Generasjon av genomet hele Chromatin konformasjon fange biblioteker fra tett trinnvis tidlig Drosophila embryo

Genetics
 

Summary

Dette verket beskriver en protokoll for generering av høy oppløsning i situ Hi-C biblioteker fra tett iscenesatt pre gastrulation Drosophila melanogaster embryoer.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Hug, C. B., Vaquerizas, J. M. Generation of Genome-wide Chromatin Conformation Capture Libraries from Tightly Staged Early Drosophila Embryos. J. Vis. Exp. (140), e57001, doi:10.3791/57001 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Undersøker tredimensjonale arkitektur chromatin tilbyr uvurderlig innsikt mekanismer av genet regulering. Her beskriver vi en protokoll for å utføre den chromatin konformasjon fange teknikk i situ Hi-C på iscenesatt Drosophila melanogaster embryoet populasjoner. Resultatet er en sekvensering bibliotek som lar tilordningen av alle chromatin vekselsvirkningene som kjernen i ett enkelt eksperiment. Fosteret sortering gjøres manuelt med fluorescerende stereo mikroskop og en transgene flua linjen som inneholder en kjernefysisk markør. Bruker denne teknikken, fosteret befolkningsgrupper fra hver kjernefysiske divisjon syklus, og med definerte celle syklus status, kan fås med svært høy renhet. Protokollen kan også tilpasses til å sortere eldre embryo utover gastrulation. Sorterte embryo brukes som inndata for i situ Hi-C. Alle eksperimenter, inkludert sekvensering biblioteket forberedelse, kan fullføres på fem dager. Protokollen har lav input krav og fungerer pålitelig med 20 blastoderm scenen embryo som inndata materiale. Sluttresultatet er en sekvensering bibliotek for neste generasjons sekvensering. Etter sekvensering, kan dataene behandles i genomet hele chromatin interaksjon kart som kan analyseres ved hjelp av en rekke tilgjengelige verktøy til å få informasjon om topologisk knytte domenestruktur (TAD), chromatin looper og chromatin rom under Drosophila utvikling.

Introduction

Chromatin konformasjon fange (3C) har dukket opp som en svært nyttig metode for å studere topologien for chromatin i kjernen1. 3C varianten Hi-C kan måle kontakt frekvenser av alle chromatin vekselsvirkningene som kjernen i et enkelt eksperiment2. Anvendelse av Hi-C har spilt en viktig rolle i oppdagelsen og karakterisering av mange grunnleggende prinsipper for chromatin organisasjonen, som var TADs, avdelinger og looper3,4,5.

Studier av chromatin arkitektur i forbindelse med utviklingsmessige overganger og celledifferensiering brukes stadig å rakne mekanismer av genet regulering under disse prosessene6,7,8, 9. En modell organismer av stor interesse er Drosophila melanogaster, som utvikling og genom blir godt preget. Imidlertid gjennomført få studier som undersøker chromatin arkitektur i Drosophila utenfor i vitro vev kultur er10,11. I embryoer ble 16 til 18 h innlegget befruktning, var TADs og avdelinger minner om lignende strukturer i pattedyr identifisert10, som reiser spørsmålet om hvilken rolle de spiller i genet regulering i Drosophila embryo utvikling. Spesielt i de tidlige stadiene av utviklingen, før gastrulation, er slike studier teknisk utfordrende. Før gastrulation gjennomgå Drosophila embryo 13 synkron kjernefysiske divisjoner som fortsetter i en svært rask tempo 8 – 60 min per syklus12,13. Mangel på visuelle funksjoner til å skille de ulike fasene gjør det vanskelig å få tett trinnvis embryoet materiale i tilstrekkelige mengder.

For å utvikle en protokoll som tillater studere chromatin arkitektur i Drosophila utviklingen kjernefysiske syklus oppløsning, vi kombinert to eksisterende teknikker: i situ Hi-C, som tillater generering av høy oppløsning hele genomet kontakt kart5og embryo iscenesettelse bruke en transgene Drosophila uttrykke en eGFP-PCNA transgene13,14. Denne transgene regionaliserer til kjernen under interphase og knuses gjennom syncytial blastoderm under mitose. Med denne egenskapen, er det mulig å enkelt skille ulike stadier av tetthet deres kjernefysiske og mitotisk embryo ved spredning av GFP.

Sammen disse teknikkene kan studere tredimensjonale strukturen i chromatin i høy oppløsning fra så lite som 20 Drosophila embryoer. Denne protokollen inneholder instruksjoner for høsting og sortere Drosophila embryo hente bestander av embryoer fra en enkelt kjernefysiske divisjon syklus. Videre beskriver hvordan de innhentet embryoene brukes til å utføre i situ Hi-C. Sluttresultatet er en nukleotid biblioteket egnet for sekvensering på neste generasjons sekvensering maskiner. Den resulterende sekvensering lest kan deretter behandles i detaljert chromatin interaksjon kart som dekker hele Drosophila genomet.

Protocol

1. drosophila Embryo samling

Merk: En tilsvarende embryoet samling kan utføres som vist i en tidligere publikasjon15.

  1. Overføre unge eGFP-PCNA fluer (< 1 uke gamle) bur egg samling med yeasted samling plater16 (1% etanol, 1% eddiksyre og 4% agar).
  2. Flytte samling bur til en inkubator satt på 25 ° C. Inkubasjon i 1-2 dager før høsting forbedrer egg avkastningen betydelig. Endre samling plater to ganger om dagen.
  3. Fjern platene som inneholder embryoer fra samlingen kammeret i 30-60 min intervaller. Mindre intervaller medføre færre embryoer, men strammere distribusjon av utviklingsstadier. Samle fra flere bur parallelt så som ideelt > 200 egg legges hvert 30-60 min.
  4. Lagre platene ved 25 ° C før embryoene når ønsket. For blastoderm trinn ruge embryo (kjernefysisk syklus 14), for ca 2 timer.
  5. Etter 2 timer med inkubering, legge til vann fra en sprøyting flasken samlingen plate slik at hele overflaten er dekket med vann. Suspendere embryoer og gjær med en myk børste.
  6. Hell resuspended embryoer fra samlingen plate i et embryo samling kurven (kommersielle celle siler med 100 µm porestørrelse eller hjemmelaget kurver17 fungerer bra), legge til ekstra vann fra en sprøyting flasken, om nødvendig. På dette stadiet, kan du kombinere embryoer fra alle platene som ble samlet i parallell. Grupperte prøven representerer en enkelt satsvis.
  7. Vask embryo godt av Skyllekurv med vann fra en sprøyting flasken for 30 s til alle gjær rester er vasket bort.
  8. Dechorionate embryo ved å plassere samling kurven i en 2,5% natriumhypokloritt løsning i vann. Lys agitasjon av virvlende forenkler fjerningen av plasmocitara. Fortsett til embryoer er tilstrekkelig hydrofobe slik at de flyter på overflaten av løsningen når kurven er løftes ut og neddykket igjen, som bør ta ~1.75–2 min.
    Forsiktig: natriumhypokloritt er etsende. Bruke riktig personlig verneutstyr. Løsninger som inneholder < 10% natriumhypokloritt kan vanligvis kastes i vasken, må du sjekke med regelverket for verten institute.
  9. Fjerne kurven fra løsningen og skyll grundig med vann fra en sprøyting flasken Inntil blekemiddel lukten ikke er merkbar.

2. embryo fiksering

Merk: Optimal fiksering forhold, hovedsakelig konsentrasjonen av vaskemiddel, formaldehyd og varigheten av fiksering, må være empirisk bestemt å passe scenen av embryoene. For etapper rundt syncytial blastoderm, en endelig konsentrasjon på 0,5% Triton X-100 og 1,8% formaldehyd i den vandige fasen fungerer bra. For fasen utover embryoet SS9 kan ytterligere optimalisering av disse parameterne være nødvendig. Alle løsninger brukes under fiksering og sortering skal inneholde proteasehemmere.

  1. Invertere samling kurv og plasserer den over en 15 mL konisk sentrifugering rør. Tømme embryoer fra kurven inn i røret ved hjelp av en Pasteur pipette dispensing PBS-T (PBS, 0,5% Triton X-100).
  2. La embryo bosette nederst og justere det totale volumet til 2 mL med PBS-T.
  3. Legg til 6 mL av heptane og 100 µL av 37% formaldehyd i vann.
    Forsiktig: Heptane og formaldehyd er giftig ved innånding eller etter hudkontakt. Bruke riktig personlig verneutstyr og arbeid i avtrekksvifte. Avfall som inneholder heptane eller formaldehyd må kastes separat etter vert instituttets forskrifter.
  4. Etter tillegg av formaldehyd, starter en tidtaker som 15 min og kraftig riste røret opp og ned for 1 min hånd. Den vandige og organiske fasen vil kombinere til skjemaet en sjampo-lignende konsistens.
  5. Rist på en rotatory mikser inntil 10 min etter tillegg av formaldehyd.
  6. Sentrifuge på 500 x g for 1 min ved romtemperatur å samle embryo nederst på røret.
  7. Sug opp hele sjampo-aktig væske og kaste den, ta vare ikke å Sug opp alle embryoer. Lite gjenværende mengder sjampo som nedbryting skape ikke problemer.
  8. 15 minutter etter tilsetning av formaldehyd, resuspend embryoene i 5 mL av PBS-T med 125 mM glysin å slukke formaldehyd. Bland kraftig ved å riste opp og ned for 1 min.
  9. Sentrifuge på 500 x g ved romtemperatur for 1 min og Sug opp nedbryting.
  10. Vask embryo ved resuspending dem i 5 mL av iskalde PBS-T. La embryo bosette og leveringstanken alle supernatant.
  11. Gjenta vask i trinn 2.10 to ganger.
  12. Holde embryoer på is til sortering. Vanligvis er det en god idé å samle 3-4 grupper av fly embryo før du fortsetter til sortering. Men skal embryo sorteres samme dag. Langvarig oppbevaring på isen eller i kjøleskapet fører til endrede embryoet morfologi.

3. embryo sortering

Merk: Sortering kan gjøres på noen fluorescerende stereo mikroskop utstyrt med et GFP-filter på 60 – 80 X forstørrelse.

  1. Bruker en 1000 µL pipette, overføre en gruppe av rundt 100 embryo til et lite glass fartøy egnet for sortering, fortrinnsvis av en mørk farge, og plasser den på is.
  2. Sorter embryo av kjernefysiske tetthet og celle syklus status (figur 1) ved å trykke ønskelig embryo en separat haug med en nål eller sprøyten tips.
    1. Fjern alle embryoer med spredte, ikke-nukleære distribusjon av eGFP-PCNA (figur 1E). Også bør embryo som delvis viser et ikke-kjernefysisk GFP signal fjernes.
    2. Til hjelp i sorteringen, samle en rekke referanse embryoer på kjernefysiske syklus 12, 13 og 14 i hver gruppe bruker bildene i figur 1 som en guide. Bruk denne oppstillingen for å matche embryoene til en ukjent scenen med en av de referanse embryoene for å bestemme deres scenen.
    3. For å bekrefte det utviklingen scenen for referanse embryo, måle kjernefysiske tettheten av imaging embryoet og teller hvor mange kjerner på overflaten av embryoet i et område på 2500 µm2 ved hjelp av bildebehandlingsprogramvare som gir avstand.
      Merk: Forventet antall kjerner for et område på 2500 µm2 er 12 til 16 kjerner på kjernefysiske syklus 12 og 20 til 30 kjerner kjernefysiske syklus 1313.
  3. Når alle embryoer på det aktuelle stadiet er skilt, ta bilder av embryo for dokumentasjon og kvalitetskontroll. Hvis stereo mikroskopet ikke er utstyrt med en Kameramodul, brukes alle epifluorescence mikroskopet med GFP filtre.
  4. Pipetter opp de ønskede embryoene bruker en 1000 µL pipette, overføring til en frisk, og plasser dem på isen.
  5. Fortsett til nok embryo sorteres for planlagte eksperimentet. Embryo eldre enn trinn 9, er vanligvis 20 embryoer tilstrekkelig for en i situ Hi-C eksperimentet. På kjernefysiske syklus 12 er 80 embryoer et godt utgangspunkt. I tidligere sykluser, bør omtrent hvor mange embryoer dobles for hver syklus.
  6. Bassenget og split embryo i 1,5 mL rør slik at en tube inneholder nok embryo for en enkelt i situ Hi-C eksperimenter. Det anbefales å bruke rør med lav DNA bindende egenskaper, siden samme rør brukes for hele protokollen og adsorpsjon av DNA kan føre til betydelige tap på DNA Lavinnblanding.
  7. Spinn rør kort på 100 x g ved romtemperatur og fjerne nedbryting. Embryoene bør være så tørr som mulig for frysing.
  8. Flash fryse embryo av submerging rør i flytende nitrogen og store på-80 ° C.

4. i Situ Hei-C

  1. Lysis
    1. Plasser rør med frosne embryo på isen.
    2. Resuspend embryo i 500 µL av iskalde lyseringsbuffer (10 mM Tris-Cl pH 8.0, 10 mM NaCl, 0,2% IGEPAL CA-630, proteasehemmere, oppløst i vann). Deretter vente 1 min for å la embryo bosette seg på bunnen av røret.
    3. Grind embryo bruker en metall mikro støter, pre avkjølt på is, som er utformet for å passe tett en 1,5 mL microcentrifuge tube.
      1. For å unngå agitating av embryo, sett støter sakte til det berører bunnen av røret, trykk ned, og deretter male ved å rotere pistil to ganger i begge retninger.
      2. Løft støter veldig lett, Skyv til bunnen av røret igjen, og gjenta sliping.
      3. Gjenta 4.1.3.2 10 ganger, eller til embryoene er helt lysed. Løsningen skal være homogene og ingen gjenværende store biter av embryo skal være.
    4. Inkuber homogenisert suspensjon på is 15 min. spinn på 1000 x g, 4 ° C i 5 minutter, og kast nedbryting.
    5. Vask pellet av resuspending i 500 µL iskald lyseringsbuffer, pipettering opp og ned.
    6. Spinn igjen som 4.1.4, og forkaste nedbryting.
    7. Resuspend vasket pellet i 100 µL av 0,5% natrium dodecyl sulfate (SDS), pipettering opp og ned. Permeabilize kjerner av rugende i 10 min på 65 ° C i en oppvarming blokk. Slukke SDS ved å legge til 50 µL av 10% Triton X-100 og 120 µL vann. Bland ved flicking røret.
    8. Ruge på 37 ° C i 15 min i varme blokk.
  2. Begrensning enzym fordøyelse
    1. Legg til 25 µL av 10 x begrensning enzym buffer og 20 U av 5 U/µL MboI. Bland ved flicking røret.
    2. Fordøye DNA av rugende for 90 min på 37 ° C i varme blokk under liten agitasjon (750 rpm).
    3. Legg en annen 20 U MboI og fortsette inkubasjonstiden for 90 min.
    4. Varme-Deaktiver MboI av rugende ved 62 ° C i 20 min.
  3. Overheng utfylling
    Merk: Fylle ut overheng med biotinylated dATP innrømmer utvalg av bestemte samskrevet fragmenter. Biotin-dATP på hemorroider veikryss er beskyttet mot exonuclease aktiviteten av T4 DNA Polymerase (inndelingen 4.6), mens biotin-dATP på unligated Butte endene er effektivt fjernet. Rullegardinmenyen hjelp streptavidin-belagt perler i delen 4.7 derfor spesielt beriker for samskrevet, chimeric DNA fragmenter.
    1. Legge til 18 µL av 0.4 mM biotin-14-dATP, 2,25 µL av en uendret dCTP/dGTP/dTTP blanding (3,3 mM hver) og 8 µL av 5 U/µL DNA Polymerase I Klenow Fragment.
    2. Bland ved å sveipe røret og ruge ved 37 ° C i 90 min i varme blokk.
  4. Hemorroider
    1. Legg 657 µL av vann, 120 µL av 10 x T4 DNA Ligase Buffer, 100 µL av 10% Triton X-100, 6 µL av 20 mg/mL bovin serum albumin (BSA), og blandingen av flicking røret. Til slutt Legg 5 µL av 5 U/µL T4 DNA Ligase og bland ved å sveipe røret.
    2. Rotere rør forsiktig (20 rpm) ved romtemperatur for 2T.
    3. Legge til en andre avbetaling av 5 µL av 5 U/µL T4 DNA Ligase og fortsette roterende for 2 mer h.
    4. Nedspinning kjerner på 2500 x g i 5 min og kast nedbryting.
  5. DNA utvinning
    1. Resuspend pellets i 500 µL utvinning bufferen (50 mM Tris-Cl pH 8.0, 50 mM NaCl, 1 mM Ethylenediaminetetraacetic syre (EDTA), 1% SDS, oppløst i vann) og legge 20 µL av 20 mg/mL proteinasen K. blanding av flicking røret.
    2. Fordøye protein av rugende ved 55 ° C i 30 min, rister på 1000 rpm.
    3. Å de-krysskobling, legge til 130 µL av 5 M NaCl og ruge over natten på 68 ° C, rister på 1000 rpm.
    4. Pipetter utvalg i en ny 2 mL tube, fortrinnsvis med lav DNA bindende egenskaper.
    5. Legge til 0,1 x volumer (63 µL) av 3 M natrium acetate pH 5.2 og 2 µL av 15 mg/mL GlycoBlue. Bland godt ved å snu. Legge til 1,6 x volumer (1008 µL) av ren absolutt etanol og bland ved å snu.
    6. Inkuber ved-80 ° C i 15 min. sentrifuge 20.000 x g på 4 ° C i minst 30 min. DNA-pellets er ofte svært liten, nesten usynlig, og kan bare bli sett på grunn av den blå fargen på GlycoBlue.
    7. Fjerne nedbryting nøye, flytte pipette spissen inn i røret langs motsatt vegg fra hvor DNA pellet ligger. Lite gjenværende dråper fjernes ofte lett under dette trinnet og de følgende vasker ved å skyve dem ut av rør med en P10 tips enn pipettering dem ut.
    8. Vask pellet ved å legge til 800 µL av 70% etanol. Bland ved å snu og sentrifuge 20.000 x g ved romtemperatur for 5 min. Gjenta denne skyller minst én gang.
    9. Fjerne alle spor av etanol og la den tube stående med lokk åpent for opptil 5 min til air-dry. Når ingen væsker er igjen, legger du til 50 µL av 10 mM Tris-Cl pH 8.0. Gjentatte ganger Pipetter løsningen over området på veggen av røret der pellet lå til solubilize DNA.
    10. Legg 1 µL av 20 mg/mL RNase A, blandingen av flicking røret, og ruge på 37 ° C i 15 min å fordøye RNA. Prøven kan nå lagres i kjøleskapet over natten eller frosset ved 20 ° C på ubestemt tid.
    11. Sjekk konsentrasjonen av DNA ved å bruke en fluorescerende farge basert analysen i henhold til produsentens instruksjoner. Den totale mengden DNA i utvalget bør være minst 10 ng, ellers for lite materiale er tilgjengelig for forsterkning og biblioteket kompleksitet vil trolig bli lav. Når dette skjer, mengden starter materiale sannsynligvis ikke var tilstrekkelig, eller materiale gikk tapt underveis kanskje under lyse og nedbør.
  6. Biotin fjerning og DNA skråstilling
    1. Legg sammen 12 µL 10 x T4 DNA Polymerase bufferen, 3 µL av 1 mM dATP, 3 µL av 1 mM dGTP og 46 µL av vann. Bland ved flicking røret. Legge til 5 µL av 3 U/mL T4 DNA Polymerase, bland ved å sveipe røret og ruge ved 20 ° C i 30 min.
    2. Legg 3 µL av 0,5 M EDTA stoppe reaksjonen, og bruk vann for å bringe prøven til et volum på ca 120 µL.
    3. Skråstille DNA til en størrelse på 200-400 bp bruker en sonication enhet ifølge instruksjonene fra produsenten. Bruker sonicator som er nevnt i Tabellen for materiale, programmet følgende er riktig: 2 sykluser hver 50 s, 10% plikt, intensitet 5, 200 sykluser/utbrudd.
  7. Biotin pulldown
    1. Pipetter 30 µL av 10 mg/mL streptavidin belagt magnetiske perler i en ny tube skille dem på en magnetisk stand og forkaste nedbryting.
    2. Resuspend perler i 1 x B & W buffer (5 mM Tris-Cl pH 7.4, 0,5 mM EDTA, 1 M NaCl, oppløst i vann) + 0,1% Triton X-100 og blanding av vortexing. Plassere rør på en magnetisk stå og vente i 1 – 5 min til perlene skilles, avhengig av merke og modell.
    3. Sug opp og kast nedbryting mens skyve pipette spissen langs motsatt der perlene er plassert. Resuspend perler i 120 µL av 2 x B & W buffer (10 mM Tris-Cl pH 7.4, 1 mM EDTA, og 2 M NaCl). Bland ved vortexing.
    4. Overføre skråstilte DNA til en ny lav DNA bindende tube, og bland med 120 µL av perle suspensjon i 2 X B & W buffer av vortexing. Rotere perler med DNA-prøve 20 RPM i 15 min.
    5. Separate perler på en magnetisk stand og forkaste nedbryting.
    6. Resuspend perler i 600 µL av 1 x B & W + 0,1% Triton X-100 og ruge ved 55 ° C i 2 minutter, rister på 1000 rpm. Etter separasjon, forkaste nedbryting. Gjenta denne vask en gang.
    7. Vask perler gang med 600 µL av 10 mM Tris-Cl pH 8.0, og kaste nedbryting etter separasjon.
    8. Resuspend perler i 50 µL av 10 mM Tris-Cl pH 8.0.

5. sekvensering biblioteket forberedelse

Merk: Alle bibliotek trinnene er gjort med komponenter fra en reklamen DNA biblioteket forberedelse kit (se Tabell for materiale). Men kan alternative kits eller andre erstattes. Nedbør tendens til skjemaet i biblioteket forberedelse agenter under fryser lagring. Det er derfor viktig å sørge for at alle nedbør er oppløst før du bruker reagenser.

  1. Slutten reparasjon
    1. Overføre perle suspensjon i 50 µL av 10 mM Tris-Cl pH 8.0 til en ny PCR-tube.
    2. Legg 3 µL slutten Prep enzym mix og 7 µL slutten Prep reaksjon bufferen. Bland ved pipettering opp og ned.
    3. Overføre tube til en termisk cycler og kjøre følgende program: 20 ° C i 30 min, 65 ° C for 30 min og hold på 4 ° C.
  2. Kortet hemorroider
    1. Legge til 30 µL av Ligation Master Mix, 2,5 µL av 1,5 µM sekvensering adapter (fortynnet til 1,5 µM fra lager) og 1 µL av Ligation Enhancer å perle suspensjon. Bland ved pipettering opp og ned.
    2. Inkuber ved 20 ° C i 15 minutter i en termisk cycler.
    3. Legge 3 µL av brukeren enzym. Bland ved pipettering opp og ned.
    4. Ruge på 37 ° C i 15 min i en termisk cycler.
    5. Separate perler på en magnetisk stand og fjerne nedbryting.
    6. Å vaske perler, resuspend perler i 100 µL av 1 x B & W buffer + 0,1% Triton X-100. Blanding av vortexing, og overføre til en ny microcentrifuge tube. Separate perler på en magnetisk stand og fjerne nedbryting.
    7. Gjenta denne vask bruk 600 µL av samme bufferen.
    8. Resuspend perler i 600 µL av 10 mM Tris-Cl pH 8.0, blanding av vortexing, og Overfør perler til en ny tube.
    9. Skille perler på en magnetisk stand, forkaste nedbryting og resuspend perler i 50 µL av 10 mM Tris-Cl pH 8.0.
  3. PCR forsterkning
    1. Forberede to PCR rør og i hver, bland 25 µL Polymerase Master mix, 1,5 µL av 10 µM fremover (ikke er indekserte) PCR primer og 1,5 µL av 10 µM bakover (indekserte) PCR primer.
      Merk: Fremover (ikke er indekserte) PCR primer:
      5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC * T-3´.
      Omvendt (indekserte) PCR primer:
      5'-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC * T-3´. * Angir phosphorothioate obligasjoner og Ns i indekserte PCR primer.
    2. I hver retning, legger du til 22 µL av perle suspensjon og blanding av pipettering opp og ned.
    3. Kjøre PCR bruker følgende program: 98 ° C i 1 min, (98 ° C i 15 s, 65 ° C for 75 s, gradvis 1.5 ° C/s) gjentatt 9 - 12 ganger, 65 ° C i 5 minutter, og hold på 4 ° C.
      Merk: Antall forsterkning sykluser har bestemmes empirisk. Vi fant imidlertid at biblioteker som krevde mer enn 12 sykluser var generelt lav kompleksitet og ikke resulterte i høy kvalitet Hi-C kart. På den annen side, var biblioteker som kreves mindre enn 12 sykluser ikke negativt påvirket av forsterke for en full 12 sykluser. Derfor er det mulig å standard 12 sykluser av forsterkning.
    4. Bassenget to PCR reaksjoner i en enkelt microcentrifuge tube, separate perler på en magnetisk stand, og overføre nedbryting inneholder biblioteket til en ny tube.
  4. Størrelse
    1. Ta Ampure XP perle suspensjon til romtemperatur og bland godt ved å riste.
    2. Bringe antall grupperte PCR reaksjonen til nøyaktig 200 µL med vann. Under PCR og magnetiske separasjon, noen av det originale volumet er vanligvis tapt. Kontroller volumet ved å sette Pipetter til 200 µL og Sug opp hele volumet av reaksjonen. Hvis luften er pustende, mer vann må legges. Hvis volumet overskrider 200 µL, justere volumet av perler lagt til i trinn 5.4.3 og 5.4.6 proporsjonalt.
      Merk: Volumene i parentes er gyldig hvis det totale volumet av grupperte PCR reaksjoner er nøyaktig 200 µL.
    3. Legg 0.55 x volumer (110 µL) Ampure XP perle hjuloppheng og bland av pipettering opp og ned minst 10 ganger.
    4. Inkuber ved romtemperatur for 5 min, separat perler på en magnetisk stå i 5 minutter.
    5. Flytte nedbryting til en ny tube. Kast røret med perler. Perlene har bundet DNA > 700 bp, som er for stor til å være sekvensielt.
    6. Nedbryting, legge til 0,2 x volumer (40 µL, resulterer i totalt 0,75 x Ampure buffer i eksemplet) Ampure XP perle suspensjon og blanding av pipettering opp og ned 10 ganger.
    7. Inkuber ved romtemperatur for 5 min, separat perler på en magnetisk stå i 5 minutter.
    8. Forkaste nedbryting som inneholder DNA < 200 bp, som inkluderer gratis primere, primer dimers og fragmenter for liten som ble sekvensert.
    9. La røret på magnetiske stand. Å vaske perler, legge til 700 µL av 80% etanol, tar seg ikke forstyrre perle pellets og ruge for 30 s.
    10. Forkaste nedbryting, så ta tuben av magnetiske stativet og resuspend perler i 100 µL av 10 mM Tris-Cl pH 8.0. Blande av pipettering opp og ned 10 ganger og ruge ved romtemperatur for 1 min.
    11. Legg 0.8 x volumer (80 µL) av Ampure XP perle suspensjon. Blande av pipettering opp og ned 10 ganger og ruge ved romtemperatur for 5 min. Denne andre runden av nedre grense størrelse utvalg sikrer at siste biblioteket er helt gratis primere og primer dimers.
    12. Separat perler på en magnetisk står for 5 min og kast nedbryting.
    13. Vask perle pellet to ganger med 700 µL av 80% etanol for 30 s hver, mens røret på magnetiske standen, som ovenfor.
    14. Med røret fortsatt på magnetiske standen, fjerne alle spor av etanol. Det hjelper for å presse dråper av etanol ut av røret ved hjelp av en P10 pipette. La gjenværende etanol fordampe maksimum 5 minutter.
    15. Ta rør av magnetiske stativet og resuspend perler i 50 µL av 10 mM Tris-Cl pH 8.0. Bland ved pipettering opp og ned 10 ganger.
    16. Inkuber ved romtemperatur for 5 min og separat perler på en magnetisk stand.
    17. Overføre nedbryting slik frisk. Dette er siste Hi-C biblioteket, klar til å være kvantifisert og rekkefølge på neste generasjons sekvensering maskiner, i henhold til produsentens instruksjoner.

Representative Results

Sortert embryoet bestander på kjernefysiske syklus 12, 13 og 14 (tilsvarer 1:30 1:45 og 2:10 timer legge befruktning, henholdsvis12) og 3-4 h innlegget befruktning (hpf) ble oppnådd i henhold til prosedyrene som er beskrevet i protokollen. Ved å ta bilder av eGFP-PCNA hvert sorterte embryoet parti, er det mulig å dokumentere nøyaktig scenen og celle syklus status for hver enkelt embryo som brukes i nedstrøms eksperimenter. Eksempelbilder av embryoer fra sorterte populasjoner er vist i figur 1B-E. Resultatet av i situ Hi-C protokollen er en nukleotid biblioteket klar som ble sekvensert på neste generasjons sekvensering maskiner. For dette formålet er en siste biblioteket konsentrasjon av minst 2-4 nM vanligvis nødvendig. Bruke anbefalte mengder input materiale, denne konsentrasjonen er pålitelig oppnådd (tabell 1).

Forventet størrelsesDistribusjon av DNA etter størrelse er mellom 300-600 bp, med maksimalt 500 bp (figur 2A), avhengig av nøyaktig klippe og størrelse utvalg parametere. Sekvensering anbefaler vi sammen-end leser 75 bp lengden å minimere antall på begrensning fragmenter i genomet. Høyoppløselig kart med 1 – 2 kb bin størrelse kan fås fra 400 millioner leser. Vi anbefaler sekvensering flere biologiske gjentak med en lavere dybde av ~ 150 millioner leser hver, i stedet for sekvensering en enkelt gjenskape på svært høy dybde. Dette gjør vurdering av biologisk variasjon og fører til et lavere antall kasserte leser på grunn av PCR duplisering. For visuell representasjon, kan gjentak kombineres. Før du forplikter deg til sekvensering et utvalg på høy dybde, anbefaler vi kjører prøver ved grunne sekvensering (noen millioner leser per eksempel) å bestemme grunnleggende biblioteket kvalitet parametere som figur 2B.

Analyse av Hi-C data krever betydelig beregningsorientert ressurser og bioinformatikk kompetanse. Som en grov oversikt, den sammenkoblede lest tilordnes uavhengig referanse genomet, resulterende justeringer filtreres for kvalitet og retning, deretter en matrise av kontakter på en bestemt hylle oppløsning eller fragment kan genereres fra den filtrerte justeringer. Kontakt matrix er grunnlaget for alle ytterligere nedstrøms analyse utforske var TADs, løkker og avdelinger. Flere bioinformatikk rørledninger er tilgjengelig for den første analysen i sekvensering lyder, som aktiverer behandling av lese rådata i kontakt matriser uten mye spesialiserte bioinformatikk kunnskap18,19, 20,21,22,23. Hvordan videre analyse er gjennomført avhenger i stor grad på den eksakte biologiske spørsmålet under studien og kreve betydelig erfaring innen programmering og scripting i R eller Python. Men flere verktøy og algoritmer til ring var TADs er tilgjengelig5,,24,,25,,26,,27,,28, i tillegg til å analysere og utforske Hi-C data i webleseren og som frittstående desktop-applikasjoner29,30,31,32.

Når behandlet, kan kvaliteten på biblioteket bestemmes ved hjelp av ulike beregninger (figur 2B). Først bør frekvensen av PCR duplikater, som er antall sekvensert Les par fremkommer fra samme opprinnelige molekyl, være så lavt som mulig å begrense mengden av bortkastet sekvens. Men selv biblioteker med > 40% PCR duplisering kan bearbeides til høy kvalitet kontakt kart hvis duplikatene er filtrert. Andre bør av filtrert på grunn av retning, som beskrevet i4, prisen konsekvent være lavere enn 10% av justert Les.

Under pre gastrular utviklingen av Drosophila mellom kjernefysiske syklus 12 og 14 er kjernefysiske arkitektur drastisk ombygde33 (Figur 3). Noen var TADs oppdages kjernefysiske syklus 12, og den generelle fordelingen av kontakter er svært glatt uten mange merkes funksjoner. Dette er dramatisk endret på kjernefysiske syklus 13 og 14, når var TADs er stadig mer fremtredende og uspesifikke langtrekkende kontakter er oppbrukt.

Figure 1
Figur 1: representant bilder av eGFP-PCNA embryo under sortering. (A) eGFP-PCNA signalet fra en usortert befolkning av embryo etter 60 min samling og 2t inkubasjon på 25 ° C (B-E) eksempler på embryoer fra sorterte populasjoner på kjernefysiske syklus 12 (B), kjernefysiske syklus 13 (C), 14 () kjernefysiske syklus D), og fra embryo gjennomgår synkron mitose (E). Skalere barer = 200 µm. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: Eksempler på i situ Hi-C biblioteket kvalitet beregninger. (A) Bioanalyzer spor viser fordelingen av DNA fragment størrelser fra en vellykket Hi-C library (bibliotek 1, topp) og et bibliotek som viser en topp på fragmenter som er for stor for sekvensering (biblioteket 2, bunn). Biblioteket 2 var vellykket sekvensert, men enda større mengder uønsket DNA fragmenter kan føre til redusert sekvensering avkastning. (B) filtrering statistikk over to Hei-C-bibliotek: vises er antall justert Les par som er utelatt fra videre analyse på grunn av Les retning og avstand (innover, utover)4 eller PCR duplisering (like). I hver bar tegnes leser passerer filteret (gjenværende) og sviktende (filtrert). Andelen leser passerer filteret vises i tillegg som tekst. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: Hei-C samhandling kart fra trinnvis embryoer. Hei-C samhandling kartene er binned 10 kb oppløsning og balansert som beskrevet før33. Vist er et område på Kromosom 2 L. Klikk her for å se en større versjon av dette tallet.

Biblioteket Scenen Antall embryo Beløp DNA før klipping (ng) PCR sykluser Siste biblioteket konsentrasjon (nM)
1 kjernefysisk syklus 12 71 46 12 28,2
2 kjernefysisk syklus 12 46 40 12 22.2
3 kjernefysisk syklus 12 60 13 13 12.3
4 kjernefysisk syklus 13 36 39 12 22.2
5 kjernefysisk syklus 13 35 10 12 5.0
6 kjernefysisk syklus 13 48 18 12 8.7
7 kjernefysisk syklus 14 33 30 12 39.8
8 kjernefysisk syklus 14 24 36 12 20.4
9 kjernefysisk syklus 14 14 8 12 4.2
10 3-4 hpf 17 30 12 24,0
11 3-4 hpf 18 42 11 19.1
12 3-4 hpf 22 63 11 48,4

Tabell 1: liste over representant sekvensering biblioteket statistikk. For hvert bibliotek i listen antall embryo som ble brukt til sin generasjon, mengden totalt DNA før biotin pulldown og skråstilling målt ved FROLINA, sykluser antall PCR for forsterkning og endelige konsentrasjonen av sekvensering biblioteket etter rensing og størrelse er angitt.

Discussion

Protokollen presenteres her er svært effektiv til å generere høy kvalitet kart av den chromatin arkitekturen i tidlig Drosophila embryoer. Sammenlignet med en tidligere protokollen34, bruker tilnærming som er beskrevet her en oppdatert i situ Hi-C prosedyren5, som resulterer i raskere behandling, høyere oppløsning, og mindre reagens forbruk. Den generelle prosedyren inkludert i situ Hi-C protokoll forventes å arbeide på en rekke etapper og eksperimentelle systemer foruten Drosophila. Siden protokollen har en lav input kravet, kan den også brukes på isolerte celle populasjoner. I Drosophila, når bruker protokollen for embryoer utenfor område beskrevet her, noen parametere, kanskje spesielt fiksering av materialet, må justeres. Siden eldre embryo utvikle en svært ugjennomtrengelig cuticle, kan øke konsentrasjonen av formaldehyd og forlenge fiksering være hensiktsmessig. For innsamling av embryo på stadier enn kjernefysiske syklus 14, inkubasjon tider embryo ved 25 ° C i trinn 1.4 må justeres som følger: kjernefysiske syklus 12: 70 min; kjernefysisk syklus 13, 90 min; 3-4 hpf, 3:30 h.

Under 13 cleavage divisjonene (stadium 1-4), fordobles kjerner tettheten omtrent hver avdeling. Kjerner kan lett identifiseres av deres lys GFP fluorescens. Under mitose, eGFP-PCNA finnes ikke i kjernen og dekningen er spredt over hele fosteret. Denne funksjonen gjør identifiserende embryo som er under en synkron cleavage divisjon mulig. For å studere chromatin konformasjon, er disse mitotisk embryo vanligvis ikke ønskelig, siden mitotisk organiseringen av chromatin er drastisk annerledes enn de interphase organisasjon35. Det er mulig å tilpasse protokollen for å velge spesielt embryo gjennomgår en synkron mitotisk divisjon. I dette tilfellet bare embryo med spredte, ikke-nukleære distribusjon av eGFP-PCNA bør holdes, og alle andre embryo skal kastes. Siden kjernefysiske tettheten ikke kan bestemmes, må alternative metoder til scenen embryo av deres morfologi vises i overført * lys være ansatt. Pol cellene og kjerner i fosteret periferien indikerer at fosteret har fullført minst kjernefysiske syklus 9, mens synlig cellularization i periferien angir kjernefysiske syklus 1412.

Hei-C eksperimenter utføres med hell med et bredt utvalg av begrensning enzymer5. Gjeldende tilnærminger bruker vanligvis enzymer som gjenkjenner enten en 4-base rekkefølge, for eksempel MboI eller en 6-base anerkjennelse webområdet, for eksempel HindIII. Fordelen av 4-base cutters over 6-base kniver er at de tilbyr høyere potensielle oppløsning, gitt nok sekvensering dybde og en jevnere dekning av begrensning nettsteder over genomet. Det er ingen klar fordel i å velge en 4-base kutter over ytterligere5,23,36,37. De to vanligste enzymene, MboI og DpnII, erkjenner begge det samme GATC anerkjennelse området. DpnII er mindre sensitiv for CpG metylering, som er ingen bekymring i Drosophila. Protokollen presenteres her kan også være fullført med DpnII som en begrensning enzym. I delen 4.2. begrensning enzym og buffer må justeres for DpnII kompatibilitet, i henhold til produsentens anbefalinger.

Hvis fragment størrelsen på sekvensering biblioteket avviker betydelig fra området vises i figur 2A, kan klynge formasjon under sekvensering være mindre effektiv eller ikke. I dette tilfellet størrelsesDistribusjon etter klipping bør sjekkes og klipping parametere justert tilsvarende. Toppene i fordelingen av DNA fragmenter av veldig små (< 100 bp) eller stor (> 1000 bp) størrelser indikerer problemer med størrelse utvalg, for eksempel bære perler eller nedbryting som skal forkastes. Ofte disse bibliotekene med små topper på disse uønskede størrelser, for eksempel en avbildet, er fortsatt sekvensielt vellykket med bare en mindre nedgang i klynger effektivitet.

Høy forekomst av PCR duplisering bør unngås fordi dette drastisk reduserer antall brukbare sekvens leser. Frekvensen av PCR duplikater er direkte relatert til mengden av input materiale. Bruke flere inndata derfor lindrer vanligvis problemer med PCR duplisering.

Høyere antall leseoperasjoner filtrert på grunn av Les orientering ()finne 2B) angi utilstrekkelig fordøyelsen, som kan være et resultat av bruker for lite enzym, for mye input materiale eller ufullstendig homogenisering av embryo.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Denne forskningen ble finansiert av Max Planck Society. C.B.H. ble støttet av et fellesskap fra den internasjonale Max Planck Research School-molekylær biomedisin. Vi takker Shelby Blythe og Eric Wieschaus for vennlige gir eGFP-PCNA Drosophila melanogaster linjen.

Materials

Name Company Catalog Number Comments
Biotin-14-dATP Life Technologies 19524016
MboI New England Biolabs R0147L
DNA Polymerase I Klenow Fragment New England Biolabs M0210L
T4 DNA Ligase Thermo Fisher EL0012 T4 DNA Ligase Buffer included
T4 DNA Polymerase New England Biolabs M0203L
Proteinase K AppliChem A4392
GlycoBlue Life Technologies AM9516
Complete Ultra EDTA-free protease inhibitors Roche 5892791001
NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) New England Biolabs E7335 Sequencing Adaptor, Forward (unindexed) PCR primer and Reverse (indexed) PCR primer and USER enzyme used in the Library preparation section are components of this kit
NEBNext Ultra II DNA Library Prep Kit New England Biolabs E7645 End Prep Enzyme Mix, End Prep Reaction Buffer, Ligation Enhancer, Ligation Master Mix and Polymerase Master Mix used in the Library preparation section are components of this kit
Covaris S2 AFA System Covaris
DNA LoBind Tubes, 1.5 mL Eppendorf 0030108051
Falcon cell strainer 100 µm Corning 352360 Embryo collection baskets
37% formaldehyde VWR 437536C
Heptane AppliChem 122062.1612
M165 FC fluorescent stereo microscope Leica
M165 FC DFC camera Leica
Metal micro pestle Carl Roth P985.1 Used to lyse embryos in step 4.1.4
RNase A AppliChem A3832,0050
Dynabeads MyOne Streptavidin C1 Life Technologies 65002 Streptavidin coated magnetic beads
Ampure XP beads Beckman Coulter A63881
Qubit 3.0 Fluorometer Thermo Fisher Scientific Q33216
Qubit assay tubes Thermo Fisher Scientific Q32856
Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Q32854
Phosphate buffered saline (PBS) Sigma-Aldrich P4417
eGFP-PCNA flies Gift from S. Blythe and E. Wieschaus
Sodium hypochlorite 13% Thermo Fisher AC219255000
Triton X-100 AppliChem A4975
Tris buffer pH 8.0 (1 M) for molecular biology AppliChem A4577
NaCl AppliChem A2942
IGEPAL CA-630 Sigma-Aldrich I8896
1.5 mL microcentrifuge tubes Greiner Bio-One 616201
SDS for molecular biology AppliChem A2263
10x CutSmart buffer New England Biolabs B7204S Restriction enzyme buffer
PCR Nucleotide Mix Sigma-Aldrich 11814362001 Unmodified dCTP, dGTP, dTTP
BSA, Molecular Biology Grade New England Biolabs B9000S
EDTA 0.5 M solution for molecular biology AppliChem A4892
Sodium acetate 3 M pH 5.2 Sigma-Aldrich S7899
DynaMag-2 Magnet Life Technologies 12321D Magnetic stand
Intelli-Mixer RM-2L Omnilab 5729802 Rotator
ThermoMixer F1.5 Eppendorf 5384000012 Mixer
Small Embryo Collection Cages Flystuff.com 59-100 Egg collection cage
Centrifuge 5424 R Eppendorf 5404000413
C1000 Touch Thermal Cycler Bio-Rad 1851148
PCR tube strips Greiner Bio-One 673275
NEBuffer 2.1 New England Biolabs B7202S T4 DNA Polymerase buffer

DOWNLOAD MATERIALS LIST

References

  1. Bonev, B., Cavalli, G. Organization and function of the 3D genome. Nat Rev Genet. 17, (11), 661-678 (2016).
  2. Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, (5950), 289-293 (2009).
  3. Dixon, J. R., et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 485, (7398), 376-380 (2012).
  4. Jin, F., et al. A high-resolution map of the three-dimensional chromatin interactome in human cells. Nature. (2013).
  5. Rao, S. S. P., et al. A 3D Map of the Human Genome at Kilobase Resolution Reveals Principles of Chromatin Looping. Cell. 159, (7), 1665-1680 (2014).
  6. Darbellay, F., Duboule, D. Topological Domains, Metagenes, and the Emergence of Pleiotropic Regulations at Hox Loci. Current topics in developmental biology. 116, 299-314 (2016).
  7. Beagan, J. A., et al. Local Genome Topology Can Exhibit an Incompletely Rewired 3D-Folding State during Somatic Cell Reprogramming. Cell stem cell. 18, (5), 611-624 (2016).
  8. Andrey, G., et al. Characterization of hundreds of regulatory landscapes in developing limbs reveals two regimes of chromatin folding. Genome Res. 27, (2), 223-233 (2017).
  9. Krijger, P. H. L., de Laat, W. Regulation of disease-associated gene expression in the 3D genome. Nature Reviews. Molecular Cell Biology. 17, (12), 771-782 (2016).
  10. Sexton, T., et al. Three-dimensional folding and functional organization principles of the Drosophila genome. Cell. 148, (3), 458-472 (2012).
  11. Ghavi-Helm, Y., et al. Enhancer loops appear stable during development and are associated with paused polymerase. Nature. 512, (7512), 96-100 (2014).
  12. Foe, V. E., Alberts, B. M. Studies of nuclear and cytoplasmic behaviour during the five mitotic cycles that precede gastrulation in Drosophila embryogenesis. J Cell Sci. 61, 31-70 (1983).
  13. Blythe, S. A., Wieschaus, E. F. Zygotic Genome Activation Triggers the DNA Replication Checkpoint at the Midblastula Transition. Cell. 160, (6), 1169-1181 (2015).
  14. Blythe, S. A., Wieschaus, E. F. Establishment and maintenance of heritable chromatin structure during early Drosophila embryogenesis. eLife. 5, e20148 (2016).
  15. JoVE Science Education Database. Embryo and Larva Harvesting and Preparation. Biology I: yeast, Drosophila and C. elegans. Drosophila melanogaster. JoVE, Cambridge, MA. (2017).
  16. Sicaeros, B., O'Dowd, D. K. Preparation of Neuronal Cultures from Midgastrula Stage Drosophila Embryos. Journal of Visualized Experiments. (5), (2007).
  17. Shermoen, A. W. Preparation of Baskets for Drosophila Egg Collections, Treatments, and Incubations. Cold Spring Harbor Protocols. (10), (2008).
  18. Ay, F., Noble, W. S. Analysis methods for studying the 3D architecture of the genome. Genome biology. 16, (1), 183 (2015).
  19. Lazaris, C., Kelly, S., Ntziachristos, P., Aifantis, I., Tsirigos, A. HiC-bench: comprehensive and reproducible Hi-C data analysis designed for parameter exploration and benchmarking. BMC Genomics. 18, (1), (2017).
  20. Servant, N., et al. HiC-Pro: an optimized and flexible pipeline for Hi-C data processing. Genome Biology. 16, (1), (2015).
  21. Durand, N. C., et al. Juicer Provides a One-Click System for Analyzing Loop-Resolution Hi-C Experiments. Cell systems. 3, (1), 95-98 (2016).
  22. Lajoie, B. R., Dekker, J., Kaplan, N. The Hitchhiker's guide to Hi-C analysis: Practical guidelines. Methods. 72, 65-75 (2015).
  23. Schmitt, A. D., Hu, M., Ren, B. Genome-wide mapping and analysis of chromosome architecture. Nature Reviews. Molecular Cell Biology. 17, (12), 743-755 (2016).
  24. Shin, H., et al. TopDom: an efficient and deterministic method for identifying topological domains in genomes. Nucleic Acids Res. 44, (7), e70 (2016).
  25. Kruse, K., Hug, C. B., Hernández-Rodríguez, B., Vaquerizas, J. M. TADtool: visual parameter identification for TAD-calling algorithms. Bioinformatics. 32, (20), 3190-3192 (2016).
  26. Lévy-Leduc, C., Delattre, M., Mary-Huard, T., Robin, S. Two-dimensional segmentation for analyzing Hi-C data. Bioinformatics. 30, (17), Oxford, England. i386-i392 (2014).
  27. Filippova, D., Patro, R., Duggal, G., Kingsford, C. Identification of alternative topological domains in chromatin. Algorithms for molecular biology: AMB. 9, (1), 14 (2014).
  28. Crane, E., et al. Condensin-driven remodelling of X chromosome topology during dosage compensation. Nature. 523, (7559), 240-244 (2015).
  29. Durand, N. C., et al. Juicebox Provides a Visualization System for Hi-C Contact Maps with Unlimited Zoom. Cell systems. 3, (1), 99-101 (2016).
  30. Zhou, X., et al. Exploring long-range genome interactions using the WashU Epigenome Browser. Nature Methods. 10, (5), 375-376 (2013).
  31. Ramírez, F., et al. High-resolution TADs reveal DNA sequences underlying genome organization in flies. bioRxiv. 115063 (2017).
  32. Kerpedjiev, P., et al. HiGlass: Web-based Visual Comparison And Exploration Of Genome Interaction Maps. bioRxiv. 121889 (2017).
  33. Hug, C. B., Grimaldi, A. G., Kruse, K., Vaquerizas, J. M. Chromatin Architecture Emerges during Zygotic Genome Activation Independent of Transcription. Cell. 169, (2), (2017).
  34. Berkum, N. L., et al. Hi-C: a method to study the three-dimensional architecture of genomes. Journal of Visualized Experiments: JoVE. (39), (2010).
  35. Naumova, N., et al. Organization of the mitotic chromosome. Science. 342, (6161), 948-953 (2013).
  36. Denker, A., de Laat, W. The second decade of 3C technologies: detailed insights into nuclear organization. Genes & development. 30, (12), 1357-1382 (2016).
  37. Belaghzal, H., Dekker, J., Gibcus, J. H. Hi-C 2.0: An optimized Hi-C procedure for high-resolution genome-wide mapping of chromosome conformation. Methods (San Diego, Calif). 123, 56-65 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics