1 x 10 5 hücre tohumlayın ve EN + CHIR99021 + Y-27632 +% 1.25 v / v DMSO ortamı ekleyin. 37 ° C'de inkübe edin.
    6. 5. günde, ortamı EN + CHIR99021 + Y-27632'ye değiştirin ve GFP ifadesini gözleyerek transfeksiyon verimliliğini kontrol edin ( Şekil 2 ). Organoidleri 37 ° C'de tutun ve 2 gün sonra EN + CHIR99021 + Y-27632 orta tazeleyin.
    7. 9. günde, ortamı WENR + Nic + Y-27632'ye değiştirin ve 37 ° C'de inkübe edin.
      NOT: Y-27632, 7-10 gün sonra (16-19 günlerinde) çıkarılabilir.
  • Kaplama darbesi Transfer nabzı
    Voltaj 175V 20V
    Darbe uzunluğu 5 ms 50 mms'den
    Darbe aralığı 50 mms'den 50 mms'den
    Bakliyat sayısı 2 5
    Çürüme oranı % 10 % 40
    Polarite + +/-

    Tablo 3: Elektroporasyon Ayarları.

    4. Büyüme Faktörü Para Çekme

    Not: Burada, bağırsak organoidlerinde Wnt yolağının negatif regülatörlerini çalarak bir büyüme faktörü geri çekme deneyinin nasıl yürütüleceği örneklendirilmektedir.

    1. 10-14 gün sonraR elektroporasyonunda, yukarıda sözü edilen (3.2.1 - 3.2.2) adımları izleyerek organoidleri 48 oyuklu bir plakada 1: 3 oranında bölün.
    2. Organoid pelleti 20 μL Bazal membran matrisinde süspansiyon haline getirin ve 10 dakika boyunca 37 ° C'de katılaşmasına izin verin. Daha sonra, dönüştürücü büyüme faktörü-yoksun ortam katlamalı 250 uL (EN) hedef genlerin nakavt 5 elde olup olmadığını test etmek için.
    3. Vahşi tipli vahşi tip (WT) kontrol organoidleri ve mutant organoidler arasındaki yaşamsal farklılığı görmek için organoidleri büyüme faktörü yoksun koşullar altında minimum 2 - 3 pasajda bölün. 5 , 15 .
      NOT: Vahşi organoitler, büyüme faktöründen yoksun ortamda iki pasajda hayatta kalamaz, mutant hatlar büyüyebilmelidir.

    Representative Results

    Konsatemer vektöründe doğru sayıda gRNA eklentisinin varlığını teyit etmek için, tüm gRNA ifade kasetlerini çevreleyen enzimler ( EcoR I + Bgl II) ile kısıtlama sindirimi yapılır (her kaset boyutu ~ 400 bp, Şekil 1 ). Örneğin, 4 gRNA-konsatimer vektör üretirken agaroz jelinde alt grubun beklenen boyutu yaklaşık 1.6 Kbp'dir; Bundan daha düşük herhangi bir bant, 4 gRNA kasetinin tamamının vektöre eklenmediğini gösterir ( Şekil 2A ). Buna ek olarak, her zaman Bbs I tanıma bölgelerinin kaybolduğunu ve enzimin vektörü kesmediğini kontrol etmesi önerilir ( Şekil 2B ).

    Yapılar teyit edildikten sonra optima elde etmek için elektroporasyon ile fare intestinal organoidlerine verilebilirler.L seviyelerinde transfeksiyon etkinliği (% 70'e kadar), GFP kontrolü ( Şekil 3 ) ile gösterilmiştir.

    Son olarak, bu stratejinin etkinliğini işlevsel olarak test etmek için Cas9 ile transfekte edilen bağırsak organoidleri ve Axin1 / 2 ve Rnf43 / Znrf3'e karşı konektör vektörleri, EN (R-spondin geri çekilmesi) ve EN + IWP2 (R-spondin ve Wnt geri çekilmesi, IWP2 : Porcupin inhibitörü, 2.5 uM) en az 3 pasaj ( Şekil 4 ) için ortam. Transfekte edilmemiş WT organoitleri her iki koşulda da ölürken, Axin1 / 2 nakavt organoidleri hem Wnt yolağının aşağı aktivasyonu nedeniyle hayatta kalmışlardır; Buna ek olarak, Rnf43 / Znrf3 mutant organoitleri R-spondin yokluğunda hayatta kalırlar ancak yol açan Wnt'in tükenmesine neden olan IWP2 varlığında hayatta kalamazlar. Birlikte ele alındığında, bu gözlemler, bu paralog çiftlerinin nakavt edilmesinin,Organoid fenotipini bekledi. Bu sonuçların ayrıntıları Gelişimsel Biyoloji 5'de yayınlanmıştır.

    Şekil 1
    Şekil 1: CRISPR-concatemer'in 4 Kaset ile Şematik Olarak Gösterilmesi. Her bir 400 bp'lik kaset ile bir U6 yükseltici, iki ters çevrilmiş Bbs I bölgesi (aynı zamanda BB olarak gösterilir) ve bu sırayla gRNA iskelesi bulunan 4 gRNA-konsatimer vektörünün şeması. Karıştırma reaksiyonu sırasında, Bbs I bölgeleri, çıkıntılar eşleşen gRNA fragmanları ile değiştirilir ve sonuç olarak kaybedilir. GRNA oligolarının doğru eklenmesini kontrol etmek için sıralama primerlerinin bağlanma yerleri mavi oklarla gösterilir. Fwd = ileri primer, Rev = ters primer, Link 1/2/3 = linker bölgeleri 1/2/3. Lütfen cBu şeklin daha büyük bir versiyonunu görmek için yalamak.

    şekil 2
    Şekil 2: Concetemer Vektörlerinin Temsilci Sindirim Modelleri. ( A ) EcoR I ve Bgl II ile 3 ve 4 gRNA-konsatema vektörlerinin çift sindirimi. Doğru sindirim modeli yeşil bir işaret ile işaretlenirken, yalnızca 1 veya 2 gRNA eklemeli vektörler kırmızı bir çaprazla işaretlenir. Şerit 1, pozitif kontrol olarak kullanılan ("+" ile işaretlenmiş) bir 4 gRNA-konsatEMer ebeveyn vektörünün sindirimini gösterir; Benzer şekilde, şerit 5, "+" ile işaretlenmiş bir 3 gRNA-konstemer ebeveyn vektörünün sindirimini gösterir. ( B ) Bbs I ile sindirim, sindirilmemiş concatemer vektörlerinin doğru boyutunu (yeşil kenarlar ile gösterilir) gösteren. Bbs I bölgelerini kaybetmiş bir gRNA içeren konsatemer vektörün sindirimi pozitif bir kontrol olarak kullanılır veD "+" ile işaretlenmiştir. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

    Şekil 3
    Şekil 3: Başarılı Elektroporasyona Bağlı Bağırsak Organoitlerinin Temsili Görüntüsü. Transfeksiyon etkinliğini değerlendirmek için bir GFP plazmidinin transfeksiyonu yararlıdır. Elektroporasyondan yaklaşık 24 saat sonra, az sayıda hücre içeren organoidler zaten görülebilir ve elektroporasyon prosedürü başarılı olursa,% 70'e kadar yeşil flüoresan görüntülenir. BF = parlak alan, GFP = yeşil floresan proteini. Ölçek çubuğu = 2.000 μm. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.


    Şekil 4: Mutant Bağırsak Organoitlerinin Temsilci Görüntüleri. Wnt yolağı Axin1 ve Rnf43'in negatif düzenleyicilerinin nakavtları, paraloglarıyla birlikte, bağırsak organoidlerini büyüme faktörü yoksunluğuna dirençli kılar. Özellikle Axin1 / 2 nakavt organoidleri (Axin1 / 2 KO) R-spondin (EN: EGF + Noggin) ve Wnt (EN + IWP2: EN + Porcupin inhibitörü) yokluğunda büyüyebilirken Rnf43 / Znrf3 mutant organoidleri (R & Z KO), ancak R-spondin (EN) yokluğunda hayatta kalabilir. Buna karşılık, WT organoitler sadece kontrol kültürü durumunda, WENR + Nic (Wnt + EGF + Noggin + R-spondin + Nikotinamid) hayatta kalabilirler. Ölçek çubukları = 1,000 μm. Bu rakamın daha büyük bir versiyonunu görmek için lütfen tıklayınız.

    Bazal orta Yorumlar
    4 ° C'de 4 hafta süreyle saklayın
    Hücre kültürü ortamı 500 mL Malzeme tablosuna bakınız
    L-Glutamin 100x 5 mL
    Tamponlayıcı madde 1 M 5 mL Malzeme tablosuna bakınız
    Penisilin Streptomisin 100x 5 mL
    WENR + Nic (Wnt + EGF + Noggin + R-spondin + Nikotinamid)
    2 hafta boyunca 4 ° C'de saklayın
    Bazal orta 50 mL'ye kadar
    Nöronal hücre serumundan arındırılmış ek madde (50x) 1 mL Ma tablosuna bakedilen malzemelerden
    Nöronal hücre serumundan arındırılmış ek madde (100x) 500 uL Malzeme tablosuna bakınız
    N-Asetilsistein (500 mM) 125 uL
    Fare EGF (100 ug / mL) 25 uL
    Fare Noggin (100 ug / mL) 50 uL
    R-Spondin klimalı ortam 5 mL
    Wnt3a klimalı ortam 25 mL
    Nikotinamid (1 M) 250 uL
    EN + KİRAZ + Y-27632 (EGF + Noggin + CHIR + Y-27632)
    2 hafta boyunca 4 ° C'de saklayın
    Penisilin Streptomisin içermeyen bazal ortam 20 mL'ye kadar
    Nöronal hücre serumundan arındırılmış ek madde (50x) 400 μL Malzeme tablosuna bakınız
    Nöronal hücre serumundan arındırılmış ek madde (100x) 200 uL Malzeme tablosuna bakınız
    N-Asetilsistein (500 mM) 50 uL
    Fare EGF (100 ug / mL) 10 uL
    Fare Noggin (100 ug / mL) 20 uL
    Y-27632 (10 uM) 20 uL
    CHIR99021 (8 uM) 10 uL
    EN (EGF + Noggin)
    4 ° C'de 4 hafta süreyle saklayın
    Bazal orta 50 mL'ye kadar
    Nöronal hücre serumundan arındırılmış ek madde (50x) Bkz. Malzeme Tablosu
    Nöronal hücre serumundan arındırılmış ek madde (100x) 500 uL Bkz. Malzeme Tablosu
    N-Asetilsistein (500 mM) 125 uL
    Fare EGF (100 ug / mL) 25 uL
    Fare Noggin (100 ug / mL) 50 uL

    Tablo 2: Organoid Medya Bileşimi.

    Discussion

    Bu protokolde, CRISPR-concatemers üretmek için gerekli tüm adımları ve fare bağırsak organoitlerinde aynı anda birden fazla geni çürütmek için CRISPR-konkanteemleri uygulayacağız. Daha önce de belirtildiği gibi, bu strateji, hızı, yüksek verimliliği ve maliyet etkinliği gibi birçok avantaja sahiptir.

    Bütün prosedürü başarıyla yerine getirmek için, dikkate alınması gereken birkaç kritik husus vardır. Öncelikle, tüm gRNA oligolarının düzgün bir şekilde tavlanması ve fosforile edilmesi esastır; çünkü bunlar kendi başına çok etkili olan Bbs I klonlama reaksiyonunun başlangıç ​​materyalini temsil eder. İkincisi, organoidleri elektroporasyona tabi tuttuğunda, durum başına daha fazla hücre kullanılırsa, mümkün olan en fazla transfeksiyon etkinliği o kadar yüksek olur. Ek olarak, hücre ayrışmasının ardından küçük hücrelerin kümelenmeleri tek hücrelere üstün olduğu da önemlidir.

    Bununla birlikte, teknik prob ile karşılaşmak mümkündür.Klonlama veya transfeksiyon ilk kez denendiğinde lems; GRNA klonlaması sırasında sorunlar olması durumunda, gRNA oligo dizisini iki kez kontrol etmeniz ve doğruysa, kısıtlama sindirim taraması için ilave bakteri kolonileri seçmeniz önerilir. Transfeksiyon etkinliği ve hücre yaşayabilirliği elektroporasyondan düşükse, durum başına daha fazla hücre kullanarak protokolü tekrar etmeniz ve hücre ayrılma süresini 3 dakikaya düşürmeniz önerilir.

    CRISPR-konkantemlerin üretimi nispeten ucuz ve kolay olmasına rağmen, organoidlerde daha büyük çaplı genetik ekranlar yapmak, ölçek organik kültür ile ilişkili maliyetlerle ve emek yoğun doğasıyla sınırlı olmadığı için değil. Bu durumda, CRISPR-konkantem yönteminin HEK293 ve fare embriyonik kök hücreleri gibi hücre hatlarıyla da uyumlu olduğunu belirtmek gerekir.

    Hücresel sistem ne olursa olsun, bu durumun bir başka potansiyel dezavantajıÜç ya da dört farklı genin aynı anda nakavt edilmesini amaçlarken yönelime rastlanabilir. Örneğin, her bir gRNA'nın farklı bir hedefleme etkinliği olacaktır ve aynı anda tüm genlere çarpma değişiklikleri nispeten düşük olabilir; Bu nedenle, aynı gene karşı birden fazla gRNA yönlendirmek için konsatemer sistemi kullanmanız önerilir.

    Benzer şekilde Golden Gate karıştırmaya dayanan alternatif stratejiler, çok katlı gRNA vektörlerini 7 , 8 üretmek için yıllar içinde önerildi. Bununla birlikte, yöntemimizde paralogları hedeflemek için gRNA kütüphaneleri üretmek için uygun hale getiren, tek bir retroviral vektöre doğrudan klonlamanın tek bir turunda birden fazla gRNA'yı bir araya getirmek mümkündür.

    CRISPR-konsatremeri MSCV retroviral vektör omurgasında inşa edilmiştir. Böylece, gRNA konkanteri ihtiva eden retrovirüs, aşırı ifade eden kararlı hücre çizgileri üretmek için kullanılabilirRess gRNA'ları. Bir Cas9-uyarılabilir sistemle kombine edildiğinde, sistemimiz kullanılarak uyarılabilir paralog knockouts gerçekleştirebilir.

    Özetle, burada bir adımda aynı vektöre dört farklı gRNA'nın nasıl klonlanacağını ve bu stratejinin yüksek bir transfeksiyon etkinliği ile organoid kültürüne nasıl uygulandığını açıklıyoruz. Ayrıca, tüm prosedür boyunca başarı şansını en üst düzeye çıkarmak için yararlı öneriler sunuyoruz.

    Disclosures

    Yazarların açıklayacak bir şeyi yok. Yazarlar, çıkar çatışması ilan etmedi.

    Acknowledgments

    Makalenin eleştirel okunması için Christopher Hindley'e teşekkür ediyoruz. AM, Wntsapp (Marie Curie ITN), AA-R tarafından desteklenmektedir. Tıp Araştırma Konseyi (MRC) ve BK.K tarafından desteklenmektedir. Ve RM, Wellcome Trust ve Royal Society [101241 / Z / 13 / Z] 'den bir Sir Henry Dale Bursu tarafından desteklenmekte ve Wellcome Trust ve MRC'den Wellcome Trust - MRC Cambridge Stem Cell Enstitüsüne bir temel hibe yoluyla destek alınmaktadır .

    Materials

    Name Company Catalog Number Comments
    Optimized CRISPR Design Tool Feng Zhang group CRISPR gRNA design tool; http://crispr.mit.edu/
    Webcutter 2.0 restriction mapping tool; http://rna.lundberg.gu.se/cutter2/
    T4 PNK (Polynucleotide Kinase) New England Biolabs M0201L
    T4 DNA ligase buffer New England Biolabs M0202S
    T7 DNA Ligase New England Biolabs M0318L
    DTT (dithiothreitol) Promega P1171
    ATP (adenosine triphosphate) New England Biolabs P0756S
    FastDigest BbsI (BpiI) Thermo Fisher FD1014
    Tango buffer (BSA-containing restriction enzyme buffer) Thermo Fisher BY5
    BglII New England Biolabs R0144
    EcoRI New England Biolabs R0101
    Plasmid-safe exonuclease Cambio E3101K
    Thermal cycler Applied biosystems 4359659
    10G competent E. coli bacteria Cambridge Bioscience 60108-1
    Plasmid mini kit Qiagen 12125
    Table top microcentrifuge Eppendorf UY-02580-01
    Inoculating loops Microspec PLS5
    Bacteria incubator Sanyo MIR-262
    Luria-Bertani broth (LB) Sigma-Aldrich L3522
    Agarose Sigma-Aldrich A4718
    Agarose gel electrophoresis apparatus Bioneer A-7020
    Advanced DMEM/F12(cell culture medium) Invitrogen 12634-034
    Glutamax (L-Glutamine) 100x Invitrogen 35050-068
    HEPES 1 M (buffering agent) Invitrogen 15630-056
    Penicillin-streptomycin 100x Invitrogen 15140-122
    B27 supplement (Neuronal cell serum-free supplement) 50x Invitrogen 17504-044
    N2 supplement (Neuronal cell serum-free supplement) 100x Invitrogen 17502-048
    n-Acetylcysteine 500 mM Sigma-Aldrich A9165-5G
    Mouse EGF 500 µg/mL Invitrogen Biosource PMG8043
    Mouse Noggin 100 µg/mL Peprotech 250-38
    Nicotinamide 1 M Sigma N0636
    R-Spondin conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Wnt conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Y-27632 10 µM Sigma-Aldrich Y0503-1MG
    Standard BD Matrigel matrix BD Biosciences 356231
    48-well Plate Greiner Bio One 677980
    CHIR99021 Sigma-Aldrich A3734-1MG
    IWP-2 Cell Guidance Systems SM39-10
    TrypLE (recombinant protease) Invitrogen 12605-010
    Opti-MEM (reduced serum medium ) Life technologies 51985-034
    Electroporation Cuvettes 2 mm gap NepaGene EC-002S
    Low binding 15 mL tubes Sigma-Aldrich CLS430791
    Bürker’s chamber Sigma-Aldrich BR719520-1EA
    NEPA21 Super Electroporator NepaGene contact supplier
    Protein LoBind tubes low binding Thermo Fisher 10708704
    BTXpress electroporation buffer Harvard Apparatus 45-0805
    DMSO (Dimethyl sulfoxide) AppliChem A3672

    DOWNLOAD MATERIALS LIST

    References

    1. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).
    2. Koike-Yusa, H., Li, Y., Tan, E. -P., Velasco-Herrera, M. D. C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotech. 32, (3), 267-273 (2014).
    3. Bassett, A. R., Kong, L., Liu, J. L. A Genome-Wide CRISPR Library for High-Throughput Genetic Screening in Drosophila Cells. J Genet Genomics. 42, (6), 301-309 (2015).
    4. Diss, G., Ascencio, D., DeLuna, A., Landry, C. R. Molecular mechanisms of paralogous compensation and the robustness of cellular networks. J Exp Zool B Mol Dev Evol. 322, (7), 488-499 (2014).
    5. Andersson-Rolf, A., Merenda, A., Mustata, R. C., Li, T., Dietmann, S., Koo, B. -K. Simultaneous paralogue knockout using a CRISPR-concatemer in mouse small intestinal organoids. Dev Biol. 420, (2), 1-7 (2016).
    6. Ran, F. A., Hsu, P. P. D., Wright, J., Agarwala, V., Scott, D., Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8, (11), 2281-2308 (2013).
    7. Engler, C., Gruetzner, R., Kandzia, R., Marillonnet, S. Golden gate shuffling: A one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS ONE. 4, (5), (2009).
    8. Sakuma, T., Nishikawa, A., Kume, S., Chayama, K., Yamamoto, T. Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 4, (5), 5400 (2014).
    9. Kabadi, A. M., Ousterout, D. G., Hilton, I. B., Gersbach, C. A. Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res. 42, (19), 1-11 (2014).
    10. Yin, L., et al. Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Genetics. 200, (2), 431-441 (2015).
    11. Cress, B. F., Toparlak, O. D., et al. CRISPathBrick: Modular Combinatorial Assembly of Type II-A CRISPR Arrays for dCas9-Mediated Multiplex Transcriptional Repression in E. coli. ACS Synth Biol. 4, (9), 987-1000 (2015).
    12. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J Vis Exp. (6), e253 (2007).
    13. Zimmermann, J., Voss, H., Schwager, C., Stegemann, J., Ansorge, W. Automated Sanger dideoxy sequencing reaction protocol. FEBS Letters. 233, (2), 432-436 (1988).
    14. Fujii, M., Matano, M., Nanki, K., Sato, T. Efficient genetic engineering of human intestinal organoids using electroporation. Nat. Protoc. 10, (10), 1474-1485 (2015).
    15. Andersson-Rolf, A., Fink, J., Mustata, R. C., Koo, B. -K. A video protocol of retroviral infection in primary intestinal organoid culture. J Vis Exp. (90), e51765 (2014).

    Erratum

    Formal Correction: Erratum: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer
    Posted by JoVE Editors on 01/02/2018. Citeable Link.

    An erratum was issued for: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. There was a typo in step 3.3 of the Protocol.

    Step 3.3 was corrected from:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 Ω

    to:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 kΩ

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics