דור של כרומטין יליד Immunoprecipitation רצף ספריות לניתוח צפיפות נוקלאוזום

Genetics
 

Summary

אנו מציגים immunoprecipitation ששונה כרומטין יליד רצף (צ'יפ-seq) מתודולוגיה לדור של רצף datasets מתאים נוקלאוזום צפיפות שבב-seq מסגרת אנליטית שילוב נגישות נוקלאז micrococcal (MNase) עם מדידות שינוי היסטון.

Cite this Article

Copy Citation | Download Citations

Lorzadeh, A., Lopez Gutierrez, R., Jackson, L., Moksa, M., Hirst, M. Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis. J. Vis. Exp. (130), e56085, doi:10.3791/56085 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

אנו מציגים immunoprecipitation ששונה כרומטין מקורית של רצף (צ'יפ-seq) נסיוני תואם עם תערובת גאוסיאנית ההפצה מבוססת ניתוח מתודולוגיה (צפיפות נוקלאוזום שבב-seq; ndChIP-seq) המאפשר את הדור של מדידות משולב של נוקלאז micrococcal (MNase) נגישות עם שינוי היסטון הגנום כולו. נוקלאוזום עמדה צפיפות המקומי ואת השינוי posttranslational של subunits שלהם היסטון, לפעול בהופעה לווסת את הברית שעתוק מקומיים. מדידות קומבינטורית של נוקלאוזום נגישות עם שינוי היסטון שנוצר על ידי ndChIP-seq מאפשר החקירה בו זמנית של תכונות אלה. המתודולוגיה ndChIP-seq ישימה על מספר קטן של תאים ראשי נגיש cross-linking מבוסס שבב-seq פרוטוקולים. יחדיו, ndChIP-seq מאפשר מדידת שינוי היסטון בשילוב עם צפיפות נוקלאוזום מקומיים כדי להשיג תובנות משותפות מנגנונים המסדירים שעתוק RNA בתוך התא הראשי נדיר אוכלוסיות חדשות.

Introduction

הגנום האיקריוטים נארז לתוך כרומטין באמצעות חזרה על מבנים נוקלאוזום המורכבים של שני עותקים של חלבוני היסטון ארבע (למשל, H2A, ויזת עבודה H2B, H3 ו- H4) ומוקפת על ידי 146 זוגות הבסיס של ה-DNA1,2. כרומטין שיפוץ מכלולי שליטה נוקלאוזום מיקום בתוך גבולות יזם ג'ין, להשתתף ברגולציה של ביטוי גנים על ידי שינוי הנגישות של ה-DNA גורמי שעתוק, מכונות RNA פולימראז3, 4.

אמינו מסוף זנבות של שינויים היסטוניים בתוך נוקלאוזום. נתונים למגוון שינויים קוולנטיות, כולל acetylation, מתילציה, זרחון, ubiquitylation, sumoylation, formylation ו hydroxylation של חומצות אמינו ספציפיות5 , 6 , 7 , 8. תפקידים ודרגות לבצע שינויים אלה להכתיב מצב כרומטין המשפיעים על מבנה כרומטין וגישה שליטה של מתחמי מולקולרית לאפשר הפעלה של שעתוק7. בהתחשב בכך שינוי צפיפות, היסטון בשני נוקלאוזום לשחק תפקיד שליטה מקומית של שעתוק גנים, פיתחנו בגישה צ'יפ מקורי המאפשרת את המדידה בו זמנית של נוקלאוזום צפיפות ו- שינוי היסטון9, 10.

צ'יפ מקורי-seq מנצל נוקלאז micrococci endonuclease (MNase) לעכל כרומטין ללא פגע במצבו המקורי בתוך גרעין11,12, שאותו יש כבר ממונף למפות נוקלאוזום מיקום13 , 14 , 15. צפיפות נוקלאוזום שבב-seq (ndChIP-seq) מנצל המאפיין של גישה מועדף של MNase כדי לפתוח את מחוזות כרומטין ליצירת מדידות המשלבות MNase נגישות עם שינוי היסטון10. ndChIP-seq מתאים פרופיל בדבר שינוי היסטון נדיר ראשי תאים, רקמות, תאים בתרבית. כאן, אנו מציגים את פרוטוקול מפורט המאפשר את הדור של רצף datasets מתאים עבודה מסגרת אנליטית שתואר לעיל10 המשלבת פרגמנט גודל פוסט immunoprecipitation, נקבע על ידי לזווג-end להקריא את גבולות, במקביל לחקור MNase נגישות עם מדידות שינוי היסטון. בעבר, יישום של פרוטוקול זה על דם טבורי אנושי ראשוני 10,000 נגזר CD34+ תאים של תאי גזע עובריים חשף ייחודי קשרי הגומלין בין שינויים במבנה ואת היסטון כרומטין בתוך אלה תא סוגי10 . בהתחשב ביכולת למדוד בו זמנית נוקלאוזום נגישות והסבת היסטון, ndChIP-seq הוא מסוגל לחשוף epigenomic תכונות בקרב אוכלוסיה תא ברמה נוקלאוזום יחיד, ופתרון חתימות הטרוגנית לתוך שלהם היסודות המרכיבים. דוגמה של חקר אוכלוסיות הטרוגניות הסלולר על-ידי ndChIP-seq הוא חקירה של היזמים טרינארית, איפה הן H3K4me3, סימן פעיל H3K27me3, סימן הדיכוי, הן נוכח10.

Protocol

הערה: הקלט המינימלי עבור פרוטוקול זה הוא 10,000 תאים לכל תגובה חיסונית יחיד-משקעים (IP). להדפיס את גליון העבודה ניסיוני שסופקו ולנצל כקו מנחה כדי לתכנן הניסוי. Incubations בטמפרטורת החדר ההשעה ב ~ 22 ° c כולכם מהמתכונים מאגר ניתנים טבלה 1. כל של מאגרי צריך להיות מאוחסן ב 4 ° C, שמרה על קרח במהלך ההליך, אלא אם צוין אחרת.

1. תא הכנה

  1. תאים בתרבית
    1. לשטוף את התאים עם 1 מ ל תמיסת מאגר פוספט (PBS) ולקבוע באופן מדויק את הריכוז התא באמצעות hemocytometer. אם יש יותר ממיליון תאים, להגביר את עוצמת PBS.
    2. בהתבסס על ספירת, aliquot המקבילה של 70,000-100,000 תאים לתוך צינור mL 1.5 סטרילי, ספין למטה ב g x 500 דקות 6-4 מעלות צלזיוס. באמצעות פיפטה של, אט-אט להסיר למחוק את תגובת שיקוע (מבלי להפריע בגדר תא) ואת resuspend בגדר המאגר הקר פירוק + 1 x פרוטאז מעכב קוקטייל (PIC) ריכוז של 1,000 תאים / µL. מערבבים היטב על ידי pipetting למעלה ולמטה 20-30 פעמים. . זה קריטי תא גושים הם שיבשו לא לנסות ליצור בועות.
    3. להמשיך ישירות ל- 1 יום (סעיף 2) של הפרוטוקול ndChIP-seq או פלאש להקפיא בגדר תא חנקן נוזלי, חנות ב-80 מעלות צלזיוס.
  2. תאים ממוינים
    1. איסוף תאים ממוינים16 70,000-100,000 לתוך צינור 1.5 מ עם 350 µL של האנק במאגר תמיסת מלח (HBSS), או PBS + 2% סרום שור עוברית (FBS).
    2. ספין לאורך כל תא aliquot ב g x 500 דקות 6-4 מעלות צלזיוס. באמצעות פיפטה של, לאט להסיר את תגובת שיקוע (מבלי להפריע בגדר התא), resuspend המאגר הקר פירוק + 1 x PIC כדי ריכוז סופי של 1,000 תאים / µL. מערבבים היטב במאגר פירוק על-ידי pipetting למעלה ולמטה 20 - 30 פעמים. ודא כי כגיהנום תא הם שיבשו. לא לנסות ליצור בועות.
    3. להמשיך ישירות ל- 1 יום (סעיף 2) של הפרוטוקול ndChIP-seq, או פלאש להקפיא בגדר תא חנקן נוזלי, חנות ב-80 מעלות צלזיוס.

2. יום 1: ndChIP-seq

  1. הכנה של המתחם נוגדן-חרוז
    1. הכנת אמבט מים 37 ° C, דלי קרח. עבודה על קרח, להכין 1 x IP מאגר/1 x PIC 1 x נוגדנים (אלב) דילול מאגר, ולשמור אותם על קרח. לאחזר beads מגנטי חלבון A (או G) (ראה דיון על קריטריוני הבחירה) מתוך 4 ° C אחסון ולאחר לערבב היטב על-ידי הדופק עדין-vortexing. . לשמור את זה על קרח.
      הערה: דופק-vortexing פירושו vortexing מופסק בכל פעם נוצרת מערבולת מלא בצינור.
    2. העברת 24 µL של חלבון A (או G) beads מגנטי לפי התגובה IP לתוך צינור 2 מ"ל. להקליט בכמויות החרוזים ולשמור את הצינורית על קרח. לדוגמה, עבור 7 IPs, להשתמש µL 24 x 7 = 168 µL.
    3. מניחים את הצינורית על המגנט צינור ולחכות הפתרון להיות ברור ההפרדה חרוז אנלוגיים. מבלי להפריע את החרוזים, בזהירות להסיר את תגובת שיקוע באמצעות פיפטה ולמחוק. להשתמש ברכבת התחתית את המגנט צינור ומניחים אותו על קרח.
    4. הוסף אמצעי שווה (קרי, הנפח הראשוני של חרוזים) המאגר הקר IP + 1 x לערבב PIC. מערבבים על-ידי pipetting למעלה ולמטה. לא מערבולת.
    5. למקם את ה-IP מאגר + 1 x PIC + חרוזים בחזרה על המגנט צינור ולחכות הפתרון להיות ברור ההפרדה חרוז אנלוגיים. מבלי להפריע את החרוזים, בזהירות להסיר את תגובת שיקוע באמצעות פיפטה ולמחוק. חזור על מאגר IP קר + 1 X שטיפת PIC שניים יותר פעמים בסך הכל 3 מנקי.
    6. לאחר השטיפה הסופית resuspend את החרוזים אמצעי שווה (קרי, הנפח הראשוני של חרוזים) המאגר הקר IP + 1 x PIC לערבב. מערבבים על-ידי pipetting למעלה ולמטה. לא מערבולת. שמור את הצינורית על קרח.
    7. על קרח, למזוג 10 מ"ל של מאגר ה-IP + PIC לשמורה בצורת V 25 מ. בעזרת פיפטה רב-ערוצי, להוסיף µL 130 המאגר הקר IP + 1 x PIC לערבב לתוך בארות בודדים של V-התחתון 96-ובכן נקי צלחת. מילוי טוב לפי IP. לתייג את הצלחת כמו "מתחם Ab-חרוז".
    8. להוסיף 12 µL של חלבון A (או G) שטף מגנטי חרוזים לתוך כל טוב המכיל מאגר IP + PIC ומערבבים על ידי pipetting למעלה ולמטה. שמור את החרוזים שטף הנותרים על קרח.
    9. השג נוגדנים המאומת שלהם אחסון הקרה, הפשרה על קרח, אם נדרש. עבודה על קרח, לדלל את הנוגדנים עם 1 x Ab דילול מאגר ריכוזי שמוצג בטבלה 2.
    10. כדי כל טוב של צלחת מורכב Ab-חרוז, להוסיף 1 µL של הנוגדן המתאים, מדולל (טבלה 1). להקליט את הבאר מפתח נוגדנים. באמצעות פיפטה רב-ערוצי, מערבבים כל שורה על-ידי pipetting למעלה ולמטה 20 פעמים. לשנות טיפים בין שורות. לאטום את הצלחת מורכבים Ab-חרוז טוב מאוד עם כיסוי אלומיניום, דגירה ב 4 ° C על פלטפורמה מסתובבת כבר לפחות שעתיים.
      הערה: הדגירה הזה ניתן להמשיך עד מוכן להתחיל שלב 2.4.
  2. מערכת העיכול, פירוק של כרומטין, תא
    1. עבודה על קרח, להכין 1 x מאגר פירוק + 1 x PIC ו 1 מ"ל של MNase אני דילול מאגר (טבלה 3) ולשמור אותם על קרח.
    2. לאחזר את כדורי תא אחסון שלהם-80 ° C (או קרח, אם טריה). הפשרת כל גלולה תא באמבט מים 37 ° C 10 s, אז העברה לקרח.
    3. כדי כל גלולה תא מיד להוסיף קרח 1 x מאגר פירוק + 1 x PIC כדי ריכוז סופי של 10,000 תאים/20 µL, ומיקס 10 פעמים על ידי pipetting למעלה ולמטה, ללא יצירת בועות. לדוגמה, עבור 70,000 תאי האחסון הסופי הוא 140 µL.
    4. עובד על קרח, aliquot 20 µL/טוב של lysates שנוצר לתוך צלחת 96-ובכן. כיסוי לצלחת עם חותמת פלסטיק דגירה על קרח במשך 20 דקות תווית צלחת "MNase העיכול", להקליט את הבארות למפתח תבנית. על מנת להבטיח העיתוי המדויק של התגובה עיכול כרומטין, לא להמשיך העיכול עם יותר מ- 2 שורות של דגימות בכל פעם.
    5. בדיוק לפני פירוק 20 דקות השלמת, לדלל את MNase אני האנזים עם MNase אני דילול מאגר, כדי ריכוז סופי של 20 U/µL, ותשמור את זה על קרח.
    6. עבודה על קרח, להכין את MNase אני עיכול מאסטר תערובת על פי טבלה 4 ו- aliquot 20 µL של המיקס לכל שורה של דוגמאות בתוספת 5 נפח מת µL לתוך שורה אחת של צלחת 96-ובכן מאגר ולשמור אותו בקרח. עבור שתי שורות, אמצעי האחסון צריכה להיות: (20 µL x 2) + 5 µL = 45 µL.
    7. לאחר lysates הסיום המקננת, הסר את לוחית עיכול MNase של קרח. בעזרת פיפטה רב-ערוצי, להוסיף 20 µL של MNase אני עיכול מאסטר לערבב לתוך כל שורה של דוגמאות, ומערבבים 10 פעמים על-ידי pipetting למעלה ולמטה. לשנות טיפים בין שורות. דגירה בטמפרטורת החדר למשך 5 דקות בדיוק.
    8. לאחר 5 דקות, כדי לעצור את התגובה, השתמש פיפטה רב-ערוצי כדי להוסיף 6 µL של מיקרומטר 250 ethylenediaminetetraacetic חומצה (EDTA) לתוך כל שורה של דוגמאות ומערבבים למעלה ולמטה, כמה פעמים לשנות טיפים בין שורות. לאחר תוספת EDTA, לעבור את ההגדרה של פיפטה 20 µL ושילוב 10 פעמים על-ידי pipetting למעלה ולמטה כדי להבטיח עצירה מוחלטת של התגובה לעיכול. לשנות טיפים בין שורות.
    9. בעזרת פיפטה רב-ערוצי, כל שורה של MNase דגימות מעוכל, להוסיף 6 µL של 10 x פירוק מאגר, לערבב היטב על ידי pipetting למעלה ולמטה 10 פעמים. מכסה פלסטיק חותם, דגירה על קרח למשך 15 דקות.
  3. ניקוי קדם והגליונות קלט
    1. לאחר 15 דקות הדגירה, עובד על הקרח, בריכת בארות כל עבור אותו תא גלולה/תבנית אחת סטרילי, טרום מקורר על קרח, צינור 1.5 mL (המסומנות מראש עם מזהה תבנית) לערבב ביסודיות אבל לאט לאט בעזרת פיפטה כדי להימנע קצף דטרגנט.
    2. כל גלולה תא/תבנית, להעביר לילה µL 8 של כרומטין מתעכל לתוך חדש סטרילי, שפופרת 0.5 mL (המסומנות מראש עם מזהה תבנית), חנות ב 4 ° C. זה ישמש פקד קלט.
    3. להפיץ נפח הנותרים כרומטין מתעכל ב 48 µL aliquots, לתוך צלחת 96-ובכן חדשה. תא גלולה/תבנית 1 נכנס בארות A01-A06, תא גלולה/תבנית 2 נכנס בארות A07-A12, וכו '. לתעד את הבארות למפתח תבנית. תווית את הצלחת "טרום קרחת".
    4. באמצעות פיפטה רב-ערוצי, להוסיף 120 µL 1 x מאגר IP + 1 x PIC µL 12 של שטף beads מגנטי חלבון A (או G) לבאר כל צלחת טרום קרחת מהשלב 2.3.3. מערבבים כל שורה על-ידי pipetting למעלה ולמטה 10 פעמים. לשנות טיפים בין שורות. חותם את הצלחת היטב עם כיסוי אלומיניום, דגירה על פלטפורמה מסתובבת ב 4 מעלות צלזיוס למשך תקופה מינימלית של 2 h.
  4. תגובה Immunoprecipitation
    1. לפני תחילת שלב זה לוודא כי המשטח מורכב Ab-חרוז (שלב 2.1.10) וצלחת טרום קרחת (שלב 2.3.4) יש מתפשט כי לפחות 2 ה מהיר מסובבת צלחות הן על ידי צריך שתוציאו בשביל 10 s-200 x g.
    2. מניחים את הצלחת מורכבים של Ab-חרוז (מתוך שלב 2.1.10) על מגנט צלחת ולחכות 15 s עבור הפתרון להתבהר. בזהירות להסיר ולמחוק את תגובת שיקוע באמצעות פיפטה מבלי להפריע את החרוזים. הסר את הלוחית של המגנט צלחת ולשמור אותו בקרח.
    3. מניחים את הצלחת התגובה ניקוי קדם (מתוך שלב 2.3.4) על מגנט צלחת ולחכות 15 s עבור חרוזים להפריד, הפתרון להתבהר. מבלי להפריע את החרוזים, להעביר בזהירות את תגובת שיקוע בעזרת פיפטה הבארות המקביל של Ab-חרוז צלחת מורכב שמר על קרח, לערבב בעדינות 15 פעמים על-ידי pipetting למעלה ולמטה. חותם הצלחת היטב עם אלומיניום צלחת כיסוי, דגירה בין לילה (12-18 h) ב 4 ° C על פלטפורמה מסתובבת. תווית מחדש את הצלחת "IP תגובה".

3. יום 2: ndCHIP-seq

  1. מנקי ו • תנאי
    1. הגדר המיקסר חימום 65 ° C. על קרח, להכין מאגר מלח נמוכה לשטוף עם מאגר מלח גבוהה לשטוף. מהר לסובב את הצלחת התגובה IP מהשלב 2.4.3 10 s-200 x g.
    2. מניחים את הצלחת התגובה IP על מגנט צלחת ולחכות 15 s עבור הפתרון להתבהר. באמצעות פיפטה רב-ערוצי, מבלי להפריע את החרוזים, בזהירות להסיר ולמחוק את תגובת שיקוע. לוקח את הצלחת את המגנט לצלחת ומניחים אותו על קרח.
    3. כל שורה של דוגמאות בצלחת תגובת ה-IP, להוסיף 150 µL של מלח נמוכה כקרח לשטוף מאגר לערבב לאט 10 פעמים למעלה ולמטה כדי resuspend באופן מלא את החרוזים.
    4. מקם את הצלחת התגובה IP בחזרה על המגנט צלחת לחכות החרוזים להפריד, באמצעות פיפטה רב-ערוצי, מבלי להפריע את החרוזים להסיר ולמחוק את תגובת שיקוע. מניחים את הצלחת בחזרה על קרח, חזור על הצעדים 3.1.3 ו 3.1.4 סך של 2 שוטף.
    5. על קרח, כל שורה של דוגמאות בצלוחית תגובת ה-IP, להוסיף 150 µL של מלח גבוהה לשטוף מאגר לערבב לאט 10 פעמים על-ידי pipetting למעלה ולמטה כדי resuspend באופן מלא את החרוזים.
    6. מקם את הצלחת התגובה IP בחזרה על המגנט צלחת לחכות החרוזים להפריד, באמצעות פיפטה רב-ערוצי, מבלי להפריע את החרוזים להסיר ולמחוק את תגובת שיקוע. מניחים את הצלחת התגובה IP על קרח ולהירגע מראש צלחת 96-ובכן חדשה לידו.
    7. כל שורה של דוגמאות בצלחת תגובת ה-IP, להוסיף 150 µL של מלח גבוהה לשטוף מאגר לערבב לאט 10 פעמים על-ידי pipetting למעלה ולמטה כדי resuspend באופן מלא את החרוזים. לאחר resuspension, העברת כל שורה של דוגמאות על השורה המתאימה של צלחת חדשה, טרום מקורר, 96-ובכן. תווית את הצלחת "IP תגובה". למחוק את הלוח הישנה.
    8. מניחים את הצלחת התגובה IP חדש על המגנט צלחת ולחכות החרוזים להפריד. באמצעות פיפטה רב-ערוצי, מבלי להפריע את החרוזים, בזהירות להסיר ולמחוק את תגובת שיקוע. לקחת את הצלחת בטמפרטורת החדר.
    9. כל שורה של דוגמאות בצלחת תגובת ה-IP, להוסיף 30 µL של המאגר • תנאי שבב (EB) ולערבב לאט 10 פעמים על-ידי pipetting למעלה ולמטה. הקפידו למנוע היווצרות בועה.
    10. לאטום את הצלחת היטב עם כיסוי ה-PCR, דגירה במיקסר חימום ב 65 ° C עבור h 1.5 עם מהירות ערבוב של 1,350 סל ד.
    11. לאחר דגירה 1.5 h, ספין למטה הצלחת התגובה IP ב- g x 200 עבור 1 דקות ב- 4 מעלות צלזיוס. שנה את ההגדרה של מיקסר חימום ל 50 מעלות צלזיוס.
    12. לאחר הספין, למקם את הצלחת התגובה IP על מגנט צלחת ולחכות הפתרון לנקות. באמצעות פיפטה רב-ערוצי, מבלי להפריע את החרוזים, בזהירות להעביר 30 µL של תגובת שיקוע לתוך צלחת חדשה 96-ובכן. השתמש בעצות טריים עבור כל שורה. לתייג את הצלחת "IP תגובה" ולשמור אותו בטמפרטורת החדר.
  2. עיכול חלבון
    1. לאחזר 30% פג/1 M NaCl חרוז מגנטי17 (מאגר הרכב טבלה) פתרון מהמקרר 4 ° C ולשמור אותה בטמפרטורת החדר במשך לפחות 30 דקות קריטיות: לוודא הפתרון חרוז באופן מלא יגיע לטמפרטורת החדר לפני שתמשיך.
    2. לאחזר דגימות הבקרה קלט 4 ° C (שלב 2.3.2) ואחסון סחרור מהיר. למדוד את האחסון באמצעות פיפטה ולהוסיף מים הנדסה גנטית כל פקד קלט עבור נפח סופי של 30 µL. להעביר את הדגימות פקד קלט הבארות קלט שנבחרו מראש (בארות ריק) בצלחת התגובה IP (שלב 3.1.12). להקליט את הבאר למפתח מדגם.
    3. על קרח, להכין את התמהיל מאסטר עיכול חלבון כפי שמוצג בטבלה 5 מסה ונפח שווה aliquot לתוך שורה אחת של צלחת 96-ובכן המאגר.
    4. באמצעות פיפטה רב-ערוצי, כל שורה של דוגמאות בצלוחית תגובת ה-IP, להוסיף µL 40 של המיקס מאסטר עיכול חלבונים ולערבב לאט 10 פעמים למעלה ולמטה. לאטום את הצלחת היטב עם כיסוי ה-PCR, ספין למטה ב- g x 200 עבור 1 דקות, דגירה במיקסר חימום ב 50 מעלות צלזיוס למשך 30 דקות שוכן בגובה 650 סל ד. בעוד הצלחת הוא המקננת, להכין טרי 70% אתנול (EtOH) ולשמור אותו בטמפרטורת החדר.
    5. בתום 30 דקות הדגירה, לסובב את הצלחת התגובה IP ב- g x 200 עבור 1 דקות, 4 מעלות צלזיוס. לקחת את הצלחת בטמפרטורת החדר.
      הערה: לנפח הכללי צריך להיות עכשיו ~ 70 µL/טוב.
  3. חרוז לנקות באמצעות 30% פג/1 M NaCl חרוז מגנטי פתרון
    1. Aliquot טמפרטורת החדר 30% פג/1 M NaCl מגנטי חרוז פתרון לתוך שורה אחת של צלחת נקי 96-ובכן אגירה (µL 75 לכל דגימה x מספר שורות).
    2. עובד בטמפרטורת החדר, באמצעות פיפטה רב-ערוצי, להוסיף 70 µL (יחס 1:1) של הפתרון מגנטי חרוז פג/1 M NaCl 30% כל שורה של דוגמאות בצלחת התגובה IP ומערבבים 10 פעמים על-ידי pipetting למעלה ולמטה. לשנות טיפים בין שורות. דגירה את הצלחת. בשביל 15 דקות בטמפרטורת החדר.
    3. מניחים את הצלחת על המגנט צלחת, תקופת דגירה של 5 דקות כדי לאפשר את החרוזים להפריד.
    4. באמצעות פיפטה של, מבלי להפריע את החרוזים, בזהירות להסיר ולמחוק את תגובת שיקוע. שמור את החרוזים.
    5. בעוד הצלחת התגובה IP הוא עדיין על המגנט צלחת, בעזרת פיפטה רב-ערוצי, כל שורה של דוגמאות, להוסיף 150 µL בטמפרטורת החדר 70% EtOH דגירה ב-30 s. לאחר 30 s, פיפטה רב-ערוצי, באמצעות להסיר ולמחוק את תגובת שיקוע. חזור על שלב זה עוד פעם אחת על סך של 2 שוטף.
    6. לאחר לשטוף את השני EtOH, דגירה על הלוחית 'יבש' המגנט צלחת עבור מינימלית 3 לבחון באופן חזותי את הצלחת כדי לוודא כי כל EtOH זה התאדו. אם לא, דגירה את הצלחת. בשביל דק 1. ייבוש יתר על המידה בתוצאות חרוזים תשואה נמוכה יותר.
    7. לוקח את הצלחת את המגנט צלחת ושימוש של פיפטה רב-ערוצי, להוסיף µL 35 EB (טבלה של חומרים). מערבבים היטב על ידי pipetting 10 פעמים למעלה ולמטה. לשנות טיפים בין שורות. דגירה בטמפרטורת החדר במשך 3 דקות ל- elute.
    8. לאחר דגירה, למקם את הצלחת התגובה IP בחזרה על המגנט צלחת, דגירה למשך 2 דקות. צריך להפריד החרוזים, הפתרון יהיה ברור.
    9. באמצעות פיפטה רב-ערוצי, מבלי להפריע את החרוזים, בזהירות להעביר את תגובת שיקוע לתוך הבארות המקביל של צלחת 96-ובכן חדשה.
    10. לאטום את הצלחת עם כיסוי אלומיניום תווית "עזרת + קלט DNA", לאחסן ב 4 מעלות צלזיוס למשך הלילה, או ב-20 ° C לטווח ארוך (> 48 שעות) אחסון.

4. יום 3: ספריית בנייה

  1. זרחון ותיקון קצה
    1. הקלט עבור התגובה סוף תיקון/זרחון הוא עזרת + קלט צלחת מהשלב 3.3.10. לאחר מפשיר, לסובב את הצלחת למטה ב- g x 200 עבור 1 דקות ב 4 ° C ולשמור אותו בקרח.
    2. לאחזר מ-20 ° C מקפיא כל ריאגנטים (מלבד אנזימים) הדרושים עבור התגובה סוף תיקון/זרחון (טבלה 6), להפשיר אותם בטמפרטורת החדר ולאחר מכן להעביר מיד לקרח.
    3. עבודה על קרח, בצע טבלה 6 כדי להגדיר את התמהיל סוף תיקון/זרחון מאסטר בצינור microcentrifuge של 1.5 mL סטרילי. לאחר התוספת של כל הרכיבים שאינם-אנזים, מערבבים היטב בעזרת דופק-vortexing ולמקם את הצינור בחזרה על קרח.
    4. לאחזר אנזימים הרלוונטיות שלהם אחסון הקרה ותעבורה לספסל במעמד מגניב צינור צוננת. לערבב כל אנזים על ידי מצליף את הצינור, סיבוב מהיר, ומקם אותו בחזרה בארון צינור צוננת מגניב. כאשר pipetting את האנזים, תשאף באיטיות כדי להבטיח העברה נפח מדויק. לאחר התוספת, לשטוף את הטיפ בתערובת הראשי על-ידי pipetting למעלה ולמטה.
    5. פעם האנזימים נוספים, בעדינות דופק-מערבולת הבסיס מערבבים 5 פעמים כדי להבטיח ריפודי כתופיים של כל הרכיבים, ואז סיבוב מהיר ומניחים מיד את הצינור בחזרה על קרח.
    6. על קרח, aliquot אמצעי אחסון המתאים של המיקס סוף תיקון/זרחון מאסטר לתוך שורה אחת של צלחת 96-ובכן מאגר חדש; לאמצעי האחסון להיות aliquoted: (15 µL x מספר שורות) + 5 µL נפח מת. חישוב לדוגמה עבור שתי שורות: (15 µL x 2) + 5 µL = µL 35/טוב.
    7. באמצעות פיפטה רב-ערוצי, להוסיף µL 15 של המיקס סוף תיקון/זרחון מאסטר כל שורה של דוגמאות ומערבבים 10 פעמים על-ידי pipetting למעלה ולמטה. לשנות טיפים בין שורות. לאטום את הצלחת עם כיסוי פלסטיק, ספין למטה ב- g x 200 עבור 1 דקות ב 4 ° C, דגירה בטמפרטורת החדר למשך 30 דקות.
  2. חרוז לנקות לאחר סיום ותיקון זירחון
    1. מהמקרר 4 ° C, לאחזר את 20% פג/1 M NaCl חרוז מגנטי פתרון והפתרון פג/1 M NaCl 30%, דגירה בטמפרטורת החדר במשך לפחות 30 דקות.
      הערה: הפתרון פג/1 M NaCl 30% אינן מכילות beads מגנטי.
    2. לאחר שני פתרונות להגיע לטמפרטורת החדר, עבור כל דגימה להכין µL 80 של 1:2 שילוב של 30% פג/1 M NaCl, 20% פג/1 M NaCl חרוז מגנטי פתרונות. דוגמה עבור דגימות 24: µL 80 x 24 = 1,920 µL (640 µL של 30% פג/1 M NaCl, µL 1,288 של 20% פג/1 M NaCl חרוז מגנטי פתרונות).
    3. Aliquot הפתרון חרוז לערבב, נפח שווה, לתוך שורה אחת של צלחת מאגר 96-ובכן, שיהיה בטמפרטורת החדר. Aliquot מאגר EB (µL 40 לדגימה x מספר שורות) לתוך שורה אחת של צלחת מאגר נקי 96-ובכן. דוגמא עבור שתי שורות: µL 40 x 2 = 80 µL/טוב.
    4. בעזרת פיפטה רב-ערוצי, להוסיף µL 75 של המיקס חרוז מוכנים להיכנס 4.2.2 כל שורה של דוגמאות מהשלב 4.1.7 ומערבבים לאורך 10 פעמים. לשנות טיפים בין שורות. דגירה בטמפרטורת החדר במשך 15 דקות המשך ההליך לנקות חרוז כפי שמתואר בספר צעדים 3.3.3-3.3.10. כיסוי לצלחת עם חותמת פלסטיק, סחרור מהיר ומניחים אותו על קרח. המשך לשלב 4.3.
  3. התגובה A-עוקב
    1. לאחזר מהמקפיא-20 ° C כל ריאגנטים (מלבד אנזימים) הדרושים עבור התגובה A-עוקב (טבלה מס ' 7), להפשיר אותם בטמפרטורת החדר ואז להעביר מיד לקרח.
    2. עבודה על קרח, בצע טבלה 7 כדי להגדיר את התמהיל מאסטר א-עוקב בצינור microcentrifuge של 1.5 mL סטרילי. בצע את הוראות ההתקנה של המבשלה אנזימטי הכללית כפי שמתואר בספר צעדים 4.1.4-4.1.6.
    3. באמצעות פיפטה רב-ערוצי, להוסיף µL 15 של המיקס מאסטר א-עוקב כל שורה של דוגמאות ומערבבים 10 פעמים על-ידי pipetting למעלה ולמטה. לשנות טיפים בין שורות. לאטום את הצלחת עם כיסוי ה-PCR, ספין למטה ב- g x 200 עבור 1 דקות ב 4 ° C, דגירה ב thermocycler ב 37 מעלות צלזיוס למשך 30 דקות. לאחר הדגירה, לסובב את הצלחת למטה ב- g x 200 עבור 1 דקות ולשמור אותה בטמפרטורת החדר.
  4. חרוז לנקות לאחר A-עוקב
    1. בצע את השלבים המתוארים שלב 4.2. כיסוי לצלחת עם חותמת פלסטיק, תווית "זנב A + לפני הספירה", ספין מהירה, ומניחים אותו על קרח. המשך לשלב 4.5.
  5. מתאם מצדו
    1. לאחזר מהמקפיא-20 ° C כל ריאגנטים (מלבד אנזימים) הדרושים עבור התגובה מצדו מתאם (טבלה 8), להפשיר אותם בטמפרטורת החדר ואז להעביר מיד לקרח.
    2. לאחזר 10 מיקרומטר PE מתאם (משלימה טבלה 1) פתרון מניות ו לדלל כדי 0.5 מיקרומטר באמצעות EB. מערבבים היטב בעזרת דופק vortexing. אמצעי האחסון הנדרש הוא 3 µL x מספר דוגמאות. עובד על קרח, aliquot מתאם 0.5 מיקרומטר PE, נפח שווה, לתוך בארות 12 של צלחת מאגר נקי 96-ובכן. . לשמור את זה על קרח.
    3. עבודה על קרח, בצע טבלה 8 כדי להגדיר את התמהיל מאסטר מצדו מתאם צינור microcentrifuge 1.5 mL סטרילי. בצע את הוראות ההתקנה של המבשלה אנזימטי הכללית כפי שמתואר בספר צעדים 4.1.4-4.1.6. ודא כי 5 X מהירה מצדו מאגר מלא המופשרים ולערבב היטב לפני השימוש.
    4. על קרח, aliquot אמצעי אחסון המתאים של המיקס מתאם מצדו מאסטר לתוך שורה אחת של צלחת 96-ובכן המאגר החדש. לדוגמה, חישוב עבור שתי שורות: (23 µL x 2) + 5 µL = µL 51/טוב. לקחת את הצלחת על קרח.
    5. בעזרת פיפטה רב-ערוצי, להוסיף 2 µL של 0.5 מיקרומטר סוף לזווג (PE) מתאם לתוך כל שורה של דגימות שלב 4.4.1 ושילוב. לשנות טיפים בין שורות.
    6. באמצעות פיפטה רב-ערוצי, להוסיף µL 23 של המיקס מתאם מצדו מאסטר כל שורה של דוגמאות ומערבבים 15 פעמים על-ידי pipetting למעלה ולמטה. לשנות טיפים בין שורות. לאטום את הצלחת עם כיסוי מתכת, תווית "מצדו", ספין למטה ב- g x 200 עבור 1 דקות ב- 4 ° C, דגירה בטמפרטורת החדר למשך הלילה.
  6. יום 4: חרוז לנקות #1 לאחר מתאם מצדו
    1. מהמקרר 4 ° C, לאחזר את הפתרון מגנטי חרוז פג/1 M NaCl 20%, דגירה בטמפרטורת החדר במשך לפחות 30 דקות. בעוד הפתרון הוא equilibrating להכין טרי 70% EtOH.
    2. Aliquot הפתרון מגנטי חרוז פג/1 M NaCl 20%, µL 55 לדגימה, לתוך שורה אחת של מאגר 96-ובכן צלחת ולשמור אותה בטמפרטורת החדר. דוגמא עבור שתי שורות: µL 55 x 2 = 110 µL/טוב.
    3. מאגר EB aliquot, µL 50 עבור דגימה, לתוך שורה אחת של צלחת מאגר נקי 96-ובכן. דוגמא עבור שתי שורות: µL 50 x 2 = 100 µL/טוב.
    4. באמצעות פיפטה רב-ערוצי, להוסיף µL 48 של הפתרון מגנטי חרוז פג/1 M NaCl 20% לתוך כל שורה של דוגמאות בצלחת מצדו מהשלב 4.5.6 ולערבב לאורך 10 פעמים. לשנות טיפים בין שורות. דגירה בטמפרטורת החדר במשך 15 דקות המשך ההליך לנקות חרוז כפי שמתואר בספר צעדים 3.3.3-3.3.7.
    5. . קח את לוחית הרישוי של פיפטה רב-ערוצי, המגנט צלחת ושימוש להוסיף 45 µL EB (טבלה של חומרים). מערבבים היטב על ידי pipetting 10 פעמים למעלה ולמטה. לשנות טיפים בין שורות. תקופת דגירה של טמפרטורת החדר במשך 3 דקות ל- elute.
    6. לאחר דגירה, למקם את הצלחת התגובה IP בחזרה על המגנט צלחת תקופת דגירה של 2 דק בעזרת פיפטה רב-ערוצי, מבלי להפריע את החרוזים, להעביר בזהירות את תגובת שיקוע לתוך הבארות המקביל של צלחת 96-ובכן חדשה. תווית את הצלחת "מצדו + 1 לפני הספירה".
    7. על כל טוב מוסיפים 5 µL 10 x PCR דיוק גבוה מאגר ומערבבים היטב על ידי pipetting למעלה ולמטה. לשנות טיפים בין שורות. כיסוי לצלחת עם חותמת פלסטיק, סיבוב מהיר, ולשמור אותו בטמפרטורת החדר.
  7. חרוז לנקות #2 לאחר מתאם מצדו
    1. לבצע ניקיון חרוז כמתואר בסעיף 4.6 עם השינויים הבאים: להוסיף 60 µL 20% פג/1 M NaCl חרוז מגנטי לפתרון מכל קידוח פעיל מצדו + צלחת 1 לפנה ס (שלב 4.6.7), elute של החרוזים באמצעות µL 35 EB המאגר. לתייג את הצלחת "מצדו + 2 לפנה ס" ולשמור אותו בקרח.
  8. PCR-הגברה
    1. לאחזר מהמקפיא-20 ° C כל של ריאגנטים (מלבד אנזימים) הדרושים עבור התגובה PCR (טבלה 9), להפשיר אותם בטמפרטורת החדר ואז מיד למקם אותם על קרח.
    2. עבודה על קרח, בצע טבלה 9 כדי להגדיר את התמהיל PCR מאסטר בצינור microcentrifuge של 1.5 mL סטרילי. בצע את ההוראות הגדרת כללי המבשלה כפי שמתואר בספר צעדים 4.1.4-4.1.5. על קרח, aliquot אמצעי אחסון המתאים של המיקס PCR מאסטר לתוך שורה אחת של צלחת 96-ובכן המאגר החדש. . לשמור את זה על קרח. ראה שלב 4.5.4 לחישובי הדגימה.
    3. עובד על קרח, באמצעות פיפטה רב-ערוצי, מוסיפים 2 µL של כל מיקרומטר 12.5 ייחודי PCR הפוך אינדקס פריימר (משלימה בטבלה 2) לבאר כל ב מצדו + צלחת 2 לפני הספירה (שלב 4.7.1) ומערבבים לאט לאט למעלה ולמטה. לשנות טיפים בין שורות. לקחת את הצלחת על קרח.
    4. עבודה על קרח, באמצעות פיפטה רב-ערוצי, להוסיף µL 23 של המיקס מאסטר PCR לתוך כל שורה של דוגמאות שלב 4.8.3 ושילוב 10 פעמים על-ידי pipetting למעלה ולמטה. לאטום את הצלחת עם כיסוי ה-PCR, לסובב אותו למטה-200 g x עבור 1 דקות, דגירה ב thermocycler (ראה טבלה 10 תנאי הרכיבה PCR).
  9. חרוז לנקות לאחר ה-PCR-הגברה
    1. לאחר ה-PCR הגברה לסובב את הצלחת ב g x 200 עבור 1 דקות, 4 מעלות צלזיוס. לבצע חרוז הניקיון כמתואר בסעיף 4.6 עם השינויים הבאים: להוסיף µL 51 של 20% פג/1 M NaCl חרוז מגנטי פתרון כל התגובה PCR, elute של החרוזים באמצעות µL 25 EB המאגר. לאטום את הצלחת עם חיפוי אלומיניום ו ספין למטה ב g 200 x דק 1 חנות הדגימות ב-20 ° C.
    2. כדי לאמת את ספריות שלא נבנה, לבצע כימות DNA שימוש assay מבוסס על-ידי קרינה פלואורסצנטית, להמחיש את המוצר הסופי באמצעות מנתח מבוססי שבב אלקטרופורזה נימי (assay רגישות גבוהה), ולהפעיל העשרה PCR כמותי (qPCR) (ראה נציג תוצאות, אימות של ndChIP-seq איכות לספריה על-ידי qPCR).

Representative Results

כרומטין עיכול פרופילים
אופטימיזציה של עיכול MNase חיוני להצלחת פרוטוקול זה. זה קריטי ליצירת פרופיל עיכול נשלט על ידי יחיד נוקלאוזום פרגמנט גדלים, כל עוד לא מעוכל יתר על המידה, כדי לאפשר התאוששות של קטעים נוקלאוזום סדר גבוהה יותר. פרופיל אידיאלי העיכול מורכבת רוב של שברי נוקלאוזום יחיד עם חלק קטן המייצגים שברים קטנים יותר, גדול יותר נוקליאוזומים יחיד. איור 1 מציג דוגמאות של פרופילים הפצה גודל אידיאלי יתר מעוכל, תחת-מעוכלים. שימו לב כי העיכול תת אופטימלית של כרומטין גם יהיה גלוי בפרופיל של הספרייה רצף הנוצר מתוך החומר IP (איור 2).

אימות באיכות ספריית ndChIP-seq מאת qPCR
qPCR היא שיטה ומבוססת על הערכה של האיכות של שבב18,19,20. בעת ביצוע ndChIP-seq על 10,000 תאים את התשואה של חומצת גרעין אחרי IP יהיה מתחת 1 ng. לכן, חיוני לבצע qPCR לאחר בניית ספריה כדי להעריך את העשרת היחסיים אזורי היעד על רקע. כדי לספק הערכה רקע, נוצרים ספריות בנוי על MNase מתעכל כרומטין (קלט). עבור כל ספריית ה-IP, נדרשים שני סטים של צבעי יסוד (ראו המשלימיםטבלה 3 לקבלת רשימה של צבעי יסוד סימני היסטון נפוץ). סט פריימר אחד צריך להיות ספציפי עבור אזור גנומית משויכת באופן עקבי השינוי היסטון עניין (יעד חיובי) ואזור אחר שאינו מסומן עם השינוי היסטון עניין (יעד שלילי). האיכות של הספרייה שבב-seq ייבחנו כמו לקפל העשרה ביחס ספריית קלט. קיפול העשרה ניתן לחשב באמצעות המשוואה הבאה כי ההנחה הגברה מעריכית של אזור היעד גנומית: 2Ctקלט-CtIP. מותאמים אישית שלנו עשוי חבילת תוכנה סטטיסטית R, qcQpcr_v1.2, היא מתאימה לניתוח העשרה qPCR של נמוך קלט יליד שבב-seq ספריות (קובצי קוד משלים). איור 3 מייצג תוצאה qPCR עבור ספריות שבב-seq ושנכשלו. הערך העשרה קיפול הצפוי המינימלי עבור ספריות ndChIP-seq באיכות טובה הם 16 עבור סימני צר, כגון H3K4me3 ו- 7 עבור סימני רחבה, לדוגמה H3K27me3.

מידול MNase נגישות
ניתוח חישובית של שבב-seq הוא מורכב וייחודי עבור כל הגדרה ניסיוני. סט של הנחיות נוסדה על ידי הבינלאומי האנושי Epigenomic Consortium (IHEC), האנציקלופדיה של ה-DNA אלמנטים (קידוד) ניתן להשתמש כדי להעריך את האיכות של ספריות שבב-seq21. חשוב לציין כי העומק רצף של הספריות משפיע את זיהוי והרזולוציה של אזורים מועשר20. מספר פסגות זוהה גידול ואת הגישות מישור כמו עומק קריאה בעליות. אנו ממליצים ndChIP-seq ספריות שנקבע בהתאם להמלצות IHEC של 50 מיליון לזווג-סינכרוניות (25 מיליון רסיסים) עבור סימני צרים (למשל, H3K4me3) וקורא 100 מיליון לזווג-(50 מיליון רסיסים) עבור סימני רחבה ( למשל, H3K27me3) קלט22. במעמקי רצף אלה מספקים היישורים רצף מספקת לצורך זיהוי של הפסגות המשמעותי ביותר תוך שימוש נרחב בשימוש שבב-seq המתקשרים שיא, כגון MACS2 והומר, בלי להגיע רוויה23,24. ספרייה ndChIP יונקים-seq באיכות גבוהה יש שיעור כפולות ה-PCR של < 10% והפניה הגנום יישור שיעור > 90% (כולל קריאות כפולים). NdChIP מוצלחת-seq ספריות יכיל משכפל מאוד מתואם עם חלק ניכר (> 40%) של קריאות מיושר בתוך MACS222 מזוהה מועשר פסגות ו פיקוח הקריאות מיושר על דפדפן הגנום לחשוף באופן חזותי enrichments לזיהוי בהשוואה הספרייה קלט (איור 4). בנוסף, ניתן להשתמש ndChIP-seq להעריך נוקלאוזום בצפיפות על ידי שימוש באלגוריתם הפצה תערובת לפי עקומת גאוס (w1 * n(x; Μ 1,σ1) + w2 * n(x; μ2, σ2) = 1) ב- MACS2 לזהות אזורים מועשר דגם נוקלאוזום לדחיסות כפי שהוגדרו על ידי גבולות נגיש MNase. במודל זה, w1 מייצג מונו-נוקלאוזום חלוקת משקל ו- w2 מייצג משקל הפצה di-נוקלאוזום. איפה w1 הוא גדול מ- w2, יש דומיננטיות של קטעים מונו-נוקלאוזום ולהיפך. ניתוח זה דורש כי ספריות היה לסדרם אופנה לזווג-קצה כך גדלים פרגמנט יכולה להיות מוגדרת. כדי להחיל את האלגוריתם הפצה תערובת לפי עקומת גאוס, אזורים מועשר סטטיסטית מזוהים לראשונה. אנו ממליצים להתקשר שיא עם MACS2 באמצעות קלט כפקד, עם הגדרות ברירת המחדל עבור סימני צר על קיצוץ ערך q של 0.01 עבור סימני רחבה. מספר החבילות הסטטיסטיות העסקת באלגוריתם התפלגות לפי עקומת גאוס תערובת של חבילות תוכנה סטטיסטית בשימוש נרחב זמינים. ניצול גודל ממוצע פרגמנט, נקבע על-ידי גבולות קריאה לזווג-end הדגימות עזרת, הפצות-MACS2 זיהה היזמים מועשר ולאחר באלגוריתם התפלגות לפי עקומת גאוס תערובת שניתן להחיל על כל יזם באמצעות החבילה R-סטטיסטי Mclust בגירסה 3.025 לחישוב התפלגות משוקלל. ביישום זה, אנו ממליצים על ביטול היזמים המכיל פחות מ 30 קטעים מיושר כי מתחת לסף זה המשקל וכתוצאה מכך הערכות להיות לא אמינים. ספרייה ndChIP-seq באיכות טובה יוצרת התפלגות לפי עקומת גאוס תערובת מורכבת משני רכיבים עיקריים עם רשע ערכים המייצגים מונו-, די-נוקלאוזום שבר אורכי.

Figure 1
איור 1 : הערכה של MNase העיכול לפני דור הספרייה. פרופילים מבוססי שבב אלקטרופורזה נימי מנתח של MNase האופטימלית (A), תחת מעוכל (B), מתעכל יתר מתעכל כרומטין (C). משכפל ביולוגי מוצגים עקבות, אדום, ירוק וכחול. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 : הערכה של MNase העיכול אחרי דור הספרייה. (א) פוסט ספריית פרופילים הבנייה של קלט מתעכל בצורה אופטימלית (משכפל ביולוגי; אדום, ירוק, שחור) ו- IP (משכפל הביולוגית; טורקיז, סגול, כחול) קלט תת אופטימלית (B) (משכפל ביולוגי; אדום, ירוק, כחול) ו- IP ( משכפל ביולוגי; ספריות ציאן, סגול, כתום). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3 : פוסט הבנייה ספריית ה-PCR כמותי יכול לשמש כדי להעריך את האיכות של ספריות ndChIP seq. קיפול העשרה של H3K4me3 IP ספריות ביחס ספריות קלט מחושב כ- 2(Ct של קלט - Ct של IP) עבור מטרות חיוביות ושליליות באמצעות qcQpcr_v1.2. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4 : הספרייה ndChIP נציג-seq נבנה מ- 10,000 CD34 ראשי+ כבל כדוריות דם. מתאם פירסון H3K4me3 אות (קורא לכל מיליון קריאות ממופה) מחושבת באופן היזמים (TSS + /-2Kb) בין משכפל ביולוגית 3, שכפול (א) 1 ו-2, (B) לשכפל 1 ו- 3, שכפול (ג) 2 ו- 3. (ד) UCSC בתצוגת דפדפן של אשכול גנים HOXA של שבב צולבים-seq שנוצר מתאי 1 מיליון לפי IP, ndChIP מוצלחת-seq מתאי 10,000 לכל IP ו- ndChIP לא מוצלח-seq מתאי 10,000 לכל IP. (אדום: H3K27me3, ירוק: H3K4me3, ושחור: קלט). (E) שבר הקריאות ממופה בתוך MACS2 לזהות אזורים מועשר של H3K4me3 (שחור), H3K27me3 (אפור). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

מאגר הרכב
A.1-מאגר Immunoprecipitation (IP)
20 מ מ טריס-HCl pH 7.5
2 מ מ EDTA
150 מ מ NaCl
0.1% טריטון X-100
0.1% Deoxycholate
Butyrate נתרן 10 מ מ
שטיפת מלח נמוכה מאגר A.2.
20 מ מ טריס-HCl pH 8.0
2 מ מ EDTA
150 מ מ NaCl
1% טריטון X-100
0.1% מרחביות
שטיפת מלח גבוהה מאגר A.3.
20 מ מ טריס-HCl pH 8.0
2 מ מ EDTA
500 מ מ NaCl
1% טריטון X-100
0.1% מרחביות
• תנאי שבב מאגר A.4.
NaHCO 100 מ מ3
1% מרחביות
A.5-1 x פירוק מאגר – 1 מ"ל
0.1% טריטון
0.1% Deoxycholate
Butyrate נתרן 10 מ מ
A.6-Ab דילול מאגר
0.05% (w/v) אזיד
0.05% בספקטרום רחב מיקרוביאלית (למשל ProClin 300)
ב- PBS
A.7-30% פתרון חרוז מגנטי של פג / 1M NaCl (הפניה16)
30% פג
NaCl 1 מ'
10 מ מ טריס HCl pH 7.5
1 מ מ EDTA
1 מ"ל של חרוזים פאראמגנטיים סופר שטף
A.8. 20% פתרון חרוז מגנטי של פג / 1M NaCl (הפניה16)
30% פג
NaCl 1 מ'
10 מ מ טריס HCl pH 7.5
1 מ מ EDTA
1 מ"ל של חרוזים פאראמגנטיים סופר שטף

טבלה 1: ndChIP-seq מאגר הרכב.

שינוי היסטון ריכוז (µg/µL)
H3K4me3 0.125
H3K4me1 0.25
H3K27me3 0.125
H3K9me3 0.125
H3K36me3 0.125
H3K27ac 0.125

טבלה 2: כמות נוגדנים הדרושים עבור ndChIP-תת סעיף.

Reganet נפח (µL)
מים טהורים אולטרה 478
ז טריס-HCl 1 pH 7.5 10
0.5 EDTA מ' 10
NaCl 5 מ' 2
גליצרול 500
הנפח הכולל 1,000

טבלה 3: מתכון MNase דילול מאגר.

מגיב נפח (µL)
מים טהורים אולטרה 13
20 מ מ DTT 1
10 x MNase מאגר 4
20 U/µl Mnase 2
הנפח הכולל 20

טבלה 4: מתכון מיקס מאסטר MNase.

מגיב נפח (µL)
• תנאי מאגר 30
מאגר G2 8
פרוטאז 2
הנפח הכולל 40

טבלה 5: מתכון מיקס מאסטר טיהור DNA.

מגיב נפח (µL)
מים טהורים אולטרה 3.3
10 x מאגר הגבלת Endonuclease (למשל NEBuffer) 5
25 מ מ ATP 2
dNTPs 10 מ מ 2
T4 Polynucleotide קינאז (U 10/µl) 1
T4 DNA פולימראז (U 3/µl) 1.5
Dna פולימראז אני, שבר גדול (Klenow) (U 5/µl) 0.2
הנפח הכולל 15

טבלה 6: מתכון סוף תיקון מאסטר מיקס.

מגיב נפח (µL)
מים טהורים אולטרה 8
10 x מאגר הגבלת Endonuclease (למשל NEBuffer) 5
10 מ מ dATP 1
Klenow (3 - 5' exo-) 1
הנפח הכולל 15

טבלה 7: מתכון מיקס מאסטר א-עוקב.

מגיב נפח (µL)
מים טהורים אולטרה 4.3
5 x מאגר מצדו מהירה 12
T4 DNA ליגאז (2000 U/µl) 6.7
הנפח הכולל 23

טבלה 8: מתכון מיקס מאסטר מצדו מתאם.

מגיב נפח (µL)
מים טהורים אולטרה 7
25. PCR פריימר 1.0 2
5 x מאגר HF 12
דימתיל סולפוקסיד 1.5
DNA פולימראז 0.5
הנפח הכולל 23

טבלה 9: מתכון מיקס מאסטר PCR.

שמתוכננים (° C) משך (s) מספר מחזורי
98 60 1
98 30
65 15 10
72 15
72 300 1
4 . תחזיק . תחזיק

טבלה 10: PCR להפעיל שיטה.

Oligo רצף השינוי
PE_adapter 1 5'-/ 5Phos/גת CGG AAG AGC GGT TCA GCA לשממ יניינעל ילבולגה דרשמה ATG CCG AG-3' 5. שינוי: זירחון
PE_adapter 2 5' - ACA CTC TTT CCC טק ACG ACG CTC TTC CGA TC * T - 3' 3' שינוי: * T הוא קשר phosphorothioate

משלימה טבלה 1: רצפים Oligo לדור של מתאם PE.

פריימר שם רצף אינדקס IndexRevC (שישמש עבור רצף)
PCR הפוך אינדקס פריימר 1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGTGAT atcacg
PCR הפוך אינדקס פריימר 2 CAAGCAGAAGACGGCATACGAGATCTGATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGATC gatcag
PCR הפוך אינדקס פריימר 3 CAAGCAGAAGACGGCATACGAGATGGGGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGGGTT aacccc
PCR הפוך אינדקס פריימר 4 CAAGCAGAAGACGGCATACGAGATCTGGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGGGT acccag
PCR הפוך אינדקס פריימר 5 CAAGCAGAAGACGGCATACGAGATAGCGCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCGCT agcgct
PCR הפוך אינדקס פריימר 6 CAAGCAGAAGACGGCATACGAGATCTTTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTTTTG caaaag
PCR הפוך אינדקס פריימר 7 CAAGCAGAAGACGGCATACGAGATTGTTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGTTGG ccaaca
PCR הפוך אינדקס פריימר 8 CAAGCAGAAGACGGCATACGAGATAGCTAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCTAG ctagct
PCR הפוכה פריימר אינדקס 9 CAAGCAGAAGACGGCATACGAGATAGCATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCATC gatgct
PCR הפוך אינדקס תחל 10 CAAGCAGAAGACGGCATACGAGATCGATTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGATTA taatcg
PCR הפוך אינדקס פריימר 11 CAAGCAGAAGACGGCATACGAGATCATTCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CATTCA tgaatg
PCR הפוך אינדקס פריימר 12 CAAGCAGAAGACGGCATACGAGATGGAACTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGAACT agttcc
PCR הפוך אינדקס פריימר 13 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ACATCG cgatgt
PCR הפוך אינדקס פריימר 14 CAAGCAGAAGACGGCATACGAGATAAGCTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AAGCTA tagctt
PCR הפוך אינדקס פריימר 15 CAAGCAGAAGACGGCATACGAGATCAAGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CAAGTT aacttg
PCR הפוך אינדקס פריימר 16 CAAGCAGAAGACGGCATACGAGATGCCGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCCGGT accggc
PCR הפוך אינדקס פריימר 17 CAAGCAGAAGACGGCATACGAGATCGGCCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGGCCT aggccg
PCR הפוך אינדקס פריימר 18 CAAGCAGAAGACGGCATACGAGATTAGTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TAGTTG caacta
PCR הפוך אינדקס פריימר 19 CAAGCAGAAGACGGCATACGAGATGCGTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCGTGG ccacgc
PCR הפוך אינדקס פריימר 20 CAAGCAGAAGACGGCATACGAGATGTATAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GTATAG ctatac
PCR הפוך אינדקס פריימר 21 CAAGCAGAAGACGGCATACGAGATCCTTGCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CCTTGC gcaagg
PCR הפוך אינדקס פריימר 22 CAAGCAGAAGACGGCATACGAGATGCTGTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCTGTA tacagc
PCR הפוך אינדקס פריימר 23 CAAGCAGAAGACGGCATACGAGATATGGCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ATGGCA tgccat
PCR הפוך אינדקס פריימר 24 CAAGCAGAAGACGGCATACGAGATTGACATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGACAT atgtca

משלימה בטבלה 2: ה-PCR הפוך אינדקס פריימר רצפים.

תחל רצף
ZNF333_genic_H3K9me3_F 5'-AGCCTTCAATCAGCCATCATCCCT-3'
ZNF333_genic_H3K9me3_R 5'-TCTGGTATGGGTTCGCAGATGTGT-3'
HOXA9-10_F 5'-ACTGAAGTAATGAAGGCAGTGTCGT-3'
HOXA9-10_R 5'-GCAGCAYCAGAACTGGTCGGTG-3'
GAPDH_genic_H3K36me3_F 5'-AGGCAACTAGGATGGTGTGG-3'
GAPDH_genic_H3K36me3_R 5'-TTGATTTTGGAGGGATCTCG-3'
GAPDH-F 5'-TACTAGCGGTTTTACGGGCG-3'
GAPDH-R 5'-TCGAACAGGAGGAGCAGAGAGCGA-3'
שינוי היסטון מטרה חיובית היעד שלילי
H3K4me3 GAPDH HOXA9-10
H3K4me1 GAPDH_genic ZNF333
H3K27me3 HOXA9-10 ZNF333
H3K27ac GAPDH ZNF333
H3K9me3 ZNF333 HOXA9-10
H3K36me3 GAPDH_genic ZNF333

3 טבלה משלימה: רשימה של צבעי יסוד סימני היסטון נפוץ (H3K4me3, H3K4me1, H3K27me3, H3K27ac, H3K9me3 ו- H3K36me3).

משלימה קובץ 1: גליון ndChIP-seq. אנא לחץ כאן כדי להוריד את הקובץ.

קובצי קוד משלים: qcQpcr_v1.2. R חבילת תוכנה סטטיסטית לניתוח העשרה qPCR של ספריות נמוך שבב-seq קלט מקורית. אנא לחץ כאן כדי להוריד את הקובץ.

Discussion

בהתחשב באופי קומבינטורית כרומטין השינוי ואת נוקלאוזום מיצוב בתקנה תעתיק, שיטה המאפשרת מדידות סימולטני של תכונות אלה סביר לספק תובנות חדשות תקנה epigenetic. פרוטוקול ndChIP-seq המוצג כאן הוא פרוטוקול שבב-seq יליד ממוטבת כדי לאפשר חקירה סימולטני של שינוי היסטון וצפיפות נוקלאוזום תאי יסוד נדיר9,10. ndChIP-seq מנצל עיכול אנזימטי של כרומטין, כאשר מצמידים רצף מקביל בנפט לזווג-end ודגם הפצה תערובת לפי עקומת גאוס, מאפשר השינויים היסטון החקירה ברמה נוקלאוזום יחיד ו deconvolution של פרופילים epigenomic מונע על ידי הטרוגניות בתוך אוכלוסיה. באמצעות פרוטוקול זה, אנחנו דיווחו בעבר כי התפלגות ייחודיים בגדלים פרגמנט זירז חיסונית, נקבע על ידי זיווג-end לקרוא גבולות, שקשורות במדינות כרומטין ספציפיים שהוגדרו על-ידי ChromHMM10,24.

האיכות של ספרייה ndChIP-seq תלוי גורמים רבים, כגון ירידה לפרטים נוגדן, רגישות, תנאים אופטימליים של עיכול MNase איכות כרומטין. יחודיות של הנוגדנים בשימוש חיוני בהפקת ספריית ndChIP מוצלחת-seq. נוגדן אידיאלי מראה זיקה גבוהה נגד epitope עניין עם תגובתיות צלב קטן עם epitopes אחרים. חשוב לא פחות לבחור beads מגנטי עם האהדה הגבוהה הנוגדן של בחירה.

MNase עיכול הוא תגובה קריטיות ולא זמן הריכוז-והרגיש של פרוטוקול זה. לכן, בעת עיבוד הדגימות מרובים, זה חשוב כי כל תגובה מודגרת למשך כמות שווה של זמן (ראה שלב 2.2). האיכות של כרומטין היא גורם נוסף המשפיע באופן משמעותי את התוצאה של ndChIP-תת סעיף Fragmented כרומטין מוביל פרופיל תת אופטימלית של מערכת העיכול MNase ותוצאות בספריות עם קליטה נמוכה יחס הרעש. דוגמאות ראשי עם נמוך תא הכדאיות או מושפל כרומטין, כמו פורמלין-תיקון רקמות (FFPE) פרפין-מוטבע לא מומלצים עבור פרוטוקול זה.

התוספת של PIC במהלך החילוץ כרומטין מפחית לא רצויות (קרי, אקראי) כרומטין ולהפיק שומר על תקינות היסטון זנבות. ככזה, PIC צריך להוסיף מאגר פירוק ומאגר immunoprecipitation רגע לפני השימוש. בעת בחירת תאים באמצעות cytometry זרימה, בחר עבור התאים קיימא ולהבטיח תאים ממוינים בספיקה נמוכה כדי להגביר את הדיוק של הערכת מספר התא ואת הכדאיות של תאים. הימנע מיון תאי ישירות לתוך מאגר פירוק. המאגר נדן לדלל את המאגר פירוק ומונע permeabilization יעיל של קרום התא כדי MNase. בהתאם לסוג תאים או אורגניזם, טיטור של MNase עשויים להידרש לקבל לעיכול אופטימלי.

ndChIP-seq בתאי יונקים מחייב רצף מינימלי לעומק של 50 מיליון לזווג-סינכרוניות (25 מיליון רסיסים) עבור סימני צר וקורא 100 מיליון לזווג-(50 מיליון רסיסים) עבור קלט וסימוני רחבה. האלגוריתם התפלגות לפי עקומת גאוס תערובת לא יבצע בצורה אופטימלית על ספריות יש כבר וסודרו לעומק באופן משמעותי להלן המלצה זו. ndChIP-seq לא תסווג היזמים עם מעט הפרדה בין ערך משוקלל הפצה עבור מונו - ו di-נוקלאוזום שבר אורכי לתוך מונו - או di-נוקלאוזום נשלט היזמים. לכן, אלה היזמים להסירו בניתוח עוקבות. ניתן להפיק משכפל ביולוגי כדי להגביר את האמון התפלגויות חזויות וזהה השתנות טכני בבניית לעיכול, ספריית MNase.

בניגוד חזרות הקודם של יליד שבב-seq פרוטוקולים, ndChIP-seq מספק את האמצעים כדי לחקור את השפעת שינוי המבנה של היסטון כרומטין קומבינטורית על ידי ניצול פרגמנט גודל פוסט immunoprecipitation לשלב נוקלאוזום צפיפות, נקבע על ידי נגישות MNase, עם מדידות שינוי היסטון. יישום של ndChIP-seq על ראשי תאים ורקמות לספק הרומן תובנות לגבי טבע אינטגרטיבית של תקנה epigenetic, מאפשר זיהוי של חתימות epigenetic בשל הטרוגניות בתוך האוכלוסייה.

Disclosures

המחברים מצהירים כי יש להם אינטרסים כלכליים אין מתחרים.

Acknowledgements

א. ל נתמכה על ידי מלגה לתואר שני קנדי מן המכון הקנדי של בריאות המחקר. עבודה זו נתמכה על ידי מענקים קולומביה הבריטית הגנום והמחקרים קנדי מוסדות של בריאות (CIHR-120589) כחלק אפיגנטיקה הקנדי, הסביבה ועל הבריאות מחקר קונסורציום היוזמה על ידי התוכנית מכון מחקר פוקס טרי פרוייקט גרנט #TFF-122869 מ. ה, מכון המחקר של שועל טרי חדש החוקר פרס (גרנט # 1039) ל מ. ה

Materials

Name Company Catalog Number Comments
1M Tris-HCl –pH 7.5 Thermo Scientific 15567-027
1M Tris-HCl –pH 8 Thermo Scientific 15568-025
0.5M EDTA Thermo Scientific AM9260G
5M NaCl Sigma 1001385276
Triton X-100 Sigma 1001412354
Sodium-Deoxycholate Sigma 1001437582
SDS Thermo Scientific 15525-017
Sodium-Bicarbonate Fisher Scientific S233-500
100% EtOH NA NA
V-bottom 96 well plate (AB 1400) Thermo Scientific AB-1400-L
Gilson P2 pipetman Mandel F144801
Gilson P10 pipetman Mandel F144802
Gilson P20 pipetman Mandel F123600
Gilson P100 pipetman Mandel F123615
Gilson P200 pipetman Mandel F123601
Gilson P1000 pipetman Mandel F123603
Micrococcal Nuclease  NEB M0247S
Thermo Mixer C (Heating block mixer) Eppendorf 5382000023
Multi 12-channel Pippet P20 Rainin 17013803
Multi 12-channel Pippet P200 Rainin 17013805
1.5 ml LoBind tube Eppendorf 22431021
0.5 ml LoBind tube Eppendorf 22431005
Plastic Plate Cover Edge Bio 48461
PCR cover Bio Rad MSD-1001
Aluminum Plate Cover Bio Rad MSF-1001
Elution buffer (EB buffer) Qiagen 19086
1M DTT Sigma 646563
Eppendorf 5810R centrifuge  Eppendorf 22625004
Ultrapure water Thermo Scientific 10977-015
Protein G dynabeads Thermo Scientific 10001D
Protein A dynabeads Thermo Scientific 10001D
Protease inhibitor Cocktail Calbiochem 539134
Rotating platform Mandel 1b109-12052010
Plate magnet Alpaqua 2523
Domed 12-cap strip Bio Rad TCS1201
Buffer G2 Qiagen 1014636
Protease Qiagen 19155
Tube Magnet (DynaMag-2) Thermo Scientific 12321D
Tube Magnet (DynaMag-2) LabCore 730-006
V shape Plastic reservoir Mandel S0100A
Vortex Mandel C1801
Mini Fuge Mettler Toledo XS2035
Analytical scale Mandel LB109-12052010
Quick Ligation Reaction Buffer, 5X NEB B6058S
DNA Polymerase I, Large (Klenow) Fragment NEB M0210S
Klenow Fragment (3'-5' exo) NEB M0212S
T4 DNA Polymerase NEB M0203S
T4 Polynucleotide Kinase NEB M0201S
Deoxynucleotide Solution mix, 10mM NEB N0447S
dATP Solution 10mM NEB N0440S
Quick T4 DNA Ligase NEB M0202T
Adenosine 5'-Triphosphate (ATP), 25mM NEB P0756S
DNA Polymerase Thermo Scientific F549L
NEBuffer 2 NEB B7002S
Hank's buffered salt solution Thermo Scientific 14025076
Fetal bovine serum  Thermo Scientific A3160702
phosphate buffer saline  Thermo Scientific 10010023
H3K4me3 Cell Signaling 9751S
H3K4me1 Diagenode C15410037
H3K27me3 Diagenode pAb-069-050
H3K36me3 Abcam ab9050
H3K9me3 Diagenode C15410056
SeraMag  super-paramagnetic beads

DOWNLOAD MATERIALS LIST

References

  1. Simpson, R. T. Nucleosome Positioning: Occurrence, Mechanisms, and Functional Consequences. Prog. Nucleic Acid Res. Mol. Biol. 40, Issue C 143-184 (1991).
  2. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundmamental particle of the eukaryotic chromosome. Cell. 98, 285-294 (1999).
  3. Schones, D. E., et al. Dynamic regulation of nucleosome positioning in the human genome. Cell. 132, (5), 887-898 (2008).
  4. Segal, E., et al. A genomic code for nucleosome positioning. Nature. 442, (7104), 772-778 (2006).
  5. Shiio, Y., Eisenman, R. N. Histone sumoylation is associated with transcriptional repression. PNAS. 100, (23), 13225-13230 (2003).
  6. Li, L., Lorzadeh, A., Hirst, M. Regulatory variation: An emerging vantage point for cancer biology. Wiley Interdiscip. Rev. Syst. Biol. Med. 6, (1), 37-59 (2014).
  7. Jiang, J., et al. Investigation of the acetylation mechanism by GCN5 histone acetyltransferase. PLoS ONE. 7, (5), (2012).
  8. Kouzarides, T. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12, (2), 198-209 (2002).
  9. Brind'Amour, J., Liu, S., Hudson, M., Chen, C., Karimi, M. M., Lorincz, M. C. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat. Commun. 6, 6033 (2015).
  10. Lorzadeh, A., et al. Nucleosome Density ChIP-Seq Identifies Distinct Chromatin Modification Signatures Associated with MNase Accessibility. Cell Rep. 17, (8), 2112-2124 (2016).
  11. Noll, M., Kornberg, R. D. Action of micrococcal nuclease on chromatin and the location of histone H1. J. Mol. Biol. 109, (3), 393-404 (1977).
  12. Skene, P. J., Henikoff, S. A simple method for generating high-resolution maps of genome wide protein binding. eLife. 4, 09225 (2015).
  13. Brogaard, K., Xi, L., Wang, J. -P., Widom, J. A map of nucleosome positions in yeast at base-pair resolution. Nature. (2012).
  14. Cui, K., Zhao, K. Genome-wide approaches to determining nucleosome occupancy in metazoans using MNase-Seq. Methods Mol. Biol. 833, 413-419 (2012).
  15. Mieczkowski, J., et al. MNase titration reveals differences between nucleosome occupancy and chromatin accessibility. Nat. Commun. 7, 11485 (2016).
  16. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). JOVE. (41), (2010).
  17. Rohland, N., Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, (5), 939-946 (2012).
  18. Zheng, Y., Josefowicz, S. Z., Kas, A., Chu, T. T., Gavin, M. A., Rudensky, A. Y. Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature. 445, (7130), 936-940 (2007).
  19. Krishnakumar, R., Gamble, M. J., Frizzell, K. M., Berrocal, J. G., Kininis, M., Kraus, W. L. Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes. Science. 319, (5864), 819-821 (2008).
  20. Mendenhall, E. M., et al. Locus-specific editing of histone modifications at endogenous enhancers. Nat. Biotechnol. 31, (12), 1133-1136 (2013).
  21. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  22. Reference Epigenome Standards - IHEC. Available from: http://ihec-epigenomes.org/research/reference-epigenome-standards/ (2017).
  23. Heinz, S., et al. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 38, (4), 576-589 (2010).
  24. Feng, J., Liu, T., Qin, B., Zhang, Y., Liu, X. S. Identifying ChIP-seq enrichment using MACS. Nat. Protoc. 7, (9), 1728-1740 (2012).
  25. Fraley, C., Raftery, A. E. MCLUST: Software for Model-Based Cluster Analysis. J. Classif. 16, (2), 297-306 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics