네이티브 Chromatin Immunoprecipitation Nucleosome 밀도 분석을 위한 라이브러리를 시퀀싱의 세대

Genetics
 

Summary

선물이 nucleosome 밀도 칩 seq 분석 프레임 워크를 통합 하는 micrococcal nuclease (MNase) 접근에 대 한 적합 한 시퀀스 데이터 집합의 세대에 대 한 (칩 seq) 방법론을 시퀀싱 수정된 네이티브 chromatin immunoprecipitation 히스톤 수정 측량와.

Cite this Article

Copy Citation | Download Citations

Lorzadeh, A., Lopez Gutierrez, R., Jackson, L., Moksa, M., Hirst, M. Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis. J. Vis. Exp. (130), e56085, doi:10.3791/56085 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

선물이 시퀀싱 (칩 seq) 실험 프로토콜 호환 가우스 혼합물 배급 기반 분석 방법론 (nucleosome 밀도 칩 seq; ndChIP-seq)의 생성을 가능 하 게 수정 된 네이티브 chromatin immunoprecipitation 히스톤 수정 게놈 넓은 micrococcal nuclease (MNase) 접근의 결합 된 측량. Nucleosome 위치 및 로컬 밀도, 그리고 그들의 히스톤 subunits posttranslational 수정 로컬 전송 상태를 조절 하는 콘서트에서 행동. NdChIP-seq에 의해 생성 된 히스톤 수정 nucleosome 접근의 조합 측정 이러한 기능의 동시 심문 수 있습니다. NdChIP-seq 방법론 1 차 셀 기반된 칩 seq 프로토콜 cross-linking에 액세스할 수의 작은 숫자에 적용 됩니다. 함께 찍은, ndChIP-seq 드문 1 차 셀 인구 내에서 RNA 전사 조절 공유 메커니즘에 새로운 통찰력을 얻기 위해 로컬 nucleosome 밀도와 히스톤 수정 조합에서의 측정을 수 있습니다.

Introduction

진 핵 게놈 DNA1,2의 146의 기본적인 쌍에 의해 circumscribed 4 개의 히스톤 단백질 (예를 들어, H2A, H2B, H3, H4)의 두 개의 복사본으로 구성 하는 nucleosome 구조 반복을 통해 chromatin에 패키지 됩니다. Chromatin 개장 단지 유전자 발기인 경계 내 nucleosome 위치 제어 및 유전자 발현의 규칙에 참여 하는 전사 인자와 RNA 중 합 효소 기계3, DNA의 액세스 가능성을 변경 하 여 4.

nucleosome 내 히스톤의 아미노 맨끝 꼬리 acetylation, 메 틸 화, 인 산화, ubiquitylation, sumoylation, formylation, 및 특정 아미노산5 의 hydroxylation를 포함 하 여 다양 한 화학식 수정 대상이 되는 , 6 , 7 , 8. 위치 및 이러한 변경의 영향 전사7의 정품 인증을 허용 하는 분자 복합물의 염색 질 구조 및 제어 액세스 chromatin 상태 지시. 그 두 nucleosome 밀도 히스톤 수정 유전자 전사의 로컬 컨트롤에서 역할을 할 우리 네이티브 칩 접근 nucleosome 밀도 히스톤 수정9의 동시 측정을 가능 하 게 개발 10.

기본 칩 seq endonuclease micrococci nuclease 핵11,12, nucleosome13 위치를 지도에 활용 되는 속성 내에서 기본 상태에서 그대로 chromatin 소화 (MNase)의 활용 , 14 , 15. nucleosome 밀도 칩 seq (ndChIP-seq) 히스톤 수정10MNase 접근을 결합 하는 측정을 생성 하는 chromatin의 영역을 열려면 MNase의 특혜 접근의 속성 활용. ndChIP-seq는 히스톤 수정 드문 1 차 셀, 조직 및 배양된 세포에서의 프로 파일링 적합 합니다. 여기, 선물이 적합 조각 크기 게시물 immunoprecipitation, 쌍 간 경계, 읽기에 의해 결정을 통합 하는 앞에서 설명한 분석 프레임 작업10 시퀀스 데이터 집합 생성을 가능 하 게 상세한 프로토콜 동시에 히스톤 수정 측정 MNase 접근성 조사. 이전에, 10000 기본 인간 코드 혈액이 프로토콜의 응용 프로그램 파생 CD34+ 세포와 인간 배아 줄기 세포 염색 질 구조와 히스톤 수정이 내 간의 독특한 관계 셀 유형10 공개 . NdChIP-seq 단일 nucleosome 수준에서 세포 인구에서 epigenomic 기능을 공개 하 고 다른 유형의 서명으로 해결은 nucleosome 접근성 및 히스톤 수정 동시에 측정 하는 능력을 감안할 때, 그들의 구성 요소입니다. NdChIP-seq에 의해 다른 유형의 세포 인구의 탐험의 예는 어디 H3K4me3, 적극적인 마크와 H3K27me3, 억압 적인 마크는 현재10가 발기인의 조사입니다.

Protocol

참고:이 프로토콜에 대 한 최소 입력 단일 면역-강 수 (IP) 반응 당 10, 000 셀입니다. 제공 된 실험적인 워크시트 인쇄 및 실험을 계획 하는 지침으로 활용. 실 온에서 외피 ~ 22 ° c.에 것으로 간주 버퍼 조리법의 모든 표 1에 제공 됩니다. 버퍼의 모든 4 ° C에서 저장 한다 고 명시 되지 않는 한 절차 동안 얼음에 보관.

1. 세포 준비

  1. 배양된 세포
    1. 인산 염 버퍼 식 염 수 (PBS)의 1 mL로 세포 세척 하 고 정확 하 게는 hemocytometer를 사용 하 여 셀 농도 결정. 1 백만 개 이상의 셀이, PBS의 볼륨을 증가.
    2. 살 균 1.5 mL 튜브, 4 ° c.에 6 분 x 500g에 다운 스핀으로 70000-100000 셀의 해당 셀 카운트, aliquot에 따라 피 펫을 사용 하 여, 천천히 제거 (셀 펠 렛을 방해) 하지 않고는 상쾌한 삭제 그리고 얼음 세포의 용 해 버퍼 + 프로 테아 제 억제 물 칵테일 (PIC) 1000 세포의 농도를 x 1에서 펠 릿 resuspend / µ L. 20-30 아래로 pipetting으로 잘 믹스 번입니다. 그것은 중요 한 세포 덩어리 혼란 된다입니다. 거품을 생성 하지 마세요.
    3. NdChIP-seq 프로토콜의 하루 1 (제 2)에 직접 진행 또는 플래시 액체 질소와-80 ° c.에 게에 셀 펠 릿을 동결
  2. 정렬된 셀
    1. 행 크의 버퍼링 된 소금물 (HBSS), 또는 PBS + 2% 태아 둔감 한 혈 청 (FBS) 350 µ L 1.5 mL 튜브에 70000-100000 정렬된16 셀을 수집 합니다.
    2. 각 셀은 4 ° c.에 6 분 500g x에서 aliquot 아래로 회전 천천히 (셀 펠 렛을 방해) 하지 않고는 상쾌한을 제거 하 고 얼음 세포의 용 해 버퍼 + 1 resuspend는 피 펫을 사용 하 여, 1000 셀의 최종 농도에 PIC x / µ L.를 위아래로 pipetting으로 세포의 용 해 버퍼에서 잘 믹스 20-30 시간. 셀 덩어리 중단 됩니다 있는지 확인 합니다. 거품을 생성 하지 마세요.
    3. NdChIP-seq 프로토콜의 하루 1 (제 2)에 직접 진행 또는 플래시 액체 질소와-80 ° c.에 게에 셀 펠 릿을 동결

2. 제 1 일: ndChIP-seq

  1. 항 체-비드 복합물의 준비
    1. 37 ° C 물 목욕과 얼음 양동이 준비. 얼음에서 작업, PIC x 1 x IP 버퍼/1과 항 체 (Ab) 희석 버퍼, x 1을 준비 하 고 얼음에 그들을 유지. 부드러운 펄스-vortexing에 의해 잘 4 ° C 저장 및 혼합에서 단백질 A (또는 G) 자석 구슬 (선택 기준에 대 한 토론 을 참조 하십시오)를 검색 합니다. 얼음에 그것을 유지.
      참고: 펄스-vortexing vortexing 전체와 동 튜브에 형성 된다 때마다 중지 의미 합니다.
    2. 새로운 2 mL 튜브에 IP 반응 당 24 µ L 단백질 A (또는 G)의 자석 구슬을 전송 합니다. 구슬의 볼륨을 기록 하 고 얼음에 튜브를 유지. 예를 들어, 7의 ips 사용 7 x 24 µ L = 168 µ L.
    3. 튜브를 튜브 자석에 놓고 나타내는 비드 분리 될 솔루션에 대 한 대기 합니다. 방해 없이 구슬, 신중 하 게 상쾌한 한 피 펫을 사용 하 여 제거 하 고 삭제. 튜브 자석에서 튜브를가지고 고 얼음에 그것을 배치.
    4. 얼음 처럼 차가운 IP 버퍼의 한 동일한 볼륨 (, 구슬의 초기 볼륨) + 1 x 그림 믹스를 추가 합니다. 아래로 pipetting으로 혼합. 와 동 하지 마십시오.
    5. IP 버퍼 + 1 x 그림 + 튜브 자석에 다시 구슬을 놓고 나타내는 비드 분리 될 솔루션에 대 한 기다려야 합니다. 방해 없이 구슬, 신중 하 게 상쾌한 한 피 펫을 사용 하 여 제거 하 고 삭제. 반복 차가운 IP 버퍼 + PIC 세척 2 X 1 번 총 3 세척 합니다.
    6. 최종 세척 후 차가운 IP 버퍼는 동일한 볼륨 (, 구슬의 초기 볼륨) + 1 x 그림 혼합에 구슬 resuspend. 아래로 pipetting으로 혼합. 와 동 하지 마십시오. 얼음에 튜브를 유지.
    7. 얼음, 25 mL V 모양의 저수지로 IP 버퍼 + 그림의 10 mL를 붓는 다. 멀티 채널 피 펫을 사용 하 여 추가 차가운 IP 버퍼의 130 µ L + 깨끗 한 V-하단 96-잘의 개별 우물에 그림 혼합 x 1 판. IP 당 하나의 잘을 작성 합니다. 라벨로 접시 "Ab-비드 복합물".
    8. 12 µ L 세척 단백질 A (또는 G)의 자석 구슬 잘 IP 버퍼 + 그림, 포함 된 각 추가 하 고 아래로 pipetting으로 혼합. 얼음에 나머지 씻어 구슬 유지.
    9. 검증 된 항 체에서 얻을 그들의 냉동과 해 동, 얼음에 필요한 경우. 얼음에 working 희석 농도 표 2에 표시 된 1 x Ab 희석 버퍼와 항 체.
    10. Ab-비드 복잡 한 플레이트의 각 음에 적절 한, 희석 항 체 (표 1)의 1 µ L를 추가 합니다. 항 체 키에 잘 기록. 멀티 채널 피 펫을 사용 하 여, 20 번 위아래로 pipetting으로 각 행을 믹스. 팁 행 사이 변경 합니다. 알루미늄 플레이트 커버 Ab 비드 복잡 한 접시를 아주 잘 밀봉 하 고 2 시간 이상 회전 하는 플랫폼에 4 ° C에서 품 어.
      참고:이 인큐베이션 단계 2.4를 시작할 준비가 될 때까지 진행할 수 있습니다.
  2. 세포 세포의 용 해와 염색 질 소화
    1. 세포의 용 해 버퍼 x 1 + PIC x 1과 MNase의 1 mL 준비 얼음 작업, 난 희석 (표 3)를 버퍼링 하 고 얼음에 그들을 유지.
    2. 검색할 셀 알 약-80 ° C 저장 (또는 얼음, 신선 하 게 준비 하는 경우). 각 셀 펠 렛 10 s, 다음 얼음을 전송에 대 한 37 ° C 물 탕에 녹여
    3. 각 셀 펠 릿 즉시 차가운 1 x 세포의 용 해 버퍼 + 1 x 10000 셀/20 µ L, 그리고 10 번 pipetting으로 믹스의 최종 농도에 그림 고 거품을 만들지 않고 아래 추가 합니다. 예를 들어, 70000 셀에 대 한 최종 볼륨 140 µ L입니다.
    4. 얼음, aliquot 20 µ L/잘 96 잘 접시에 결과 lysates의 작업. 플라스틱 도장 플레이트 커버 하 고 20 분 라벨 플레이트 "MNase 소화" ice에 품 어 서식 파일 키에 웰 스를 기록. 염색 질 소화 반응의 정확한 타이밍을 보장 하기 위해 한 번에 샘플 2 개 이상의 행으로 소화를 진행 하지 마십시오.
    5. 방금 전에 20 분 세포 완료 되 면 희석 된 MNase 나 MNase와 효소 나 희석 20 U / µ L의 최종 농도를 버퍼링 하 고 얼음에 그것을 유지.
    6. MNase을 준비 얼음 작업, 내가 소화 저수지 96 잘 접시의 한 행에 표 4 와 샘플 플러스 5 µ L 죽은 볼륨의 각 행 마다 믹스의 aliquot 20 µ L 믹스 마스터와 얼음에 그것을 유지. 두 개의 행에 대 한 볼륨 이어야 한다: (20 µ L x 2) + 5 µ L = 45 µ L.
    7. lysates 잠복기 후, 얼음에서 MNase 소화 플레이트를 제거 합니다. 20 µ L MNase의 추가 멀티 채널 피 펫을 사용 하 여 내가 소화 샘플의 각 행에는 믹스 마스터와 아래로 pipetting으로 10 번을 혼합. 팁 행 사이 변경 합니다. 정확히 5 분 동안 실 온에서 품 어.
    8. 5 분 후 반응을 중지, 250 µ M ethylenediaminetetraacetic 산 (EDTA)의 6 µ L을 추가 하는 멀티 채널 피 펫을 사용 하 여 샘플의 각 행에 아래로 혼합을 몇 번. 팁 행 사이 변경 합니다. EDTA 추가 후 전환 피펫으로의 설정을 20 µ L을 혼합 10 번 소화 반응의 완전 한 정지를 보장 하기 위해서 여기저기 pipetting으로. 팁 행 사이 변경 합니다.
    9. 멀티 채널 피 펫을 사용 하 여, 소화 하는 MNase 샘플의 각 행에 추가 세포의 용 해 버퍼와 혼합 x 10의 6 µ L 10 번 위아래로 pipetting으로 잘. 플라스틱 물개로 커버 하 고 15 분 동안 얼음에 품 어.
  3. 입력된 분리 및 전 개간
    1. 모든 우물 같은 살 균, 하나로 펠 릿/서식 파일 셀에 대 한 미리 냉장 얼음, 1.5 mL 튜브 (미리 서식 파일 id 표시) 및 혼합에 수영장, 얼음에 15 분 부 화를 철저 하 게 따라 있지만 천천히 세제 거품을 방지 하는 피 펫을 사용 하 여.
    2. 각 셀 펠 릿/서식 파일에 대 한 살 균으로 새로운 소화 chromatin, 0.5 mL 튜브 (미리 서식 파일 id 표시), 및 4 ° C에서 저장소의 8 µ L를 하룻밤으로 전송 합니다. 이 입력된 컨트롤 될 것입니다.
    3. 새로운 96 잘 접시에 48 µ L aliquots에 소화 chromatin의 나머지 볼륨을 배포 합니다. 웰 스 A01-A06 들어가는 셀 펠 릿/템플릿 1, 셀 펠 릿/템플릿 2 우물 A07-A12, 등등으로. 서식 파일의 키에 웰 스를 기록 합니다. "전 개간" 접시를 레이블을 지정 합니다.
    4. 멀티 채널 피 펫을 사용 하 여 추가 IP 버퍼 x 1 + 1 PIC x 120 µ L 및 세척된 단백질 A (또는 G) 자석 구슬의 12 µ L 전 개간 플레이트의 각 음에 단계 2.3.3에서. 10 번 위아래로 pipetting으로 각 행을 믹스. 팁 행 사이 변경 합니다. 알루미늄 플레이트 커버와 함께 접시를 잘 밀봉 하 고 최소 2 h 4 ° C에서 회전 플랫폼에서 품 어.
  4. Immunoprecipitation 반응
    1. Ab-비드 복잡 한 접시 (단계 2.1.10)와 전 개간 플레이트 (단계 2.3.4) 적어도 2 h. 빠른 10 centrifuging 여 두 접시를 회전 하는 동안 incubated가지고 있는지 확인 하십시오이 단계를 시작 하기 전에 200 x g에서 s.
    2. (에서 단계 2.1.10) Ab 비드 복잡 한 접시 접시 자석에 놓고 15 기다려 분명 될 솔루션에 대 한 s. 조심 스럽게 제거 하 고 상쾌한 구슬 방해 하지 않고 한 피 펫을 사용 하 여 삭제. 플레이트 자석에서 접시를 제거 하 고 얼음에 그것을 유지.
    3. (단계 2.3.4)에서 전 개간 반응 접시 접시 자석에 놓고 15 기다려 분명 될 솔루션에 대 한 별도의 구슬에 대 한 s. 방해 없이 구슬, 신중 하 게 상쾌한 복잡 한 접시 보관 얼음과 혼합에 부드럽게 15 배 아래로 pipetting Ab 구슬의 해당 우물에는 피 펫을 사용 하 여 전송 합니다. 물개는 알루미늄으로 잘 플레이트 커버 플레이트와 품 어 회전 하는 플랫폼에 4 ° C에서 (12 월 18 일 h) 하룻밤. 다시 접시 "IP 반응" 레이블을.

3. 주 2: ndCHIP-seq

  1. 세척 및 차입
    1. 65 ° c 난방 믹서 설정 얼음에는 낮은 소금 워시 버퍼 및 높은 소금 워시 버퍼를 준비 합니다. 빠른 회전 10 단계의 2.4.3 IP 반응 판 200 x g에서 s.
    2. IP 반응 접시 접시 자석에 놓고 15 기다려 분명 될 솔루션에 대 한 s. 멀티 채널 피 펫을 사용 하 여 구슬을 방해 하지 않고, 조심 스럽게 제거 하 고 삭제는 상쾌한. 플레이트 자석에서 판 하 고 얼음에 그것을 배치.
    3. IP 반응 판에 샘플의 각 행에 얼음 처럼 차가운 낮은 소금의 150 µ L 세척 버퍼와 혼합 천천히 10 번 아래로 완전히 구슬 resuspend을 추가 합니다.
    4. IP 반응 접시 접시 자석에 다시, 별도로 구슬 대기 장소와 구슬 방해 하지 않고 제거 하 고 삭제는 상쾌한 멀티 채널 피 펫을 사용 하 여. 얼음에 다시 접시를 놓고 2 세척 총 3.1.3, 3.1.4 단계를 반복 합니다.
    5. 얼음, IP 반응 판에 샘플의 각 행에 추가 높은 소금의 150 µ L 워시 버퍼와 혼합 천천히 10 번 아래로 완전히 구슬 resuspend를 pipetting으로 합니다.
    6. IP 반응 접시 접시 자석에 다시, 별도로 구슬 대기 장소와 구슬 방해 하지 않고 제거 하 고 삭제는 상쾌한 멀티 채널 피 펫을 사용 하 여. 얼음에 IP 반응 접시를 놓고 미리 옆에 새로운 96 잘 접시를 진정.
    7. IP 반응 판에 샘플의 각 행에 높은 소금의 150 µ L 세척 버퍼와 혼합 천천히 10 번 아래로 완전히 구슬 resuspend를 pipetting으로 추가 합니다. 물의 resuspension, 후 새, 미리 냉장, 96 잘 접시의 해당 하는 행을 샘플의 각 행을 전송 합니다. 레이블을 접시 "IP 반응". 오래 된 접시를 삭제 합니다.
    8. 판 자석에 새로운 IP 반응 접시를 놓고 구분 하는 구슬에 대 한 대기. 멀티 채널 피 펫을 사용 하 여 구슬을 방해 하지 않고, 조심 스럽게 제거 하 고 삭제는 상쾌한. 실 온에서 접시를 유지.
    9. IP 반응 판에 샘플의 각 행에 칩 차입 버퍼 (EB)의 30 µ L을 추가 하 고 천천히 아래로 pipetting으로 10 번을 혼합. 거품 형성을 방지 있는지 확인 합니다.
    10. PCR 덮개로 잘 접시를 봉인 하 고 1350 rpm의 혼합 속도와 1.5 h 65 ° C에서 난방 믹서에서 품 어.
    11. 1.5 h 부 화 후 4 ° c.에 1 분 동안 200 x g에서 IP 반응 판 아래로 회전 50 ° c.의 난방 믹서 설정을 변경합니다
    12. 스핀, 후 IP 반응 접시 접시 자석에 놓고 취소 솔루션에 대 한 대기 합니다. 멀티 채널 피 펫을 사용 하 여, 구슬, 방해 하지 않고 신중 하 게 전송 30 µ L는 상쾌한의 새로운 96 잘 접시에. 각 행에 대 한 신선한 팁을 사용 합니다. 레이블을 접시 "IP 반응" 하 고 실내 온도에서 보관.
  2. 단백질 소화
    1. 4 ℃ 냉장고에서 30% 못/1 M NaCl 자석 구슬17 (버퍼 구성 테이블) 솔루션을 검색 하 고 적어도 30 분 중요 한에 대 한 실내 온도 유지: 비드 솔루션 완전히 진행 하기 전에 실내 온도 도달 하는 확인 하십시오.
    2. 4 ° C 저장 (2.3.2 단계)와 빠른 회전 급강하에서 입력된 컨트롤 샘플을 검색 합니다. 피 펫을 사용 하 여 볼륨을 측정 하 고 초순 각 입력된 컨트롤에 대 한 추가 30 µ L. 마지막 볼륨 미리 선택 된 입력된 웰 스 (빈 우물)에 입력된 컨트롤 샘플 전송 IP 반응 플레이트 (3.1.12 단계)에서. 예제 키에 잘 기록.
    3. 얼음, 저수지 96 잘 접시의 한 행에 표 5 와 aliquot 같은 볼륨에서와 같이 단백질 소화 마스터 믹스를 준비 합니다.
    4. 멀티 채널 피 펫을 사용 하 여, IP 반응 판에 샘플의 각 행에 추가 40 µ L의 단백질 소화 마스터 믹스 하 고 위아래로 천천히 10 번을 혼합. PCR 덮개로 잘 접시를 봉인 하 고 1 분, 200 x g에서 스핀 다운 650 rpm에서 설정 하는 30 분 동안 50 ° C에서 난방 믹서에서 품 어. 접시 잠복기 동안 신선한 70% 에탄올 (EtOH)를 준비 하 고 실내 온도에서 보관.
    5. 30 분 부 화 완료 후 회전 1 분, 4 ° c.에 대 한 200 x g에서 IP 반응 판 실 온에서 접시를 유지.
      참고: 총 볼륨 이어야 한다 지금 ~ 70 µ L/잘.
  3. 비드 정리 30% 못/1 M NaCl 자석 구슬 솔루션을 사용 하 여
    1. Aliquot 실내 온도 30% 못/1 M NaCl 자석의 저수지 깨끗 한 96 잘 접시의 한 행으로 솔루션 구슬 (샘플 당 75 µ L x 행의 #).
    2. 실내 온도에, 멀티 채널 피 펫을 사용 하 여 working IP 반응 판에 샘플의 각 행에 30% 못/1 M NaCl 자석 구슬 솔루션의 70 µ L (1:1 비율)을 추가 하 고 아래로 pipetting으로 10 번을 혼합. 팁 행 사이 변경 합니다. 실 온에서 15 분 동안 접시를 품 어.
    3. 플레이트 자석에 접시를 놓고 별도의 구슬 수 있도록 5 분 동안 품 어.
    4. 피 펫를 사용 하 여 구슬을 방해 하지 않고, 조심 스럽게 제거 하 고 삭제는 상쾌한. 구슬 유지.
    5. IP 반응 접시 접시 자석에 여전히 동안 실내 온도 70%의 150 µ L 추가 샘플의 각 행에 멀티 채널 피 펫을 사용 하 여 EtOH 30 품 어 및 s. 30 후 s, 멀티 채널 피 펫을 사용 하 여 제거 하 고 삭제는 상쾌한. 한 번 더 2 세척의 총에 대 한이 단계를 반복 합니다.
    6. 두 번째 EtOH 세척 후 3 분 시각적으로 모든 EtOH 증발 되도록 판 검사에 대 한 '건조' 접시 접시 자석에의 품 어. 그렇지 않은 경우에 1 분 이상 건조 낮은 수율에 구슬 결과 대 한 접시를 품 어.
    7. 플레이트 자석 및 멀티 채널 피 펫을 사용 하 여 접시를 받아 35 µ L EB (자료 테이블)를 추가 합니다. 10 배를 아래로 pipetting으로 잘 섞는다. 팁 행 사이 변경 합니다. 3 분 elute 실 온에서 품 어.
    8. 부 화, 후 IP 반응 접시 접시 자석에 다시 놓고 2 분 동안 품 어. 구슬 분리 해야 하 고 솔루션 명확 하 게 될 것 이다.
    9. 멀티 채널 피 펫을 사용 하 여, 구슬, 방해 하지 않고 신중 하 게 전송는 상쾌한 새로운 96 잘 접시의 해당 우물에.
    10. 알루미늄 플레이트 커버 플레이트를 봉인, 라벨 "IPed + 입력 DNA", 그리고 하룻밤, 4 ° C 또는-20 ° C에서 장기 저장 (> 48 h) 저장.

4. 주 3: 도서관 건축

  1. 최종 수리 및 인 산화
    1. 결국 수리/인 산화 반응에 대 한 입력은는 IPed + 입력 단계 3.3.10 접시. 녹고, 후 4 ° C에서 1 분 동안 200 x g에서 내려 접시를 회전 하 고 얼음에 그것을 유지 합니다.
    2. -20 ° C 냉장고 (효소)를 제외 하 고 시 약의 모든 최종 수리/인 산화 반응 (표 6)에 필요한 그들을 실 온에서 해 동 후 즉시 얼음 전송에서 검색 합니다.
    3. 얼음에 working, 불 임, 1.5 mL microcentrifuge 관에서 최종 수리/인 산화 마스터 믹스를 설정 하려면 표 6 따릅니다. 모든 비-효소 구성 요소 추가 후 펄스 vortexing에 의해 잘 혼합 하 고 얼음에 다시 튜브를 놓습니다.
    4. 그들의 저온 저장 및 전송에서 냉장된 튜브 멋진 랙에서 벤치 관련 효소를 검색 합니다. 튜브, 빠른 스핀을 터치 하 여 각 효소를 혼합 하 고 냉장된 튜브 멋진 선반에 다시. 효소를 pipetting 때 정확한 볼륨 전송을 보장 하기 위해서 천천히 발음. 또한, 후 아래로 pipetting으로 마스터 믹스에 팁을 세척.
    5. 효소는 추가 부드럽게 펄스-소용돌이 마스터 믹스 5 번을 모든 구성 요소, 다음 빠른 스핀의 동등한 배급을 보장 즉시 튜브 얼음에 다시.
    6. 얼음, 약 새로운 저수지 96 잘 접시;의 한 행으로 최종 수리/인 산화 마스터 믹스의 적절 한 볼륨 수 aliquoted 수 양: (15 µ L 행의 # x) + 5 µ L 죽은 볼륨. 두 개의 행에 대 한 예제 계산: (15 µ L x 2) + 5 µ L = 35 µ L/잘.
    7. 멀티 채널 피 펫을 사용 하 여, 샘플의 각 행에 최종 수리/인 산화 마스터 믹스의 15 µ L을 추가 하 고 아래로 pipetting으로 10 번을 혼합. 팁 행 사이 변경 합니다. 플라스틱 커버와 함께 접시를 봉인, 4 ° C에서 1 분 동안 200 x g에 아래로 회전 하 고 30 분 동안 실 온에서 품 어.
  2. 비드 정리 후 최종 수리 및 인 산화
    1. 4 ℃ 냉장고에서 20% 말뚝/1 M NaCl 자석 구슬 솔루션 및 30% 못/1 M NaCl 솔루션을 검색 하 고 적어도 30 분 동안 실 온에서 품 어.
      참고: 30% 못/1 M NaCl 솔루션 하지 않습니다 자석 구슬 포함.
    2. 두 솔루션 모두 실내 온도 도달, 후 각 샘플에 대 한 30% 못/1 M NaCl 및 20% 말뚝/1 M NaCl 자석 구슬 솔루션의 1:2 혼합의 80 µ L를 준비 합니다. 24 샘플 예: 24 = 1920 x 80 µ L µ L (640 µ L 30%의 말뚝/1 M NaCl 및 20% 말뚝/1 M NaCl 자석 구슬 솔루션의 1,288 µ L).
    3. Aliquot 구슬 솔루션 혼합, 같은 볼륨, 저수지 96 잘 접시의 한 행으로 하 고 실내 온도에서 보관. Aliquot EB 버퍼 (40 µ L 샘플 당 행의 # x) 저수지 깨끗 한 96 잘 접시의 한 행에. 두 개의 행에 대 한 예: 40 µ L x 2 = 80 µ L/잘.
    4. 멀티 채널 피 펫을 사용 하 여 추가 준비 구슬 믹스의 75 µ L 단계의 4.1.7 4.2.2 샘플의 각 행에 단계 10 번 아래로 혼합. 팁 행 사이 변경 합니다. 3.3.3-3.3.10 단계에에서 설명 된 대로 15 분 계속 구슬 정리 절차에 대 한 실 온에서 품 어. 플라스틱 도장, 빠른 회전 플레이트 커버 하 고 얼음에 그것을 배치. 4.3 단계로 진행 합니다.
  3. A-미행 반응
    1. A 미행 반응 (표 7)에 필요한 모든 시 약 (효소)를 제외 하 고는-20 ° C 냉동 고에서 가져옵니다, 그리고 실 온에서 녹여 다음 얼음을 즉시 전송 합니다.
    2. 얼음에 working, 표 7 살 균, 1.5 mL microcentrifuge 튜브에서 A 미행 마스터 믹스를 설정 하려면 따릅니다. 4.1.4-4.1.6 단계에에서 설명 된 대로 일반 효소 brew 설치 지침을 따릅니다.
    3. 멀티 채널 피 펫을 사용 하 여, 샘플의 각 행에 A-미행 마스터 믹스의 15 µ L을 추가 하 고 아래로 pipetting으로 10 번을 혼합. 팁 행 사이 변경 합니다. PCR 커버 플레이트를 봉인, 4 ° C에서 1 분 동안 200 x g에 아래로 회전 하 고 30 분 동안 37 ° C에서 thermocycler에서 품 어. 부 화 후 1 분 동안 200 x g에서 내려 접시를 회전 하 고 실 온에서 보관 합니다.
  4. 비드 정리 후 A-미행
    1. 4.2 단계에서 설명 하는 단계를 수행 합니다. 플라스틱 도장, 라벨 "A 꼬리 + BC", 빠른 회전, 플레이트 커버 하 고 얼음에 그것을 배치. 4.5 단계로 진행 합니다.
  5. 어댑터 결 찰
    1. 어댑터 결 찰 반응 (표 8)에 대 한 필요한 모든 시 약 (효소)를 제외 하 고는-20 ° C 냉동 고에서 가져옵니다, 그리고 실 온에서 녹여 다음 얼음을 즉시 전송 합니다.
    2. 10 µ M PE 어댑터 (보충 표 1) 재고 솔루션을 검색 하 고 희석 0.5 µ M EB를 사용 하 여. 펄스 vortexing에 의해 잘 혼합. 필요한 볼륨은 3 µ L의 샘플 # x. 작업을 얼음, aliquot 0.5 µ M PE 어댑터, 같은 볼륨, 96-잘 깨끗 한 저수지 판의 12 우물에. 얼음에 그것을 유지.
    3. 얼음에 working, 불 임, 1.5 mL microcentrifuge 튜브에서 어댑터 결 찰 마스터 믹스를 설정 하려면 테이블 8 따릅니다. 4.1.4-4.1.6 단계에에서 설명 된 대로 일반 효소 brew 설치 지침을 따릅니다. 5 X 빠른 결 찰 버퍼는 완전히 해 동 하 고 아주 잘 사용 하기 전에 혼합 다는 것을 확인 하십시오.
    4. 에 얼음, 약 수는 적절 한 양의 새로운 저수지 96 잘 접시의 한 행으로 어댑터 결 찰 마스터 믹스. 예를 들어 두 개의 행에 대 한 계산: (23 µ L x 2) + 5 µ L = 51 µ L/잘. 얼음에 플레이트를 유지.
    5. 0.5 µ M의 2 µ L 추가 멀티 채널 피 펫을 사용 하 여 샘플 단계 4.4.1 믹스에서의 각 행에 끝 결합 (PE) 어댑터. 팁 행 사이 변경 합니다.
    6. 멀티 채널 피 펫을 사용 하 여, 샘플의 각 행에 어댑터 결 찰 마스터 믹스의 23 µ L을 추가 하 고 아래로 pipetting으로 15 번을 혼합. 팁 행 사이 변경 합니다. 레이블 "결 찰", 4 ° C에서 1 분 동안 200 x g에 아래로 회전 금속 덮개를 가진 격판덮개를 봉인 하 고 하룻밤 실 온에서 품 어.
  6. 제 4 일: 비드 정리 #1 어댑터 결 찰 후
    1. 4 ℃ 냉장고에서 20% 말뚝/1 M NaCl 자석 구슬 솔루션을 검색 하 고 적어도 30 분 동안 실 온에서 품 어. 솔루션 평형 하는 동안 준비 신선한 70 %EtOH.
    2. 약 20% 말뚝/1 M NaCl 자석 구슬 솔루션 수, 96-잘 저수지의 한 행으로 샘플 당 55 µ L 플레이트 및 실내 온도에서 보관. 두 개의 행에 대 한 예: 2 = 110 x 55 µ L µ L/잘.
    3. Aliquot EB 버퍼, 96-잘 깨끗 한 저수지 접시의 한 행으로 샘플 당 50 µ L. 두 개의 행에 대 한 예: 50 µ L x 2 = 100 µ L/잘.
    4. 멀티 채널 피 펫을 사용 하 여 단계의 4.5.6 결 찰 판에 샘플의 각 행에 20% 말뚝/1 M NaCl 자석 구슬 솔루션의 48 µ L을 추가 하 고 10 배 아래로 혼합. 팁 행 사이 변경 합니다. 3.3.3-3.3.7 단계에에서 설명 된 대로 15 분 계속 구슬 정리 절차에 대 한 실 온에서 품 어.
    5. 플레이트 자석 및 멀티 채널 피 펫을 사용 하 여 접시를 받아 45 µ L EB (자료 테이블)를 추가 합니다. 10 배를 아래로 pipetting으로 잘 섞는다. 팁 행 사이 변경 합니다. 3 분 elute 실내 온도에 대 한 품 어.
    6. 부 화, 후 IP 반응 접시 접시 자석에 다시 배치 구슬 방해 없이 멀티 채널 피 펫을 사용 하 여 2 분에 대 한 품 어, 신중 하 게 새로운 96 잘 접시의 해당 우물에는 상쾌한 전송. "결 찰 + 1 BC" 접시를 레이블을 지정 합니다.
    7. 각 잘 하 10 x PCR 고화질 버퍼의 5 µ L을 추가 하 고 아래로 pipetting으로 잘 혼합. 팁 행 사이 변경 합니다. 플라스틱 도장, 빠른 회전, 플레이트 커버 하 고 실내 온도에서 보관.
  7. 비드 정리 #2 어댑터 결 찰 후
    1. 다음 변경 4.6 섹션에 설명 된 대로 비드 정리 수행: 각 활성 잘 결 찰 + 1 기원전 플레이트 (단계 4.6.7)에서 20% 말뚝/1 M NaCl 자석 구슬 솔루션의 60 µ L을 추가 하 고 EB 버퍼의 35 µ L를 사용 하 여 구슬에서 elute. "결 찰 + 2 BC" 접시를 레이블 하 고 얼음에 그것을 유지.
  8. PCR 증폭
    1. -20 ° C 냉동 고에서 모든 고 시 약 (효소)를 제외 하 고 PCR 반응 (표 9)에 필요한를 가져옵니다, 그리고 그들을 실 온에서 해 동 후 즉시 얼음에 그들을 배치.
    2. 얼음에 working, 불 임, 1.5 mL microcentrifuge 튜브에 PCR 마스터 믹스를 설정 하려면 테이블 9 따릅니다. 4.1.4-4.1.5 단계에에서 설명 된 대로 일반 brew 설정 지침을 따르십시오. 에 얼음, 약 수는 적절 한 양의 새로운 저수지 96 잘 접시의 한 행으로 PCR 주인 혼합. 얼음에 그것을 유지. 4.5.4 샘플 계산에 대 한 단계를 참조 하십시오.
    3. 멀티 채널 피 펫을 사용 하 여 얼음에서 작업 각 고유 12.5 µ M PCR 뇌관 (보충 표 2)에 결 찰에 각 잘 + 2 BC 플레이트 (단계 4.7.1) 인덱싱 역방향의 2 µ L을 추가 하 고 위아래로 천천히 섞어. 팁 행 사이 변경 합니다. 얼음에 플레이트를 유지.
    4. 멀티 채널 피 펫을 사용 하 여 얼음에 작업 추가 샘플의 각 행에 마스터 PCR 혼합의 23 µ L 단계 4.8.3 믹스에서 10 배 아래로 pipetting으로. PCR 커버 플레이트를 봉인, 1 분, 200 x g에서 스핀 다운 및는 thermocycler에서 품 어 (PCR 순환 조건 표 10 참조).
  9. 비드 정리 PCR 증폭 후
    1. PCR 확대 후 1 분, 4 ° c.에 대 한 200 x g에서 접시를 회전 다음 변경 4.6 섹션에 설명 된 대로 구슬 정리 수행: 각 PCR 반응에 20% 말뚝/1 M NaCl 자석 구슬 솔루션의 51 µ L을 추가 하 고 EB 버퍼의 25 µ L를 사용 하 여 구슬에서 elute. 알루미늄 커버 플레이트 및 스핀 다운 200 x g에서 1 분 저장소-20 ° c.에 샘플
    2. 생성 된 라이브러리의 유효성을 검사 하려면 형광 기반 분석 결과 사용 하 여 DNA 정량화를 수행, 칩-기반 모 세관 전기 이동 법 분석기 (높은 감도 분석 결과)를 사용 하 여 최종 제품을 시각화 하 고 농축을 실행 정량 PCR (정량) (참조 대표 결과, ndChIP-seq 라이브러리 품질 정량 유효성 검사).

Representative Results

Chromatin 소화 프로필
MNase 소화의 최적화는이 프로토콜의 성공을 위해 필수적 이다. 그것은 중요 한 소화 프로필 단일 nucleosome 조각 크기에 의해 지배를 생성 하는 동안 하지-소화, 더 높은 순서 nucleosome 파편의 복구에 대 한 허용. 이상적인 소화 프로필 극히 작고 단일 nucleosomes 보다 더 큰 조각을 나타내는 단일 nucleosome 파편의 대부분 이루어져 있습니다. 그림 1 이상적인,-소화-소화 크기 배포 프로 파일의 예를 보여줍니다. Chromatin의 최적의 소화 또한 것입니다 IP 자료 (그림 2)에서 생성 된 시퀀싱 라이브러리의 프로필에 명백한 참고.

NdChIP-seq 라이브러리 품질 정량의 유효성 검사
정량은 칩18,,1920의 품질 평가 대 한 기초가 튼튼한 방법입니다. 때에 핵 산의 수익률 세포 10000에 ndChIP-seq를 수행 후 IP 1 ng. 따라서, 배경 위에 대상 영역의 상대 농축을 평가 하기 위해 도서관 건설 후 정량 Pcr을 수행 필수적 이다. 배경 추정을 제공 하려면 MNase 소화 chromatin (입력)에서 생성 하는 라이브러리 생성 됩니다. 각 IP 라이브러리 (일반적으로 사용 되 히스톤 부호를 위한 뇌관의 목록에 대 한 Supplemental표 3 참조) 뇌관의 2 세트 필요 합니다. 한 뇌관 세트는 일관 되 게 관심 (긍정적인 대상)의 히스톤 수정에 연관 된 게놈 지역 및 관심 (제외 대상)의 히스톤 수정 표시 되지 않은 다른 영역에 대 한 특정 해야 합니다. 칩 seq 라이브러리의 품질 입력된 라이브러리 관련 농축을 접어로 부과 됩니다. 배 농축 대상 게놈 영역의 지 수 증폭을 가정 하는 다음 수식을 사용 하 여 산출 될 수 있다: 2Ct입력-CtIP. 우리의 사용자 정의 R 통계 소프트웨어 패키지, qcQpcr_v1.2는 낮은 입력된 기본 칩 seq 라이브러리 (추가 코드 파일)의 정량 농축 분석에 적합. 그림 3 은 성공과 실패 칩 seq 라이브러리에 대 한 정량 결과를 나타냅니다. 좋은 품질 ndChIP-seq 라이브러리에 대 한 최소 예상된 배 농축 값은 H3K4me3, 및 광범위 한 표시, 예를 들어 H3K27me3에 대 한 7 처럼 좁은 부호에 대 한 16.

MNase 접근을 모델링
칩 seq의 전산 분석은 복잡 하 고 각 실험 설정에 대 한 고유의. 국제 인간 Epigenomic 컨소시엄 (IHEC)와 백과 사전의 DNA 요소 (인코딩)에 의해 설립 지침 서의 세트는 칩 seq 라이브러리21의 품질을 평가 하기 위해 사용할 수 있습니다. 그것은 라이브러리의 시퀀싱 깊이 탐지 및 풍부한 지역20의 해상도 영향을 주의 하는 것이 중요입니다. 봉우리의 수 증가 감지 하 고 읽기 깊이 증가 함에 따라 대 지에 접근. NdChIP-seq 라이브러리 좁은 표시 (, H3K4me3)의 50 백만 쌍 읽기 (25 백만 조각)의 IHEC 권고에 따라 시퀀스를 권장 및 100 백만 쌍-읽기 (50 백만 조각) 광범위 한 마크 ( 에 대 한 예를 들어, H3K27me3)와22를 입력. 이 시퀀싱 깊이 채도23,24에 도달 하지 않고 칩 seq 피크 호출자, 호머, MACS2 등을 사용 하는 광범위 하 게 사용 하 여 가장 중요 한 봉우리의 검출에 대 한 충분 한 시퀀스 정렬 제공 합니다. 높은 품질 포유류 ndChIP-seq 라이브러리의 PCR 중복 속도는 < > 90% (를 포함 하 여 중복된 읽기)의 10% 및 참조 게놈 정렬 속도. 성공적인 ndChIP-seq 라이브러리 정렬된 읽기 MACS222 식별 내 농축 봉우리의 상당 부분 (> 40%)와 높은 상관된 복제 포함 됩니다 및 게놈 브라우저에 정렬 된 읽기의 검사는 시각적으로 계시 해야 한다 입력된 라이브러리 (그림 4)에 비해 감지 풍부. 또한, ndChIP-seq nucleosome 밀도 가우스 혼합물 분배 알고리즘을 이용 하 여 평가 하기 위해 사용할 수 있습니다 (w1 * n(x; Μ 1,σ1) + w2 * n(x; μ2, σ2) = 1) MNase 액세스할 수 경계에 의해 정의 된 대로 식별 모델 nucleosome 밀도에 풍부한 영역을 MACS2에서. 이 모델 w1 모노 nucleosome 배포 무게 나타내고 w2 디 nucleosome 배포 무게를 나타냅니다. W1 은 w2보다 큰, 지배 모노 nucleosome 파편 그리고 그 반대도 있다. 이 분석 조각 크기를 정의할 수 있도록 라이브러리 쌍 엔드 패션에 시퀀싱 할 필요 합니다. 가우스 혼합물 분배 알고리즘을 적용, 통계적으로 중요 한 풍부한 지역 먼저 식별 됩니다. MACS2와 함께 사용 하 여 입력 컨트롤을 기본 설정으로 좁은 마크와 광범위 한 마크 0.01의 q 값 구분에 대 한 피크 전화를 하시기 바랍니다. 가우스 혼합물 분배 알고리즘을 고용 통계 패키지 수 널리 사용 되는 통계 소프트웨어 패키지에서 사용할 수 있습니다. 평균 조각 크기, 결정을 활용 하 여 IPed 샘플의 쌍 간 읽기 경계로 MACS2에서 배포판 식별 농축된 발기인 및 가우스 혼합물 분배 알고리즘 연구-통계 패키지를 사용 하 여 각 발기인에 적용할 수 있습니다. Mclust 버전 3.025 가중치 분포를 계산 하. 이 응용 프로그램에서는이 임계값 결과 무게 견적 될 신뢰할 수 있기 때문에 30 정렬 된 파편을 포함 하는 발기인을 제거 하는 것이 좋습니다. 좋은 품질 ndChIP-seq 라이브러리 평균값에 해당 하는 모노-디 nucleosome 조각 길이와 두 개의 주요 구성 요소로 구성 된 가우스 혼합 분포를 생성 합니다.

Figure 1
그림 1 : 라이브러리 생성 하기 전에 MNase 소화의 평가. 최적의 MNase의 칩 기반 모 세관 전기 이동 법 분석기 프로필 소화 (A), (B), 소화에서-및-(C) chromatin 소화. 생물 복제, 빨간색, 파란색과 녹색 추적으로 표시 됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2 : 라이브러리 생성 후 MNase 소화의 평가. (A) 최적의 소화 입력의 도서관 건설 프로필을 게시 (생물 복제, 빨강, 녹색, 검은색) 및 IP (생물 복제, 청록색, 보라색, 파란색) 및 (B) 최적의 입력 (생물 복제, 빨강, 녹색, 파랑) 및 IP ( 생물 복제; 청록색, 보라색, 주황색) 라이브러리입니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3 : 게시할 라이브러리 건설 정량 PCR ndChIP-seq 라이브러리의 품질을 평가 하기 위해 사용할 수 있습니다. H3K4me3 IP 입력된 라이브러리 관련 라이브러리의 배 농축 2로 계산 됩니다(입력-Ct Ct의 IP) qcQpcr_v1.2를 사용 하 여 긍정적이 고 부정적인 대상에 대 한. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4 : 10000 기본 CD34에서 건설 대표 ndChIP-seq 라이브러리+ 코드 혈액 세포. 피어슨 상관 관계 H3K4me3 신호 (백만 매핑된 읽기 당 읽기) 3 생물 복제, 1, 2, (B) (A) 복제 사이 발기인 (2 Kb + TSS)에서 계산의 1, 3, 2 및 3 (C) 복제 복제 합니다. (D) UCSC 브라우저 보기 복사해올된 칩 seq의 HOXA 유전자 클러스터의 IP, IP 당 10, 000 셀에서 성공적인 ndChIP-seq 및 실패 ndChIP-seq IP 당 10, 000에서 1 백만 세포에서 생성 됩니다. (빨간색: H3K27me3, 그린: H3K4me3, 검정: 입력). MACS2 내에서 매핑된 읽기 (E) 분수 (검정) H3K4me3 및 H3K27me3 (회색)의 풍부한 영역 식별. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

버퍼 구성
A.1. Immunoprecipitation 버퍼 (IP)
20 mM Tris HCl pH 7.5
2 mM EDTA
150 mM NaCl
0.1% 트라이 톤 X-100
0.1 %Deoxycholate
10 m m 나트륨 낙 산 염
A.2입니다. 낮은 소금 워시 버퍼
20 mM Tris HCl pH 8.0
2 mM EDTA
150 mM NaCl
1% 트라이 톤 X-100
0.1% SDS
A.3입니다. 높은 소금 워시 버퍼
20 mM Tris HCl pH 8.0
2 mM EDTA
500 mM NaCl
1% 트라이 톤 X-100
0.1% SDS
A.4. 칩 차입 버퍼
100 mM NaHCO3
1% SDS
A.5. 세포의 용 해 버퍼-1 mL x 1
0.1% 트리톤
0.1 %Deoxycholate
10 m m 나트륨 낙 산 염
A.6입니다. Ab 희석 버퍼
0.05% (w/v) 아 지 드
0.05% 광범위 항균 (예: ProClin 300)
PBS에서
A.7. 30% 못/1 M NaCl 자석 구슬 솔루션 (기준16)
30% 말뚝
1 M NaCl
10 mM Tris HCl pH 7.5
1 mM EDTA
씻어 초 상자성 구슬의 1 mL
A.8. 20% 말뚝/1 M NaCl 자석 구슬 솔루션 (기준16)
30% 말뚝
1 M NaCl
10 mM Tris HCl pH 7.5
1 mM EDTA
씻어 초 상자성 구슬의 1 mL

표 1: ndChIP-seq 버퍼 구성입니다.

히스톤 수정 농도 (µ g / µ L)
H3K4me3 0.125
H3K4me1 0.25
H3K27me3 0.125
H3K9me3 0.125
H3K36me3 0.125
H3K27ac 0.125

표 2: 항 체 금액 ndChIP이 필요한

Reganet 볼륨 (µ L)
울트라 순수 물 478
1 M Tris HCl pH 7.5 10
0.5 M EDTA 10
5 M NaCl 2
글리세롤 500
총 볼륨 1000

표 3: MNase 희석 버퍼에 대 한 제조 법입니다.

시 약 볼륨 (µ L)
울트라 순수 물 13
20 mM DTT 1
MNase 버퍼 x 10 4
20 U / µ l Mnase 2
총 볼륨 20

표 4: MNase 마스터 믹스에 대 한 제조 법입니다.

시 약 볼륨 (µ L)
차입 버퍼 30
버퍼 G2 8
프로 테아 제 2
총 볼륨 40

표 5: DNA 정화 마스터 믹스에 대 한 제조 법.

시 약 볼륨 (µ L)
울트라 순수 물 3.3
금지 Endonuclease 버퍼 (예: NEBuffer) x 10 5
25mm ATP 2
10mm dNTPs 2
T4 Polynucleotide 키 니 아 제 (10 U / µ l) 1
T4 DNA 중 합 효소 (3 U / µ l) 1.5
Dna 중 합 효소 I, 대형 (Klenow) 조각 (5 U / µ l) 0.2
총 볼륨 15

표 6: 최종 복구 마스터 믹스에 대 한 제조 법.

시 약 볼륨 (µ L)
울트라 순수 물 8
금지 Endonuclease 버퍼 (예: NEBuffer) x 10 5
10mm dATP 1
Klenow (3'-5' 엑 소-) 1
총 볼륨 15

표 7: A-미행 마스터 믹스에 대 한 제조 법.

시 약 볼륨 (µ L)
울트라 순수 물 4.3
5 배 빠른 결 찰 버퍼 12
T4 DNA 리가 (2000 U / µ l) 6.7
총 볼륨 23

표 8: 어댑터 결 찰 마스터 믹스에 대 한 제조 법.

시 약 볼륨 (µ L)
울트라 순수 물 7
25 uM PCR 뇌관 1.0 2
HF 버퍼 x 5 12
DMSO 1.5
DNA 중 합 효소 0.5
총 볼륨 23

표 9: PCR 주인 혼합에 대 한 제조 법입니다.

체 (° C) 기간 (s) 사이클 수
98 60 1
98 30
65 15 10
72 15
72 300 1
4 보류 보류

표 10: PCR 메서드를 실행 합니다.

올리고 시퀀스 수정
PE_adapter 1 5'-/ 5Phos/GAT CGG 아 그 AGC GGT TCA GCA GGA ATG CCG AG-3 ' 5' 수정: 인 산화
PE_adapter 2 5'-ACA CTC TTT CCC 전술 ACG ACG CTC TTC CGA TC * T-3' 3' 수정: * T는 phosphorothioate 본드

PE 어댑터의 세대에 대 한 보충 표 1: 올리고 시퀀스.

뇌관 이름 시퀀스 인덱스 IndexRevC (연속 사용)를
PCR 역 인덱싱 뇌관 1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGTGAT atcacg
PCR 역 인덱싱 뇌관 2 CAAGCAGAAGACGGCATACGAGATCTGATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGATC gatcag
PCR 역 인덱싱 뇌관 3 CAAGCAGAAGACGGCATACGAGATGGGGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGGGTT aacccc
PCR 역 인덱싱 뇌관 4 CAAGCAGAAGACGGCATACGAGATCTGGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGGGT acccag
PCR 역 인덱싱 뇌관 5 CAAGCAGAAGACGGCATACGAGATAGCGCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCGCT agcgct
PCR 역 인덱싱 뇌관 6 CAAGCAGAAGACGGCATACGAGATCTTTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTTTTG caaaag
PCR 역 인덱싱 뇌관 7 CAAGCAGAAGACGGCATACGAGATTGTTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGTTGG ccaaca
PCR 역 인덱싱 뇌관 8 CAAGCAGAAGACGGCATACGAGATAGCTAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCTAG ctagct
PCR 역 인덱싱 입문서 9 CAAGCAGAAGACGGCATACGAGATAGCATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCATC gatgct
PCR 역 인덱싱 뇌관 10 CAAGCAGAAGACGGCATACGAGATCGATTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGATTA taatcg
PCR 역 인덱싱 뇌관 11 CAAGCAGAAGACGGCATACGAGATCATTCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CATTCA tgaatg
PCR 역 인덱싱 뇌관 12 CAAGCAGAAGACGGCATACGAGATGGAACTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGAACT agttcc
PCR 역 인덱싱 뇌관 13 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ACATCG cgatgt
PCR 역 인덱싱 뇌관 14 CAAGCAGAAGACGGCATACGAGATAAGCTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AAGCTA tagctt
PCR 역 인덱싱 뇌관 15 CAAGCAGAAGACGGCATACGAGATCAAGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CAAGTT aacttg
PCR 역 인덱싱 뇌관 16 CAAGCAGAAGACGGCATACGAGATGCCGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCCGGT accggc
PCR 역 인덱싱 뇌관 17 CAAGCAGAAGACGGCATACGAGATCGGCCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGGCCT aggccg
PCR 역 인덱싱 뇌관 18 CAAGCAGAAGACGGCATACGAGATTAGTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TAGTTG caacta
PCR 역 인덱싱 뇌관 19 CAAGCAGAAGACGGCATACGAGATGCGTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCGTGG ccacgc
PCR 역 인덱싱 뇌관 20 CAAGCAGAAGACGGCATACGAGATGTATAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GTATAG ctatac
PCR 역 인덱싱 뇌관 21 CAAGCAGAAGACGGCATACGAGATCCTTGCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CCTTGC gcaagg
PCR 역 인덱싱 뇌관 22 CAAGCAGAAGACGGCATACGAGATGCTGTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCTGTA tacagc
PCR 역 인덱싱 뇌관 23 CAAGCAGAAGACGGCATACGAGATATGGCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ATGGCA tgccat
PCR 역 인덱싱 입문서 24 CAAGCAGAAGACGGCATACGAGATTGACATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGACAT atgtca

추가 표 2: PCR 뇌관 시퀀스를 인덱싱 반전.

뇌관 시퀀스
ZNF333_genic_H3K9me3_F 5'-AGCCTTCAATCAGCCATCATCCCT-3'
ZNF333_genic_H3K9me3_R 5'-TCTGGTATGGGTTCGCAGATGTGT-3'
HOXA9-10_F 5'-ACTGAAGTAATGAAGGCAGTGTCGT-3'
HOXA9-10_R 5'-GCAGCAYCAGAACTGGTCGGTG-3'
GAPDH_genic_H3K36me3_F 5'-AGGCAACTAGGATGGTGTGG-3'
GAPDH_genic_H3K36me3_R 5'-TTGATTTTGGAGGGATCTCG-3'
GAPDH F 5'-TACTAGCGGTTTTACGGGCG-3'
GAPDH-R 5'-TCGAACAGGAGGAGCAGAGAGCGA-3'
히스톤 수정 긍정적인 대상 제외 대상
H3K4me3 GAPDH HOXA9-10
H3K4me1 GAPDH_genic ZNF333
H3K27me3 HOXA9-10 ZNF333
H3K27ac GAPDH ZNF333
H3K9me3 ZNF333 HOXA9-10
H3K36me3 GAPDH_genic ZNF333

추가 표 3: 일반적으로 사용 되 히스톤 부호 (H3K4me3, H3K4me1, H3K27me3, H3K27ac, H3K9me3, 및 H3K36me3)를 위한 뇌관의 목록입니다.

보충 파일 1: ndChIP-seq 워크시트. 이 파일을 다운로드 하려면 여기를 클릭 하십시오.

추가 코드 파일: qcQpcr_v1.2. 낮은 입력된 기본 칩 seq 라이브러리의 정량 농축 분석에 대 한 R 통계 소프트웨어 패키지. 이 파일을 다운로드 하려면 여기를 클릭 하십시오.

Discussion

Chromatin 수정 및 transcriptional 규칙에서 위치 하는 nucleosome의 조합 성격을 감안할 때, 이러한 기능의 동시 측정 하는 방법 후 성적인 규정에 새로운 통찰력을 제공 것입니다. 여기에 제시 된 ndChIP-seq 프로토콜은 히스톤 수정 및 드문 1 차 셀9,10nucleosome 밀도 동시 심문 수 있도록 최적화 된 네이티브 칩 seq 프로토콜이입니다. ndChIP-seq 활용 chromatin의 효소 소화, 쌍 간 대규모 병렬 시퀀싱 및 가우스 혼합 배포 모델을 사용할 경우, 단일 nucleosome 수준 조사 히스톤 수정에 대 한 수 고는 deconvolution epigenomic 프로필 인구 내에서 성분에 의해 구동. 이 프로토콜을 사용 하 여, 우리 이전 면역을 시 켰 던 조각 크기, 쌍 간 경계, ChromHMM10,24에 의해 정의 된 특정 chromatin 상태와 관련 된 읽기에 의해 결정의 독특한 분포를 보고 있다.

NdChIP-seq 도서관의 질 항 체 특이성, 감도, 최적의 MNase 소화 조건, 및는 chromatin의 품질 등 여러 요인에 따라 달라 집니다. 사용 하는 항 체의 특이성은 성공적인 ndChIP-seq 라이브러리 생성에서 결정적 이다. 이상적인 항 체 다른 epitopes와 작은 교차 반응성으로 관심의 피토 프에 대 한 높은 선호도 보여줍니다. 그것은 동등 하 게 자석 구슬 선택의 항 체에 대 한 높은 선호도 선택 하는 것이 중요입니다.

MNase 소화가이 프로토콜에 중요 하 고 시간 및 농도 민감한 반응입니다. 따라서, 여러 개의 샘플을 처리할 때 그것은 중요 한 시간의 상응 하는 금액에 대 한 각 반응에 대 한 알을 품는 (단계 2.2 참조). chromatin의 품질이 크게 ndChIP이 Fragmented chromatin 리드 낮은 신호 대 잡음 비와 최적의 MNase 소화 프로필 및 라이브러리에서 결과의 결과 초래 하는 또 다른 요인은. 낮은 기본 샘플 세포 생존 능력 또는 염색 질, 타락 한 같은 포 르 말린 고정 파라핀 포함 (FFPE) 조직이이 프로토콜에 대 한 권장 하지 않습니다.

Chromatin 추출 하는 동안 그림의 추가 감소 (, 무작위) chromatin 조각화 및 보존의 무결성 히스톤 꼬리를 바라지 않는. 따라서, 그림 사용 하 여 세포의 용 해 버퍼와 그냥 이전 immunoprecipitation 버퍼에 추가 해야 합니다. Cytometry 통해 선택 셀 가능한 셀을 선택 하 고 확인 하는 동안 셀 셀 번호 추정의 정확성과 세포의 생존 능력을 증가 하는 낮은 흐름 율에 정렬 됩니다. 세포 세포의 용 해 버퍼에 직접 정렬 하지 마십시오. 칼 집 버퍼 세포의 용 해 버퍼를 희석 하 고 세포 막의 효과적인 permeabilization MNase를 방지. 셀 또는 유기 체의 종류에 따라 적정 MNase의 최적의 소화를 얻기 위해 필요할 수 있습니다.

ndChIP-seq 포유류 세포에 광범위 한 표시 및 입력에 대 한 좁은 표시 및 100 백만 쌍 읽기 (50 백만 조각) 50 백만 쌍 읽기 (25 백만 조각)의 최소 시퀀싱 깊이 필요합니다. 가우스 혼합물 분배 알고리즘 라이브러리가이 추천 아래 크게 깊이 시퀀스에 최적으로 수행 되지 않습니다. ndChIP-seq는 모노 또는 디 nucleosome 지배 발기인으로 모노 및 디 nucleosome 조각 길이 대 한 가중치 분포 값 간의 구분이 약간 발기인 분류 하지 것입니다. 따라서, 이러한 발기인 이후 분석에서 제거 되어야 합니다. 생물 복제 예측된 배포판에 대 한 자신감을 증가 하 고 MNase 소화 및 도서관 건설에서 기술 변화를 식별을 생성할 수 있습니다.

네이티브 칩 seq 프로토콜의 이전 반복, 달리 ndChIP-seq nucleosome 밀도, 통합 조각 크기 게시물 immunoprecipitation를 이용 하 여 염색 질 구조와 히스톤 수정의 조합 효과 조사 하는 수단 제공 MNase 접근성, 히스톤 수정 측정에 의해 결정. NdChIP-seq의 응용 프로그램 기본 세포와 조직에 epigenetic 규제의 통합 특성에 새로운 통찰력을 제공 하 고 인구 내의 성분으로 인해 후 서명 식별을 허용.

Disclosures

저자 들은 아무 경쟁 금융 관심사 선언 합니다.

Acknowledgements

앨 러 배 마 건강 연구의 캐나다 학회에서 캐나다 대학원 장학금에 의해 지원 되었다. 이 작품은 게놈 브리티시 컬럼비아 및 캐나다 연구소의 건강 연구 (CIHR-120589) 캐나다 Epigenetics, 환경 및 건강 연구 컨소시엄 이니셔티브의 한 부분으로에서 교부 금에 의해 그리고 테리 폭스 연구 연구소 프로그램에 의해 지원 되었다 프로젝트 부여 #TFF-122869 수소와 수소에 테리 폭스 연구소 새로운 탐정 수상 (부여 # 1039)

Materials

Name Company Catalog Number Comments
1M Tris-HCl –pH 7.5 Thermo Scientific 15567-027
1M Tris-HCl –pH 8 Thermo Scientific 15568-025
0.5M EDTA Thermo Scientific AM9260G
5M NaCl Sigma 1001385276
Triton X-100 Sigma 1001412354
Sodium-Deoxycholate Sigma 1001437582
SDS Thermo Scientific 15525-017
Sodium-Bicarbonate Fisher Scientific S233-500
100% EtOH NA NA
V-bottom 96 well plate (AB 1400) Thermo Scientific AB-1400-L
Gilson P2 pipetman Mandel F144801
Gilson P10 pipetman Mandel F144802
Gilson P20 pipetman Mandel F123600
Gilson P100 pipetman Mandel F123615
Gilson P200 pipetman Mandel F123601
Gilson P1000 pipetman Mandel F123603
Micrococcal Nuclease  NEB M0247S
Thermo Mixer C (Heating block mixer) Eppendorf 5382000023
Multi 12-channel Pippet P20 Rainin 17013803
Multi 12-channel Pippet P200 Rainin 17013805
1.5 ml LoBind tube Eppendorf 22431021
0.5 ml LoBind tube Eppendorf 22431005
Plastic Plate Cover Edge Bio 48461
PCR cover Bio Rad MSD-1001
Aluminum Plate Cover Bio Rad MSF-1001
Elution buffer (EB buffer) Qiagen 19086
1M DTT Sigma 646563
Eppendorf 5810R centrifuge  Eppendorf 22625004
Ultrapure water Thermo Scientific 10977-015
Protein G dynabeads Thermo Scientific 10001D
Protein A dynabeads Thermo Scientific 10001D
Protease inhibitor Cocktail Calbiochem 539134
Rotating platform Mandel 1b109-12052010
Plate magnet Alpaqua 2523
Domed 12-cap strip Bio Rad TCS1201
Buffer G2 Qiagen 1014636
Protease Qiagen 19155
Tube Magnet (DynaMag-2) Thermo Scientific 12321D
Tube Magnet (DynaMag-2) LabCore 730-006
V shape Plastic reservoir Mandel S0100A
Vortex Mandel C1801
Mini Fuge Mettler Toledo XS2035
Analytical scale Mandel LB109-12052010
Quick Ligation Reaction Buffer, 5X NEB B6058S
DNA Polymerase I, Large (Klenow) Fragment NEB M0210S
Klenow Fragment (3'-5' exo) NEB M0212S
T4 DNA Polymerase NEB M0203S
T4 Polynucleotide Kinase NEB M0201S
Deoxynucleotide Solution mix, 10mM NEB N0447S
dATP Solution 10mM NEB N0440S
Quick T4 DNA Ligase NEB M0202T
Adenosine 5'-Triphosphate (ATP), 25mM NEB P0756S
DNA Polymerase Thermo Scientific F549L
NEBuffer 2 NEB B7002S
Hank's buffered salt solution Thermo Scientific 14025076
Fetal bovine serum  Thermo Scientific A3160702
phosphate buffer saline  Thermo Scientific 10010023
H3K4me3 Cell Signaling 9751S
H3K4me1 Diagenode C15410037
H3K27me3 Diagenode pAb-069-050
H3K36me3 Abcam ab9050
H3K9me3 Diagenode C15410056
SeraMag  super-paramagnetic beads

DOWNLOAD MATERIALS LIST

References

  1. Simpson, R. T. Nucleosome Positioning: Occurrence, Mechanisms, and Functional Consequences. Prog. Nucleic Acid Res. Mol. Biol. 40, Issue C 143-184 (1991).
  2. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundmamental particle of the eukaryotic chromosome. Cell. 98, 285-294 (1999).
  3. Schones, D. E., et al. Dynamic regulation of nucleosome positioning in the human genome. Cell. 132, (5), 887-898 (2008).
  4. Segal, E., et al. A genomic code for nucleosome positioning. Nature. 442, (7104), 772-778 (2006).
  5. Shiio, Y., Eisenman, R. N. Histone sumoylation is associated with transcriptional repression. PNAS. 100, (23), 13225-13230 (2003).
  6. Li, L., Lorzadeh, A., Hirst, M. Regulatory variation: An emerging vantage point for cancer biology. Wiley Interdiscip. Rev. Syst. Biol. Med. 6, (1), 37-59 (2014).
  7. Jiang, J., et al. Investigation of the acetylation mechanism by GCN5 histone acetyltransferase. PLoS ONE. 7, (5), (2012).
  8. Kouzarides, T. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12, (2), 198-209 (2002).
  9. Brind'Amour, J., Liu, S., Hudson, M., Chen, C., Karimi, M. M., Lorincz, M. C. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat. Commun. 6, 6033 (2015).
  10. Lorzadeh, A., et al. Nucleosome Density ChIP-Seq Identifies Distinct Chromatin Modification Signatures Associated with MNase Accessibility. Cell Rep. 17, (8), 2112-2124 (2016).
  11. Noll, M., Kornberg, R. D. Action of micrococcal nuclease on chromatin and the location of histone H1. J. Mol. Biol. 109, (3), 393-404 (1977).
  12. Skene, P. J., Henikoff, S. A simple method for generating high-resolution maps of genome wide protein binding. eLife. 4, 09225 (2015).
  13. Brogaard, K., Xi, L., Wang, J. -P., Widom, J. A map of nucleosome positions in yeast at base-pair resolution. Nature. (2012).
  14. Cui, K., Zhao, K. Genome-wide approaches to determining nucleosome occupancy in metazoans using MNase-Seq. Methods Mol. Biol. 833, 413-419 (2012).
  15. Mieczkowski, J., et al. MNase titration reveals differences between nucleosome occupancy and chromatin accessibility. Nat. Commun. 7, 11485 (2016).
  16. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). JOVE. (41), (2010).
  17. Rohland, N., Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, (5), 939-946 (2012).
  18. Zheng, Y., Josefowicz, S. Z., Kas, A., Chu, T. T., Gavin, M. A., Rudensky, A. Y. Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature. 445, (7130), 936-940 (2007).
  19. Krishnakumar, R., Gamble, M. J., Frizzell, K. M., Berrocal, J. G., Kininis, M., Kraus, W. L. Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes. Science. 319, (5864), 819-821 (2008).
  20. Mendenhall, E. M., et al. Locus-specific editing of histone modifications at endogenous enhancers. Nat. Biotechnol. 31, (12), 1133-1136 (2013).
  21. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  22. Reference Epigenome Standards - IHEC. Available from: http://ihec-epigenomes.org/research/reference-epigenome-standards/ (2017).
  23. Heinz, S., et al. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 38, (4), 576-589 (2010).
  24. Feng, J., Liu, T., Qin, B., Zhang, Y., Liu, X. S. Identifying ChIP-seq enrichment using MACS. Nat. Protoc. 7, (9), 1728-1740 (2012).
  25. Fraley, C., Raftery, A. E. MCLUST: Software for Model-Based Cluster Analysis. J. Classif. 16, (2), 297-306 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics