Ett protokoll för Multiple Gene Knockout i Mouse Små Intestinala Organoider Använda en CRISPR-concatemer

Bioengineering
 

ERRATUM NOTICE

Summary

Detta protokoll beskriver stegen för kloning av flera enkla styr-RNA i en guide RNA-concatemervektor, som är särskilt användbar för att skapa multi-gen-knockouts med CRISPR / Cas9-teknik. Genereringen av dubbla knockouts i tarmorganoider visas som en möjlig tillämpning av denna metod.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Merenda, A., Andersson-Rolf, A., Mustata, R. C., Li, T., Kim, H., Koo, B. K. A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. J. Vis. Exp. (125), e55916, doi:10.3791/55916 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

CRISPR / Cas9-tekniken har avsevärt förbättrat genomförbarhetsstudien och hastigheten för studier av förlust av funktion som är nödvändiga för att förstå genfunktionen. I högre eukaryoter kan paralogena gener maskera en potentiell fenotyp genom att kompensera förlusten av en gen, vilket begränsar informationen som kan erhållas från genetiska studier med utgångspunkt i gengenomslag. Vi har utvecklat en ny, snabb kloningsmetod för guiden RNA (gRNA) concatemers för att skapa multi-gen-knockouts efter en enda transfektion i mus-tarmorganoider. Vår strategi möjliggör concatemerization av upp till fyra individuella gRNAs i en enda vektor genom att utföra en enda Golden Gate-shufflingreaktion med glödgade gRNA-oligos och en förkonstruerad retroviral vektor. Detta möjliggör antingen samtidig utslagning av upp till fyra olika gener eller ökad knockout-effektivitet efter inriktning av en gen av flera gRNA. I det här protokollet visar vi i detaljHur man effektivt klonar flera gRNA i den retrovirala CRISPR-concatemervektorn och hur man uppnår högeffektiv elektroporation i tarmorganoider. Som ett exempel visar vi att simultant knockout av två par gener som kodar negativa reglerare för Wnt-signalvägen (Axin1 / 2 och Rnf43 / Znrf3) gör intestinala organoider resistenta mot återkallandet av viktiga tillväxtfaktorer.

Introduction

Omvänd genetik är en allmänt använd metod för att undersöka genens funktion. I synnerhet studier av förlust av funktion, där störning av en gen orsakar fenotypiska förändringar, spelar en nyckelroll för att bygga upp vår förståelse för biologiska processer. CRISPR / Cas9-metoden representerar den senaste utvecklingen inom genomtekniksteknik och har revolutionerat den nuvarande praxisen av genetik i celler och organismer. Cas9 är ett RNA-styrt endonukleas som binder till en specifik DNA-sekvens komplementär till gRNA och genererar en dubbelsträngspaus (DSB). Denna DSB rekryterar DNA-reparationsmaskiner som, i avsaknad av en DNA-mall för homolog rekombination, kommer att ligga om den skurna DNA-strängen via felaktigt icke-homologa ändförbindelser, vilket sålunda kan resultera i införande eller deletioner av nukleotid (er) Orsakar framväxlingsmutationer 1 .

Den stora användarvänligheten och mångsidigheten hos CRISPR / Cas9 apprOach har gjort det till ett mycket attraktivt verktyg för genomskala knockout skärmar som syftar till att unraveling okända genfunktioner 2 , 3 . Ändå är enkla genknockout-tillvägagångssätt av begränsad användning om flera paraloger med överflödiga funktioner existerar. Således kan ablatering av en enda gen inte vara tillräcklig för att bestämma funktionen hos den genen som ges möjlig kompensation genom paraloger, vilket resulterar i liten eller ingen fenotypisk förändring 4 . Det är därför viktigt att utjämna paraloger parallellt genom att leverera flera gRNA-vektorer riktade mot de olika paraloggenerna för att övervinna påverkan av genetisk kompensation.

För att utvidga användningen av CRISPR / Cas9 till paraloggengenknockout har vi nyligen utvecklat en snabb, enstegs kloningsmetod för att klona upp till fyra förutglödda gRNA i en enda retroviral vektor 5 . Ryggraden, som heter CRISPR-concatemer, är baseradPå en MSCV retroviral plasmid innehållande repetitiva gRNA-expressionskassetter. Varje kassett innehåller två inverterade igenkänningsställen av typ IIS-restriktionsenzymet Bbs I, som kan ersättas irreversibelt med en glödgad gRNA-oligo med matchande överhängningar med användning av en Golden Gate-shufflingreaktion i ett enda rör 6 . Denna kloningsmetod består av repetitiva cykler av digestion och ligering som möjliggör simultan montering av multipla DNA-fragment genom att utnyttja de olika överhängningssekvenser som genereras av Bbs I. Uniktheten hos detta enzym är exempelvis förmågan att utföra asymmetriska skärningar utanför dess igenkänning sekvens; Därför kan varje kassett ha en annan sekvens med anpassad överhängningsflankerande Bbs I- kärnplats och på detta sätt kan varje gRNA klonas i en specifik position och orientering av concatemervektorn.

Som ett bevis på principen visade vi användningen av denna strategi iMus-intestinala organoider genom att samtidigt störa två par av paraloga negativa regulatorer av Wnt-vägen genom en omgång elektroporering 5 .

Under de senaste åren har många andra grupper utvecklat liknande strategier baserade på multipla gRNA-expressionsvektorer konstruerade med användning av Golden Gate-shuffling 7 för att uppnå multigen-knockout i olika modellsystem, såsom humana cellinjer 8 , 9 , zebrafisk 10 och Escherichia coli 11 . I sina protokoll klonas först gRNA i enskilda mellanliggande vektorer och monteras sedan ihop i en slutprodukt. Däremot är den huvudsakliga fördelen med vår CRISPR-concatemer-strategi bekvämligheten av ett enda Bbs I-shuffling-kloningsteg. Liksom andra gRNA concatemers, möjliggör vår metod antingen simultant knockout på upp till fyraOlika gener eller ökad CRISPR knockout-effektivitet efter inriktningen av en eller två gener med flera gRNA ( Figur 1 ).

I detta protokoll beskriver vi i detalj varje steg i genereringen av CRISPR-concatemervektorer, från gRNA-design till Golden Gate-reaktionen och till bekräftelse av framgångsrik kloning. Vi tillhandahåller också ett högeffektivt protokoll för transfektion av CRISPR-concatemers i mus-lilla tarmorganoider genom elektroporation och efterföljande tillväxtfaktoravdragsförsök.

Protocol

1. gRNA Design för CRISPR-concatemer Vector

Obs! Syftet med detta avsnitt är att förklara hur man väljer den bästa målstrategin och hur man designar gRNA som innehåller specifika överhäng för CRISPR-concatemervektorn.

  1. Design gRNA mot generna av intresse med ett CRISPR gRNA-designverktyg som du väljer. Se Materialetabellen för ett exempel.
    OBS! Vid riktning mot ett par paraloggener, även om det är möjligt att designa ett gRNA per gen, är det lämpligt att designa två gRNA per gen för att öka chanserna att uppnå en dubbel knockout ( Figur 1 ).
  2. Se till att gRNA: erna inte innehåller Bbs I-igenkänningssidan med hjälp av ett restriktionskartläggningsverktyg (se Materialetabellen för ett exempel).
  3. Lägg till specifika CRISPR-concatemer-vektoröverhängningar till varje oligo, såsom visas i tabell 1 .
"Fo: keep-together.within-page =" 1 "fo: keep-with-next.within-page =" always "> Kassett 1 Kassett 2 Kassett 3 Kassett 4 Sekvens (5'-3 ') CACCGG [gRNA1] GT ACCGG [gRNA2] G CCGG [gRNA3] ACACCGG [gRNA4] GTT Sekvens (5'-3 ') TAAAAC [RC-gRNA1] CC AAAAC [RC-gRNA2] C AAAC [RC-gRNA3] CTAAAAC [RC-gRNA4] CCG

Tabell 1: Överhäng för varje kassett av CRISPR-concatemervektorn.

2. Kloning av gRNA i CRISPR-concatemervektorn

  1. Fosforylering och glödgning av oligos
    OBS: Detta steg illustrerar hur tO glödande övre och undre strängar för varje gRNA-oligo och hur man fosforylerar sina ändar i en enda reaktion.
    1. Förbered reaktionsblandningen för fosforylerande oligos och glödgningstopp och bottensträngar på is, enligt anvisningarna nedan.
      OBS: Alla oligos kan samlas i en reaktion; Till exempel, i fallet med en 4 gRNA-concatemervektor, sammanfogar 8 oligos.
    2. För 3 concatemers använder du 3,0 μL gRNA topsträng (1,0 μL från varje gRNA, 10 μM, 1 μl / gRNA), 3,0 μL gRNA bottensträng (1,0 μl från varje gRNA; 10 μM, 1 μl / gRNA), 2,0 μl T4 DNA-ligasbuffert (10 x), 1,0 pl T4 PNK och lägga H 2 O upp till total volym av 20,0 | il.
    3. Blanda väl genom pipettering och kör det i en termocykler med följande inställningar: 37 ° C i 30 minuter, 95 ° C i 5 minuter, ramp ned till 25 ° C vid 0,3 ° C / min, håll vid 4 ° C.
  2. Bbs jag shuffling reaktion
    OBS: I detta avsnitt inkorporeras de förglödda gRNA-oligonerna i lämplig position för concatemervektorn i ett steg genom alternerande cykler av digestion och ligering.
    1. Späd reaktionsblandningen 1: 100 i DNas / RNas-fritt vatten för att generera 3 och 4 gRNA-concatemervektorer.
      OBS: När kloning 2 gRNA-konkatemerer behövs inte detta steg.
    2. Montera Bbs I shuffling reaktionen på is, enligt anvisningarna nedan. Inkludera en negativ kontroll som bara innehåller vektorn.
    3. Använd 100 ng CRISPR-concatemervektor, 10,0 pi oligo-blandning, 1,0 pi BSA-innehållande restriktionsenzymbuffert (10x), 1,0 pi DTT (10 mM), 1,0 pi ATP (10 mM), 1,0 pi Bbs I, 1,0 pi T7-ligas , och H2O upp till total volym av 20,0 | il.
    4. Blanda väl genom pipettering och kör detta i en termocykler med följande inställningar: Kör 50 cykler för kloning av 3 och 4 gRNA-concatemers och håll vid 37 ° C i 15 min, därefter 4 ° C för alltid.
  3. Exonukleasbehandling
    OBS! Detta steg rekommenderas starkt eftersom det ökar kloningens effektivitet genom att avlägsna spår av linjärt DNA.
    1. Behandla Bbs I-blandningsreaktionen med ett DNA-exonukleas (se tabell över material ) enligt följande.
    2. Ta 11,0 μl ligationsblandning från föregående steg (2.2.3), tillsätt 1,5 μL exonukleasbuffert (10x), 1,5 μL ATP (10 mM), 1,0 μl DNA-exonukleas, och uppnå total volym till 15,0 μl med vatten. Inkubera vid 37 ° C i 30 minuter följt av 70 ° C under 30 minuter.
      OBS: Detta steg avlägsnar eventuellt kvarvarande linjärt DNA i blandningen och ökar sålunda kloningseffektiviteten.
    3. Använd 2 | il av reaktionsblandningen för transformation till kemiskt kompeTält E. coli bakterier genom värmechock 12 .
      OBS: Alternativt kan reaktionen lagras i upp till en vecka vid -20 ° C.
  4. Restriktionsmältning
    ANMÄRKNING: Syftet med detta steg är att utvärdera klonprocedurens framgång med hjälp av restriktionsmältning.
    1. För att bekräfta närvaron av gRNA-insatser i CRISPR-concatemervektorn, välj 4-8 bakteriekolonier med en inokuleringsslinga, odla varje klon i 4 ml LB-medium över natten vid 37 ° C i en orbitalskakare. Extrahera DNA med hjälp av ett plasmid miniprep kit enligt tillverkarens anvisningar (se materialet ).
    2. Digest ~ 200 ng DNA med 10 U EcoR I + 5 U Bgl II i en 10 | il reaktion genom att inkubera den vid 37 ° C i 3 h i en bakterieinkubator. Inkludera en separat reaktionsblandning med motsvarande ursprungliga vektor som en positiv kontroll för storleksjämförelse.
      OBS: ThiS kommer att bekräfta om alla concatemers är närvarande, eftersom dessa två restriktionsenzymer kommer att accisera hela concatemers. Dessa är de förväntade storlekarna för varje concatemer: 2 gRNA-concatemer (800 bp), 3 gRNA-concatemer (1,2 kbp) och 4 gRNA-concatemer (1,6 kbp).
    3. Kör digestionsreaktioner på en 1% agarosgel vid 90 V under ca 20 min.
    4. Visualisera gelén med hjälp av en UV-transilluminator. Identifiera klonerna med korrekt insatsstorlek genom att säkerställa att deras bandmönster matchar den ursprungliga vektorn och att varje fragment har den förväntade storleken genom att använda en DNA-stege.
    5. Digestera de valda klonerna med 5 U Bbs I vid 37 ° C i 3 h i en bakterieinkubator. Inkludera en separat reaktionsblandning med motsvarande ursprungliga vektor som en kontroll.
      ANMÄRKNING: Detta ytterligare uppslutningstrin är att bekräfta att gRNA har klonats i rätt läge och följaktligen har alla Bbs I-igenkänningsställen gått vilse.
    6. Kör digestionsreaktioner påEn 1% agarosgel vid 90 V under ca 20 min. Betrakta som korrekta endast de vektorer som inte skärs av Bbs I eftersom de bara innehåller gRNA.
  5. Vektor sekvensering
    OBS! Syftet med detta steg är att bekräfta närvaron av gRNA-sekvenser i de vektorer som identifieras som korrekta genom restriktionsmältningsanalys.
    1. Bekräfta positiva concatemervektorer genom Sanger-sekvensering 13 med användning av följande primers:
      Framåt: TCAAGCCCTTTGTACACCCTAAG (för kontroll av den första gRNA-kassetten)
      Linker1_Forward: GACTACAAGGACGACGATGACAA (för kontroll av den andra gRNA-kassetten)
      Linker2_Reverse: GGCGTAGTCGGGCACGTCGTAGGGGT (för kontroll av den andra gRNA-kassetten)
      Linker2_Forward: ACCCCTACGACGTGCCCGACTACGCC (för kontroll av den tredje gRNA-kassetten)
      Linker3_Reverse: TCCTCCTCTGAGATCAGCTTCTGCAT (för kontroll av den tredje gRNA-kassetten)
      Omvänd: AGGTGGCGCGAAGGGGCCACCAAAG (för kontroll av den senaste gRNAkassett)
    2. Kontrollera närvaron av alla gRNA genom att söka deras sekvenser i sekvenseringsläsningen.

3. Transfektion av tarmorganoider genom elektroporation

OBS! Observera att denna procedur är baserad på protokollet publicerat av Fujii et al . År 2015, med anpassning för mus-tarmorganiska kulturer 14 .

  1. Pre-elektroporering
    OBS! I detta avsnitt beskrivs hur man förbereder muskeltarmorganoiderna före elektroporation genom att avlägsna alla antibiotika och konditionerade medier från sitt odlingsmedium. Detta kommer att förhindra eventuella toxiska effekter vid elektroporation.
    1. På dag 0 i transfektionsförfarandet delas organoider i ett förhållande 1: 2.
      OBS: Tarmorganoidkulturer kan erhållas genom att utföra kryptisolering enligt tidigare fastställda protokoll 15 . Vänligen hänvisa till
    2. Vid uppdelning av organoider för elektroporation, frö åtminstone 6 brunnar i en 48-brunnsplatta per transfektion.
    3. Ympa organoids i 20 | il-basalmatris droppar och odla dem i WENR + Nic medium (Wnt + EGF + Noggin + R-spondin + Nikotinamid) vid 37 ° C, 5% CO2 i en fuktad inkubator (som tidigare beskrivits 15) .
  2. På dag 2 byt medium genom att ersätta WENR + Nic med 250 μL EN (EGF + Noggin) + CHIR99021 (Glycogen Synthase Kinase-3-hämmare) + Y-27632 (ROCK-hämmare), utan antibiotika (se tabell 2 ).
    OBS! I alla steg är mängden medium tillsatt till varje brunn i en 48-brunnsplatta 250 μl.
  3. På dag 3 byt du organoidmediet till EN + CHIR99021 + Y-27632 + 1,25% v / v Dimetylsulfoxid (DMSO), utan antibiotika.
  • Framställning av cellerna
    NOTERA:Här beskrivs hur man fragmenterar organoider i småcellsklyftor genom mekanisk och kemisk dissociation. Dessa steg är kritiska för framgången med förfarandet.
    1. På dag 4, störa källarmatrisdomen med hjälp av en 1 ml pipettspets och överför organoider till ett 1,5 ml rör. Poolinnehållet i fyra brunnar i en 48-brunnsplatta i ett rör.
    2. Mekaniskt bryta organoider i små fragment genom pipettering upp och ner med en P200 pipett ca 200 gånger. Centrifugera vid rumstemperatur, 5 min vid 600 x g.
    3. Avlägsna mediet och resuspendera pelleten i 1 ml av ett rekombinant proteas av cellodlingskvalitet (se tabell över material). Inkubera vid 37 ° C i högst 5 min och kontrollera sedan en 50 μl droppe prov under ett inverterat ljusmikroskop med ett 4x objektiv.
      OBS: Kluster av 10-15 celler är önskvärda, eftersom detta ökar cellöverlevnaden efter elektroporation.
    4. Överför cellsuspensionen till ett lågbindande 15 ml rör och stoppaDissociation genom tillsats av 9 ml basalt medium utan antibiotika (se tabell 2 ). Centrifugera vid rumstemperatur, 5 min vid 600 xg, kassera supernatanten och resuspendera pelleten i 1 ml reducerat serummedium (se tabell över material ).
    5. Räkna antalet celler med en Bürker-kammare och använd minst 1 x 10 5 celler per elektroporationsreaktion. Tillsätt 9 ml reducerat serummedium till 15 ml röret och centrifugera vid rumstemperatur, 3 min vid 400 x g.
  • elektroporering
    OBSERVERA: Följande avsnitt ger instruktioner om hur man utför elektroporation och att göra organoiderna återhämta sig efteråt.
    1. Ta bort hela supernatanten och resuspendera pelleten i en elektroporationslösning (se tabell över material ). Tillsätt en total mängd 10 μg DNA till cellsuspensionen och tillsätt elektroporationslösning till en slutlig volym av 100 | il och behåll cell-DNEn blandning på is. Använd CRISPR-concatamer-vektorer i kombination med en Cas9-expressionsplasmid ( t.ex. Addgen # 41815) i ett 1: 1-förhållande.
      OBS: Den totala volymen av det tillsatta DNAet bör vara mindre än eller lika med 10% av den totala reaktionsvolymen.
    2. Inkludera en separat transfektionsblandning innehållande en GFP-plasmid för att utvärdera transfektionseffektivitet (t ex pCMV-GFP, Addgen # 11153 eller någon generisk GFP-uttryckande plasmid).
    3. Tillsätt cell-DNA-blandningen till elektroporationskuvetten och placera den i elektroporatorkammaren. Mät impedansen genom att trycka på lämplig knapp på elektroporatorn och se till att den är 0,030-0,055 Ω. Utför elektroporation enligt inställningarna som visas i Tabell 3 .
      OBS! Om impedansvärdet faller utanför det tillåtna intervallet, justera lösningsvolymen i kyvetten.
    4. Tillsätt 400 μL elektroporationsbuffert + Y-27632 till kyvetten och överför sedan allt till ett 1,5 ml rör. IncubaTe vid rumstemperatur i 30 minuter för att låta cellerna återvinna och därefter spinna dem vid rumstemperatur i 3 minuter vid 400 x g.
    5. Ta bort supernatanten och resuspendera pelleten i 20 pl / brunn i källarmatrisen. Säd ungefär 1 x 10 4 till 1 x 10 5 celler per brunn i en 48-brunnsplatta och sätt till EN + CHIR99021 + Y-27632 + 1,25% volym / volym DMSO-medium. Inkubera vid 37 ° C.
    6. På dag 5 byter du mediet till EN + CHIR99021 + Y-27632 och kontrollerar transfektionseffektiviteten genom att observera GFP-uttryck ( Figur 2 ). Håll organoider vid 37 ° C och uppdatera EN + CHIR99021 + Y-27632 medium efter 2 dagar.
    7. På dag 9 byter mediet till WENR + Nic + Y-27632 och inkuberas vid 37 ° C.
      OBS: Y-27632 kan tas bort efter 7-10 dagar (på dag 16-19).
  • Poringpuls Överföringspuls
    Spänning 175V 20V
    Pulslängd 5 msek 50 ms
    Pulsintervall 50 ms 50 ms
    Antal pulser 2 5
    Sönderfallshastighet 10% 40%
    polaritet + +/-

    Tabell 3: Elektroporationsinställningar.

    4. Tillbakadragande tillväxtfaktor

    Obs! Här exemplifieras hur man utför ett tillväxtfaktoruttagsexperiment när man slår ut negativa regulatorer av Wnt-vägen i tarmorganoider.

    1. 10-14 dagar avteR elektroporation, dela organoiderna i ett förhållande 1: 3 i en 48-brunnsplatta enligt ovanstående steg (3.2.1 - 3.2.2).
    2. Resuspendera organoidpelleten i 20 pl basmembranmatris och låt den stelna vid 37 ° C under 10 minuter. Därefter överlagrar 250 μL tillväxtfaktorberoende medium ( t.ex. EN) för att testa om knockout av målgenerna har uppnåtts 5 .
    3. Dela organoiderna under tillväxtfaktorberäknade förhållanden för minst 2 - 3 passager för att se skillnad i överlevnad mellan vildtyps vildtypskontrollorganoider och mutantorganoider 5 , 15 .
      ANMÄRKNING: Wildtype-organoider ska inte kunna överleva i tillväxtfaktorberoende medium över två passager, medan mutanta linjer borde kunna växa.

    Representative Results

    För att bekräfta närvaron av det korrekta antalet gRNA-insatser i concatemervektorn, utförs restriktionsmältning med enzymer ( EcoR I + Bgl II) som flankerar alla gRNA-uttryckande kassetter (varje kassettstorlek är ~ 400 bp, Figur 1 ). När man till exempel genererar en 4 gRNA-concatemervektor är den förväntade storleken av det nedre bandet i agarosgelen ungefär 1,6 Kbp; Vilket band som är lägre än detta indikerar att inte alla 4 gRNA-kassetterna är införda i vektorn ( figur 2A ). Dessutom rekommenderas det alltid att kontrollera att alla Bbs I-igenkänningsställen går förlorade och enzymet inte skär vektorn ( Figur 2B ).

    När konstruktionerna har bekräftats kan de levereras till mus-intestinala organoider genom elektroporation för att uppnå optimaL-nivåer av transfektionseffektivitet (upp till 70%), såsom visas av GFP-kontrollen ( Figur 3 ).

    Slutligen, för att funktionellt testa effektiviteten i denna strategi odlades intestinala organoider transfekterade med Cas9 och concatemervektorer mot Axin1 / 2 och Rnf43 / Znrf3 i EN (R-spondinuttag) och EN + IWP2 (R-spondin och Wnt-uttag, IWP2 : Porcupine-hämmare, 2,5 μM) media för minst 3 passager ( Figur 4 ). Medan otransfekterade WT-organoider dog under båda betingelserna, överlevde Axin1 / 2-knockoutorganoider både på grund av nedströms aktivering av Wnt-vägen; Dessutom överlever Rnf43 / Znrf3 mutantorganoider i frånvaro av R-spondin men kan inte överleva i närvaro av IWP2, vilket orsakar utarmning av Wnt som aktiverar vägen. Sammantaget visar dessa observationer att knockout av dessa parparogerpar är möjlig genom att generera tHan förväntade organoid fenotyp. Detaljer om dessa resultat har publicerats i utvecklingsbiologi 5 .

    Figur 1
    Figur 1: Schematisk representation av CRISPR-concatemeren med 4 kassetter. Schema för 4 gRNA-concatemervektorn med varje 400 bp-kassett innehållande en U6-promotor, två inverterade upprepade Bbs I-ställen (även betecknad som BB) och gRNA-ställningen i denna ordning. Under den blandade reaktionen ersätts Bbs I-ställen med gRNA-fragment med matchande överhäng och förloras följaktligen. Bindningsställen för sekvenseringsprimrarna för kontroll av korrekt införande av gRNA-oligos visas av de blå pilarna. Fwd = framåt primer, Rev = bakre primer, Länk 1/2/3 = länkregioner 1/2/3. Snälla CSlick här för att se en större version av denna figur.

    Figur 2
    Figur 2: Representativa digestionsmönster av Concatemer Vectors. ( A ) Dubbel digestion av 3 och 4 gRNA-concatemervektorer med EcoR I och Bgl II. Det korrekta matsmältningen markeras med en grön tickning medan vektorer med endast 1 eller 2 gRNA-insertioner är markerade med ett rött kors. Bana 1 visar digestion av en 4 gRNA-concatemer föräldravektor använd som positiv kontroll (märkt med "+"); På samma sätt visar lane 5 digestion av en 3 gRNA-concatemer föräldravektor, märkt med "+". ( B ) Digestion med Bbs I, som visar den rätta storleken av odödade concatemervektorer (indikerad av gröna fästingar). Digestion av en gRNA-innehållande concatemervektor som har förlorat Bbs I-ställen används som en positiv kontroll anD är markerad med "+". Vänligen klicka här för att se en större version av denna figur.

    Figur 3
    Figur 3: Representativ bild av framgångsrikt elektroporerade tarmorganoider. Transfektion av en GFP-plasmid är instrumental för att utvärdera transfektionseffektivitet. Cirka 24 h efter elektroporation är organoider som innehåller ett litet antal celler redan synliga och om elektroporationsförfarandet var framgångsrikt uppvisar upp till 70% av grön fluorescens. BF = ljusfält, GFP = grönt fluorescerande protein. Skala bar = 2000 μm. Vänligen klicka här för att se en större version av denna figur.


    Figur 4: Representativa bilder av mutant tarmorganoider. Knockout av de negativa regulatorerna av Wnt-vägen Axin1 och Rnf43, tillsammans med deras paraloger, gör tarmorganoiderna resistenta mot tillväxtfaktorberoende. I synnerhet kan Axin1 / 2 knockoutorganoider (Axin1 / 2 KO) växa i frånvaro av både R-spondin (EN: EGF + Noggin) och Wnt (EN + IWP2: EN + Porcupine-hämmare) medan Rnf43 / Znrf3 mutanta organoider (R & Z KO) kan bara överleva i frånvaro av R-spondin (EN). Däremot kan WT-organoider bara överleva i kontrollodlingstillståndet, WENR + Nic (Wnt + EGF + Noggin + R-spondin + Nikotinamid). Skalstänger = 1000 μm. Vänligen klicka här för att se en större version av denna figur.

    Basalt medium kommentarer
    Förvara vid 4 ° C i 4 veckor
    Cellodlingsmedium 500 ml Se tabell över material
    L-Glutamin 100x 5 ml
    Buffermedel 1 M 5 ml Se tabell över material
    Penicillin Streptomycin 100x 5 ml
    WENR + Nic (Wnt + EGF + Noggin + R-spondin + Nikotinamid)
    Förvaras vid 4 ° C i 2 veckor
    Basalt medium Upp till 50 ml
    Neuronalceller serumfritt tillskott (50x) 1 ml Se tabell över material
    Neuronalcellserumfritt tillskott (100x) 500 pl Se tabell över material
    N-acetylcystein (500 mM) 125 pl
    Mus-EGF (100 | ig / ml) 25 pl
    Mus Noggin (100 | ig / ml) 50 pl
    R-Spondin-konditionerat medium 5 ml
    Wnt3a konditionerat medium 25 ml
    Nikotinamid (1 M) 250 pl
    EN + CHIR + Y-27632 (EGF + Noggin + CHIR + Y-27632)
    Förvaras vid 4 ° C i 2 veckor
    Basalt medium utan penicillin-streptomycin Upp till 20 ml
    Neuronalceller serumfritt tillskott (50x) 400 | il Se tabell över material
    Neuronalcellserumfritt tillskott (100x) 200 pl Se tabell över material
    N-acetylcystein (500 mM) 50 pl
    Mus-EGF (100 | ig / ml) 10 pl
    Mus Noggin (100 | ig / ml) 20 pl
    Y-27632 (10 | im) 20 pl
    CHIR99021 (8 | im) 10 pl
    EN (EGF + Noggin)
    Förvara vid 4 ° C i 4 veckor
    Basalt medium Upp till 50 ml
    Neuronalceller serumfritt tillskott (50x) Se materialtabell
    Neuronalcellserumfritt tillskott (100x) 500 pl Se materialtabell
    N-acetylcystein (500 mM) 125 pl
    Mus-EGF (100 | ig / ml) 25 pl
    Mus Noggin (100 | ig / ml) 50 pl

    Tabell 2: Organoidmediasammansättning.

    Discussion

    I det här protokollet detaljerar vi alla steg som är nödvändiga för att generera CRISPR-concatemers och att tillämpa CRISPR-concatemers i muskeltarmorganoider för att samtidigt slå ut flera gener. Som tidigare noterat har denna strategi flera fördelar, såsom dess hastighet, hög effektivitet och kostnadseffektivitet.

    För att framgångsrikt kunna utföra hela proceduren finns det några kritiska aspekter att överväga. För det första är det väsentligt att alla gRNA-oligos är ordentligt glödgade och fosforylerade, eftersom de representerar utgångsmaterialet för Bbs I-kloningsreaktionen som i sig är mycket effektivt. För det andra, när elektroporiserande organoider, ju fler celler som används per tillstånd, desto högre är maximal möjlig transfektionseffektivitet. Dessutom är det också viktigt att efter celldissociation dominerar småcells-kluster över enskilda celler.

    Det är emellertid möjligt att stöta på teknisk probLems när man försöker antingen kloningen eller transfektionen för första gången; I fallet med problem vid gRNA-kloning rekommenderas att dubbelkontrollera gRNA-oligosekvensen och, om det är korrekt, välja ytterligare bakteriekolonier för screening av restriktionsmältning. Om transfektionseffektivitet och cellleabilitet är låg efter elektroporering, är det lämpligt att upprepa protokollet med användning av flera celler per tillstånd och reducera tiden för celldissociation till 3 min.

    Trots att genereringen av CRISPR-concatemers är relativt billigt och lätt, är det inte nödvändigt att utföra större skala genetiska skärmar i organoider, eftersom skalan begränsas av kostnaderna för organoidkultur och av dess arbetsintensiva natur. Det är värt att nämna i detta fall att CRISPR-concatemer-metoden också är kompatibel med cellinjer, såsom HEK293 och musembryonala stamceller.

    Oavsett cellens system, en annan potentiell nackdel med detta sTrategy kan uppstå när man syftar till simultant knockout av tre eller fyra olika gener. Till exempel kommer varje gRNA att ha en annan inriktningseffektivitet och förändringarna av att träffa alla gener samtidigt kan vara relativt låga; Av detta skäl är det lämpligt att använda concatemersystemet för att rikta mer än ett gRNA mot samma gen.

    Alternativa strategier baserade på Golden Gate-shuffling har föreslagits genom åren för att generera multiplex gRNA-vektorer 7 , 8 . I vår metod är det emellertid möjligt att direkt montera flera gRNA i en enda retroviral vektor i en enda klonkloning, vilket gör den lämplig för att generera gRNA-bibliotek för att rikta paraloger.

    Vår CRISPR-concatemer är byggd i den MSCV retrovirala vektorns ryggraden. Således kan gRNA-concatemerinnehållande retrovirus användas för att alstra stabila cellinjer som överexploderarRes gRNA. När det kombineras med ett Cas9-inducerbart system kan man utföra inducerbara paralog-knockouts med vårt system.

    Sammanfattningsvis beskriver vi hur man klonar upp till fyra olika gRNA i samma vektor i ett steg och hur man tillämpar denna strategi på organoidkultur med hög transfektionseffektivitet. Dessutom ger vi användbara förslag för att maximera chanserna för framgång under hela förfarandet.

    Disclosures

    Författarna har ingenting att avslöja. Författarna har inga intressekonflikter deklarerade.

    Acknowledgments

    Vi tackar Christopher Hindley för kritisk läsning av manuskriptet. AM stöds av Wntsapp (Marie Curie ITN), AA-R. Stöds av Medical Research Council (MRC) och BK.K. Och RM stöds av ett Sir Henry Dale Fellowship från Wellcome Trust och Royal Society [101241 / Z / 13 / Z] och får stöd genom ett kärnbidrag från Wellcome Trust och MRC till Wellcome Trust - MRC Cambridge Stem Cell Institute .

    Materials

    Name Company Catalog Number Comments
    Optimized CRISPR Design Tool Feng Zhang group CRISPR gRNA design tool; http://crispr.mit.edu/
    Webcutter 2.0 restriction mapping tool; http://rna.lundberg.gu.se/cutter2/
    T4 PNK (Polynucleotide Kinase) New England Biolabs M0201L
    T4 DNA ligase buffer New England Biolabs M0202S
    T7 DNA Ligase New England Biolabs M0318L
    DTT (dithiothreitol) Promega P1171
    ATP (adenosine triphosphate) New England Biolabs P0756S
    FastDigest BbsI (BpiI) Thermo Fisher FD1014
    Tango buffer (BSA-containing restriction enzyme buffer) Thermo Fisher BY5
    BglII New England Biolabs R0144
    EcoRI New England Biolabs R0101
    Plasmid-safe exonuclease Cambio E3101K
    Thermal cycler Applied biosystems 4359659
    10G competent E. coli bacteria Cambridge Bioscience 60108-1
    Plasmid mini kit Qiagen 12125
    Table top microcentrifuge Eppendorf UY-02580-01
    Inoculating loops Microspec PLS5
    Bacteria incubator Sanyo MIR-262
    Luria-Bertani broth (LB) Sigma-Aldrich L3522
    Agarose Sigma-Aldrich A4718
    Agarose gel electrophoresis apparatus Bioneer A-7020
    Advanced DMEM/F12(cell culture medium) Invitrogen 12634-034
    Glutamax (L-Glutamine) 100x Invitrogen 35050-068
    HEPES 1 M (buffering agent) Invitrogen 15630-056
    Penicillin-streptomycin 100x Invitrogen 15140-122
    B27 supplement (Neuronal cell serum-free supplement) 50x Invitrogen 17504-044
    N2 supplement (Neuronal cell serum-free supplement) 100x Invitrogen 17502-048
    n-Acetylcysteine 500 mM Sigma-Aldrich A9165-5G
    Mouse EGF 500 µg/mL Invitrogen Biosource PMG8043
    Mouse Noggin 100 µg/mL Peprotech 250-38
    Nicotinamide 1 M Sigma N0636
    R-Spondin conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Wnt conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Y-27632 10 µM Sigma-Aldrich Y0503-1MG
    Standard BD Matrigel matrix BD Biosciences 356231
    48-well Plate Greiner Bio One 677980
    CHIR99021 Sigma-Aldrich A3734-1MG
    IWP-2 Cell Guidance Systems SM39-10
    TrypLE (recombinant protease) Invitrogen 12605-010
    Opti-MEM (reduced serum medium ) Life technologies 51985-034
    Electroporation Cuvettes 2 mm gap NepaGene EC-002S
    Low binding 15 mL tubes Sigma-Aldrich CLS430791
    Bürker’s chamber Sigma-Aldrich BR719520-1EA
    NEPA21 Super Electroporator NepaGene contact supplier
    Protein LoBind tubes low binding Thermo Fisher 10708704
    BTXpress electroporation buffer Harvard Apparatus 45-0805
    DMSO (Dimethyl sulfoxide) AppliChem A3672

    DOWNLOAD MATERIALS LIST

    References

    1. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).
    2. Koike-Yusa, H., Li, Y., Tan, E. -P., Velasco-Herrera, M. D. C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotech. 32, (3), 267-273 (2014).
    3. Bassett, A. R., Kong, L., Liu, J. L. A Genome-Wide CRISPR Library for High-Throughput Genetic Screening in Drosophila Cells. J Genet Genomics. 42, (6), 301-309 (2015).
    4. Diss, G., Ascencio, D., DeLuna, A., Landry, C. R. Molecular mechanisms of paralogous compensation and the robustness of cellular networks. J Exp Zool B Mol Dev Evol. 322, (7), 488-499 (2014).
    5. Andersson-Rolf, A., Merenda, A., Mustata, R. C., Li, T., Dietmann, S., Koo, B. -K. Simultaneous paralogue knockout using a CRISPR-concatemer in mouse small intestinal organoids. Dev Biol. 420, (2), 1-7 (2016).
    6. Ran, F. A., Hsu, P. P. D., Wright, J., Agarwala, V., Scott, D., Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8, (11), 2281-2308 (2013).
    7. Engler, C., Gruetzner, R., Kandzia, R., Marillonnet, S. Golden gate shuffling: A one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS ONE. 4, (5), (2009).
    8. Sakuma, T., Nishikawa, A., Kume, S., Chayama, K., Yamamoto, T. Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 4, (5), 5400 (2014).
    9. Kabadi, A. M., Ousterout, D. G., Hilton, I. B., Gersbach, C. A. Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res. 42, (19), 1-11 (2014).
    10. Yin, L., et al. Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Genetics. 200, (2), 431-441 (2015).
    11. Cress, B. F., Toparlak, O. D., et al. CRISPathBrick: Modular Combinatorial Assembly of Type II-A CRISPR Arrays for dCas9-Mediated Multiplex Transcriptional Repression in E. coli. ACS Synth Biol. 4, (9), 987-1000 (2015).
    12. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J Vis Exp. (6), e253 (2007).
    13. Zimmermann, J., Voss, H., Schwager, C., Stegemann, J., Ansorge, W. Automated Sanger dideoxy sequencing reaction protocol. FEBS Letters. 233, (2), 432-436 (1988).
    14. Fujii, M., Matano, M., Nanki, K., Sato, T. Efficient genetic engineering of human intestinal organoids using electroporation. Nat. Protoc. 10, (10), 1474-1485 (2015).
    15. Andersson-Rolf, A., Fink, J., Mustata, R. C., Koo, B. -K. A video protocol of retroviral infection in primary intestinal organoid culture. J Vis Exp. (90), e51765 (2014).

    Erratum

    Formal Correction: Erratum: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer
    Posted by JoVE Editors on 01/02/2018. Citeable Link.

    An erratum was issued for: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. There was a typo in step 3.3 of the Protocol.

    Step 3.3 was corrected from:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 Ω

    to:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 kΩ

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics