Generatie van genoom-brede chromatine conformatie Capture bibliotheken uit strak geënsceneerde vroege Drosophila embryo 's

Genetics
 

Summary

Dit werk beschrijft een protocol voor het genereren van hoge resolutie in situ Hi-C bibliotheken van strak geënsceneerd pre gastrulatie Drosophila melanogaster embryo's.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Hug, C. B., Vaquerizas, J. M. Generation of Genome-wide Chromatin Conformation Capture Libraries from Tightly Staged Early Drosophila Embryos. J. Vis. Exp. (140), e57001, doi:10.3791/57001 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Onderzoeken van de driedimensionale structuur van de chromatine biedt onschatbaar inzicht in de mechanismen van de genexpressie. Hier beschrijven we een protocol voor het uitvoeren van de chromatine conformatie capture techniek in situ Hi-C op geënsceneerd Drosophila melanogaster embryo populaties. Het resultaat is een sequencing-bibliotheek waarmee de toewijzing van alle chromatine interacties die in de kern in een enkele experiment plaatsvinden. Embryo sorteren gebeurt handmatig met behulp van een fluorescente stereo microscoop en een transgene vlieg lijn met een nucleaire marker. Met behulp van deze techniek, embryo populaties van elke cyclus van nucleaire divisie, en met de gedefinieerde celcyclus status, kan worden verkregen met zeer hoge zuiverheid. Het protocol kan ook worden aangepast aan het sorteren van oudere embryo's buiten gastrulatie. Gesorteerde embryo's worden gebruikt als input voor in situ Hi-C. Alle experimenten, met inbegrip van sequencing bibliotheek voorbereiding, kunnen worden uitgevoerd in vijf dagen. Het protocol heeft lage input eisen en werkt betrouwbaar met behulp van 20 blastoderm fase embryo's als uitgangsmateriaal. Het eindresultaat is een bibliotheek van de volgorde voor het volgende generatie rangschikken. Na sequencing, kunnen de gegevens worden verwerkt in genoom-brede chromatine interactie kaarten die kunnen worden geanalyseerd met behulp van een breed scala aan beschikbare hulpmiddelen te krijgen informatie over het koppelen topologisch domeinstructuur (TAD), chromatine loops en chromatine vakken tijdens de Drosophila ontwikkeling.

Introduction

Chromatine conformatie vastleggen (3C) heeft ontpopt als een buitengewoon nuttig methode om te studeren van de topologie van de chromatine in de kern1. De variant 3C Hi-C kunt meten de contact frequenties van alle chromatine interacties die in de kern in een enkele experiment2 plaatsvinden. Toepassing van Hi-C speelde een belangrijke rol in de ontdekking en karakterisering van vele fundamentele beginselen van chromatine organisatie, zoals TADs, compartimenten en lussen3,4,5.

Studies van chromatine architectuur in het kader van de ontwikkelingsdoelen overgangen en celdifferentiatie worden steeds vaker gebruikt te ontrafelen van de mechanismen van genregulatie tijdens deze processen6,7,8, 9. Een van de modelorganismen van groot belang is de Drosophila melanogaster, wiens ontwikkeling en genoom worden goed gekenmerkt. Echter, enkele studies die onderzoeken van de architectuur van de chromatine in Drosophila buiten in vitro weefselkweek instellingen zijn uitgevoerd10,11. In embryo's werden 16-18 h post bevruchting, TADs en compartimenten die doet denken aan soortgelijke structuren in zoogdieren geïdentificeerde10, waarin werpt de vraag welke rol ze in genregulatie tijdens Drosophila embryo spelen ontwikkeling. Vooral in de vroege stadia van ontwikkeling, vóór gastrulatie, zijn dergelijke studies technisch uitdagend. Voordat gastrulatie ondergaan Drosophila embryo's 13 synchrone nucleaire divisies die gaan over een uiterst snelle tempo van de 8-60 min per cyclus12,13. Naast dit, het gebrek aan visuele functies te onderscheiden van de verschillende fasen maken het moeilijk strak geënsceneerde embryo materiaal in voldoende hoeveelheden aan te schaffen.

Oog op de ontwikkeling van een protocol waarmee het bestuderen van de chromatine architectuur in de vroege ontwikkeling van de Drosophila op de resolutie van de nucleaire kringloop, gecombineerd we twee bestaande technieken: in situ Hi-C, waarmee de generatie van hoge resolutie hele genoom contact kaarten5, en de embryo enscenering opdrachtregel een transgene Drosophila uiting van een eGFP-PCNA transgenic13,14. Deze transgenic lokaliseert op de nucleus tijdens de interfase en verspreidt gedurende de syncytieel blastoderm tijdens de mitose. Met behulp van deze eigenschap, is het mogelijk om gemakkelijk onderscheiden verschillende stadia van hun nucleaire dichtheid en mitotische embryo's door de verspreiding van het GFP-signaal.

Deze technieken kunnen samen, bestuderen van de driedimensionale structuur van de chromatine in hoge resolutie uit zo weinig als 20 Drosophila embryo's. Dit protocol bevat de instructies voor het verzamelen en sorteren van Drosophila embryo's te verkrijgen van de populaties van embryo's uit een cyclus van enkele nucleaire divisie. Het wordt verder beschreven hoe de verkregen embryo's worden gebruikt om uit te voeren in situ Hi-C. Het eindresultaat is een nucleotide bibliotheek geschikt voor het rangschikken op volgende generatie sequencing machines. De resulterende sequencing leest kunnen vervolgens worden verwerkt tot gedetailleerde chromatine interactie kaarten die betrekking hebben op het volledige genoom van Drosophila .

Protocol

1. drosophila embryo's worden verzameld

Opmerking: Een gelijkwaardige embryo's worden verzameld kan worden uitgevoerd zoals wordt weergegeven in een eerdere publicatie15.

  1. Overdracht van jonge eGFP-PCNA vliegen (< 1 week oud) in ei collectie kooien met uitgegist collectie platen16 (1% ethanol, azijnzuur 1% en 4% agar).
  2. Collectie kooien verplaatsen naar een incubator ingesteld bij 25 ° C. Incubatie gedurende 1-2 dagen voorafgaand aan de eicelpunctie verbetert aanzienlijk, maar de ei-opbrengst. Wijzigen collectie platen tweemaal per dag.
  3. Het verwijderen van platen met embryo's uit de inzamelingskamer in 30-60 min intervallen. Kleinere intervallen resulteren in minder embryo's, maar de strengere verdeling van de ontwikkelingsstadia. Verzamelen van meerdere kooien parallel zo dat een ideale > 200 eieren worden gelegd om 30-60 min.
  4. De platen bij 25 ° C worden opgeslagen totdat de embryo's de gewenste leeftijd bereiken. Voor blastoderm fase Incubeer embryo's (nucleaire kringloop 14), gedurende ongeveer 2 h.
  5. Na 2 uur incubatie toevoegen leidingwater uit een spuit fles aan de collectie plaat zodat het volledige oppervlak is bedekt met water. Opschorten van de embryo's en de gist met een zachte borstel.
  6. Giet geresuspendeerde embryo's uit de collectie plaat in een embryo collectie mand (commerciële cel vulinrichtingen met 100 µm poriegrootte of zelfgemaakte manden17 werk goed), het toevoegen van extra kraanwater uit een spuit fles, indien nodig. In dit stadium, embryo's van alle platen die verzameld werden parallel te combineren. De gebundelde monster vertegenwoordigt één partij.
  7. Wassen van embryo's door de mand met leidingwater te spoelen van een spuit fles voor 30 s totdat alle gist residu is weggespoeld.
  8. Dechorionate embryo's door het plaatsen van de collectie mand in een 2,5% natriumhypochloriet-oplossing in water. Lichte agitatie door wervelende vergemakkelijkt verwijdering van de chorion. Ga zo verder tot embryo's voldoende hydrofobe zodat ze op het oppervlak van de oplossing zweven wanneer de mand is opgeheven uit en weer, ondergedompeld die ~1.75–2 min moeten nemen.
    Let op: natriumhypochloriet is corrosief. Draag passende persoonlijke beschermingsmiddelen. Oplossingen met < 10% natriumhypochloriet kan meestal worden afgezet in de gootsteen, zorg ervoor om de regeling van de host-Instituut.
  9. Verwijder de mand van de oplossing en Spoel grondig met leidingwater uit een spuit fles tot de geur van bleekmiddel niet meer merkbaar.

2. de embryo fixatie

Opmerking: Optimale fixatie voorwaarden, voornamelijk de concentratie van wasmiddel, formaldehyde en de duur van fixatie, moeten empirisch vastberaden aan het stadium van de embryo's. Voor fasen rond de syncytieel blastoderm, een eindconcentratie van 0,5% Triton X-100 en 1,8% formaldehyde in de waterige fase goed werken. Voor latere stadia dan embryo fase 9, kan verdere optimalisering van deze parameters nodig zijn. Alle oplossingen gebruikt tijdens fixatie en sorteren moeten proteaseinhibitors bevatten.

  1. Omkeren van de collectie mand en plaats deze over een tube van 15 mL conische centrifugeren. Spoelen van embryo's uit de mand in de buis met behulp van een pipet van Pasteur toedieningseenheden PBS-T (PBS, 0,5% Triton X-100).
  2. Laat embryo's vestigen op de bodem en het totale volume aan 2 mL met PBS-T.
  3. Voeg 6 mL heptaan en 100 µL van 37% formaldehyde in water.
    Let op: Heptaan en formaldehyde zijn giftig bij inademing of contact na huid. Draag passende persoonlijke beschermingsmiddelen en werken in een zuurkast. Afval bevattende heptaan of formaldehyde moet afzonderlijk worden verwijderd volgens de voorschriften van de Instituut van de host.
  4. Na de toevoeging van de formaldehyde, start een timer van 15 min en krachtig schudden de buis omhoog en omlaag voor 1 min met de hand. De waterige en organische fase zal de samenhang van het formulier een shampoo-achtige combineren.
  5. Agitate op een hiervoor mixer tot 10 min na toevoeging van formaldehyde.
  6. Centrifugeer bij 500 x g gedurende 1 minuut bij kamertemperatuur voor het verzamelen van de embryo's aan de onderkant van de buis.
  7. De gehele shampoo-achtige vloeistof gecombineerd en verwerpen, verzorgen niet om een embryo's gecombineerd. Kleine resterende hoeveelheden van shampoo-achtige supernatans veroorzaken geen problemen.
  8. 15 min na toevoeging van formaldehyde, resuspendeer de embryo's in 5 mL PBS-T met 125 mM glycine om quench de formaldehyde. Meng krachtig door schudden op en neer voor 1 min.
  9. Centrifugeer bij 500 x g bij kamertemperatuur voor 1 min en supernatant gecombineerd.
  10. Wassen van embryo's door hen in 5 mL ijskoud PBS-T. resuspending Laat embryo's regelen en aspirate alle bezinken.
  11. Herhaal de wash in stap 2.10 twee meer tijden.
  12. Houd de embryo's op het ijs tot sorteren. Meestal is het een goed idee om het verzamelen van 3 – 4 loten van vliegen embryo's alvorens te sorteren. Echter moeten embryo's worden gesorteerd op dezelfde dag. Uitgebreide opslag op ijs of in de koelkast leidt tot gewijzigde embryo morfologie.

3. de embryo sorteren

Opmerking: Sorteren kan worden gedaan op een fluorescente stereo microscoop voorzien van een filter GFP bij 60-80 X vergroting.

  1. Met behulp van een pipet 1.000 µL, een partij van ongeveer 100 embryo's overbrengen in een kleine glazen schip geschikt voor sorteren, bij voorkeur van een donkere kleur, en plaats deze op het ijs.
  2. Soort embryo's door nucleaire dichtheid en celcyclus status (Figuur 1) door duwen wenselijk embryo's in een afzonderlijke stapel met behulp van een naald of spuit tip.
    1. Verwijder alle embryo's met verspreide, niet-nucleaire verdeling van eGFP-PCNA (figuur 1E). Ook moeten embryo's die aantonen dat een niet-nucleaire GFP-signaal gedeeltelijk worden verwijderd.
    2. Om te helpen bij het sorteren, verzamelen u een line-up van referentie embryo's bij nucleaire kringloop 12, 13 en 14 in elke batch met behulp van de afbeeldingen in Figuur 1 als een gids. Gebruik deze line-up ter vervanging van embryo's van een onbekende etappe met één van de referentie-embryo's om te bepalen hun stadium.
    3. Om te controleren of het ontwikkelingsstadium voor referentie embryo's, de nucleaire dichtheid te meten door beeldvorming van het embryo en tellen van het aantal kernen aan de oppervlakte van het embryo in een oppervlakte van 2.500 µm2 met behulp van beeldbewerkingssoftware waarmee u afstand informatie toevoegt.
      Opmerking: Het verwachte aantal kernen voor een oppervlakte van 2.500 µm2 is 12 tot en met 16 kernen op nucleaire kringloop 12 en 20 tot 30 kernen op nucleaire kringloop 1313.
  3. Zodra alle embryo's het passende stadium worden gescheiden, neem foto's van de embryo's voor documentatie en kwaliteitscontrole. Als de stereo microscoop niet zelf uitgerust met een cameramodule, kan elke epifluorescence Microscoop met GFP filters worden gebruikt.
  4. Pipetteer van de gewenste embryo's met behulp van een 1.000 µL pipette, transfer naar een verse buis, en de plaats op het ijs.
  5. Ga verder tot er voldoende embryo's worden gesorteerd voor de geplande experiment. Voor embryo's oudere dan etappe 9, zijn over het algemeen 20 embryo's voldoende voor een in situ Hi-C experiment. Op nucleaire kringloop 12 zijn 80 embryo's een goed uitgangspunt. In eerdere cycli, moet het aantal embryo's ongeveer worden verdubbeld voor elke cyclus.
  6. Zwembad en split embryo's in 1,5 mL buizen op een zodanige wijze dat een buis genoeg embryo's voor een één in situ Hi-C bevat experimenteren. Het is raadzaam om het gebruik van buizen met lage DNA-bindende eigenschappen, aangezien het dezelfde buis zal worden gebruikt voor het gehele protocol en adsorptie van DNA tot aanzienlijke verliezen bij lage concentraties van DNA leiden kan.
  7. Spin buizen kort bij 100 x g bij kamertemperatuur en bovendrijvende vloeistof verwijderen. De embryo's moet zo droog mogelijk voor bevriezing.
  8. Flash bevriezen embryo's door dompelen de buizen in vloeibare stikstof en winkel bij-80 ° C.

4. in Situ Hi-C

  1. Lysis
    1. Plaatsen van buisjes met ingevroren embryo's op ijs.
    2. Resuspendeer embryo's in 500 µL van ijskoude lysis buffer (10 mM Tris-Cl pH 8.0, 10 mM NaCl, 0.2% IGEPAL CA-630, proteaseinhibitors; opgelost in water). Wacht 1 minuut om te laten van embryo's vestigen op de onderkant van de buis.
    3. Embryo's met behulp van een metalen micro stamper, vooraf gekoeld op het ijs, dat is ontworpen om strak past een 1,5 mL microcentrifuge buis te slijpen.
      1. Om te voorkomen dat schudden van de embryo's, invoegen van de stamper langzaam totdat de onderkant van de buis raakt, duw omlaag en vervolgens vermalen door het draaien van de stamper tweemaal in beide richtingen.
      2. Til de stamper zeer licht, duwen naar de onderkant van de buis opnieuw en herhaal slijpen.
      3. 4.1.3.2 herhaal 10 keer, of totdat de embryo's zijn volledig lysed. De oplossing moet homogene, en geen residuele grote stukken van embryo's moeten blijven.
    4. Incubeer de gehomogeniseerde schorsing op ijs voor 15 min. Spin 1.000 x g4 ° C gedurende 5 minuten, en weggeworpen.
    5. Wassen pellet door resuspending in 500 µL ijskoude lysis-buffermengsel, pipetting omhoog en omlaag.
    6. Spin opnieuw zoals in 4.1.4 en weggeworpen.
    7. Resuspendeer de pellet van de gewassen in 100 µL van 0,5% natrium dodecyl sulfaat (SDS), pipetting omhoog en omlaag. Permeabilize kernen door incubatie gedurende 10 minuten bij 65 ° C in een blok van de verwarming. Doven SDS door 50 µL van 10% Triton X-100 en 120 µL water toe te voegen. Meng door flicking de buis.
    8. Incubeer bij 37 ° C gedurende 15 minuten in warmte blok.
  2. Spijsvertering van het beperkingsenzym
    1. Voeg 25 µL van 10 x restrictie-enzym buffer en 20 U van 5 U/µL MboI. Meng door flicking de buis.
    2. DNA verteren door incubatie gedurende 90 minuten bij 37 ° C in de warmte blok onder lichte agitatie (750 rpm).
    3. Voeg nog eens 20 U van MboI en blijven van incubatie gedurende 90 min.
    4. Warmte-inactivering van MboI door aan het broeden bij 62 ° C gedurende 20 min.
  3. Overhang fill-in
    Opmerking: Het invullen van de overhang met biotinyleerd dATP selectie van specifieke ligaturen fragmenten kunt. Biotine-dATP bij afbinding kruisingen is beschermd tegen de exonucleaseactiviteit van T4 Polymerase van DNA (sectie 4.6), overwegende dat Biotine-dATP op unligated stompe uiteinden voor het efficiënt wordt verwijderd. De pulldown met streptavidine beklede kralen in sectie 4.7 daarom speciaal verrijkt voor ligaturen, chimeer DNA-fragmenten.
    1. 18 µL van 0,4 mM Biotine-14-dATP, 2,25 µL van een ongewijzigde dCTP/dGTP/dTTP mix (elke 3.3 mM) en 8 µL van 5 U/µL DNA-Polymerase I Klenow Fragment toevoegen.
    2. Meng door flicking de buis en Incubeer bij 37 ° C gedurende 90 minuten in warmte blok.
  4. Afbinding
    1. Voeg 657 µL van water, 120 µL van 10 x T4 DNA Ligase Buffer 100 µL van 10% Triton X-100, 6 µL van 20 mg/mL bovien serumalbumine (BSA), en meng door flicking de buis. Ten slotte voeg 5 µL 5 U/µL T4 DNA Ligase en meng door flicking de buis.
    2. Draaien buis zachtjes (20 rpm) bij kamertemperatuur gedurende 2 uur.
    3. Voeg een tweede aflevering van 5 µL van 5 U/µL T4 DNA Ligase en blijven draaien voor 2 meer h.
    4. Spin down kernen bij 2.500 x g gedurende 5 min en weggeworpen.
  5. DNA-extractie
    1. Resuspendeer de pellet in 500 µL van extractie buffer (50 mM Tris-Cl pH 8.0, 50 mM NaCl, 1 mM ethyleendiamminetetra azijnzuuroplossing (NA2EDTA), 1% SDS; opgelost in water) en Voeg 20 µL van 20 mg/mL proteïnase K. Mix door flicking de buis.
    2. Verteren eiwit door het broeden bij 55 ° C gedurende 30 minuten, schudden bij 1000 omwentelingen per minuut.
    3. De-dwarslijn, voeg 130 µL van 5 M NaCl en na een nacht bebroeden bij 68 ° C, schudden bij 1000 omwentelingen per minuut.
    4. Pipetteer monster af in een nieuwe 2 mL tube, bij voorkeur met lage DNA-bindende kenmerken.
    5. Voeg 0,1 x volumes (63 µL) van 3 M natrium acetaat pH 5.2 en 2 µL van 15 mg/mL GlycoBlue. Meng goed door omkeren. Toevoegen 1.6 x volumes (1008 µL) van zuiver absolute ethanol en meng door het omkeren.
    6. Incubeer bij-80 ° C gedurende 15 min. Centrifuge bij 20.000 x g bij 4 ° C gedurende ten minste 30 min. De DNA-pellet is vaak zeer klein, bijna onzichtbaar, en alleen als gevolg van de blauwe kleur van de GlycoBlue kan worden gespot.
    7. Verwijderen supernatant zorgvuldig, het uiteinde van de pipet verplaatsen in de buis langs de tegenoverliggende muur van waar de DNA-pellet zich bevindt. Kleine overgebleven druppels zijn vaak gemakkelijk te verwijderen tijdens deze stap en de volgende wasbeurten door het duwen van hen uit de buizen met een P10-tip in plaats van pipetteren hen uit.
    8. Wassen pellet door 800 µL van 70% ethanol toe te voegen. Meng door omkeren samen en centrifugeer bij 20.000 x g bij kamertemperatuur voor 5 min. Herhaal deze wassing ten minste eenmaal.
    9. Verwijderen van alle sporen van ethanol en laat de buis staan met het deksel open voor maximaal 5 minuten te drogen. Zodra geen vloeistof is overgebleven, voeg 50 µL van 10 mM Tris-Cl pH 8,0. Pipetteer herhaaldelijk de oplossing over het gebied aan de wand van de buis waar de pellet was gelegen aan de solubilize van het DNA.
    10. Voeg 1 µL van 20 mg/mL RNase A, Meng door flicking de buis, en Incubeer bij 37 ° C gedurende 15 minuten te verteren RNA. Het monster kan nu worden opgeslagen in de koelkast 's nachts of bevroren bij-20 ° C voor onbepaalde tijd.
    11. Controleer de concentratie van DNA met een fluorescente kleurstof gebaseerd assay volgens de instructies van de fabrikant. Het totale bedrag van DNA in de steekproef moet ten minste 10 ng, anders te weinig materiaal is beschikbaar voor versterking en complexiteit van de bibliotheek zal waarschijnlijk laag. Wanneer dit gebeurt, de hoeveelheid grondstof was waarschijnlijk niet voldoende, of materiaal was verloren langs de weg, misschien tijdens lysis en neerslag.
  6. Biotine verwijdering en DNA afknippen
    1. 12 µL van 10 x de Polymerase van DNA van T4 buffer, 3 µL van 1 mM dATP, 3 µL van 1 mM dGTP en 46 µL van water bij elkaar optelt. Meng door flicking de buis. Voeg 5 µL van 3 T4 DNA-Polymerase van U/mL, Meng door flicking de buis en Incubeer bij 20 ° C gedurende 30 minuten.
    2. Voeg 3 µL van het EDTA 0.5 M om te stoppen met de reactie en het gebruik van water om het monster met een volume van ongeveer 120 µL.
    3. Schuintrekken het DNA tot een grootte van 200-400 bp met behulp van een ultrasoonapparaat apparaat volgens de instructies van de fabrikant. Met behulp van de ultrasoonapparaat vermeld in de Tabel van materialen, het volgende programma is passende: 2 cycli elk 50 s 10% plicht, en intensiteit 5, 200 cycli/burst.
  7. Biotine pulldown
    1. Pipetteer 30 µL van 10 mg/mL daar gecoat magnetische kralen in een nieuwe buis, scheiden op een magnetische standaard en wordt weggeworpen.
    2. Resuspendeer kralen in 1 x B & W buffer (5 mM Tris-Cl pH 7.4, EDTA 0.5 mM, 1 M NaCl; opgelost in water) + 0,1% Triton X-100 en meng door vortexing. Plaats van de buis op een magnetische standaard en 1 – 5 min wachten totdat de kralen zijn gescheiden, afhankelijk van het merk en model.
    3. Gecombineerd en weggeworpen tijdens het schuiven van het uiteinde van de pipet langs de muur tegenover van de kralen bevinden. Resuspendeer kralen in 120 µL van 2 x B & W buffer (10 mM Tris-Cl pH 7.4, 1 mM EDTA en 2 M NaCl). Meng door vortexing.
    4. Sheared DNA overbrengen naar een nieuwe laag DNA-bindende buis, en meng met 120 µL van de kraal suspensie in 2 X B & W buffer door vortexing. Kralen met het DNA-monster bij 20 omwentelingen per minuut gedurende 15 minuten draaien.
    5. Scheiden van de kralen op een magnetische standaard en wordt weggeworpen.
    6. Resuspendeer kralen in 600 µL 1 x B & W + 0,1% Triton X-100 en Incubeer bij 55 ° C gedurende 2 minuten, schudden bij 1000 omwentelingen per minuut. Na scheiding, weggeworpen. Deze wassing eenmaal herhaald.
    7. Kralen eenmaal met 600 µL van 10 mM Tris-Cl pH 8,0 wassen, en na scheiding wordt weggeworpen.
    8. Resuspendeer kralen in 50 µL van 10 mM Tris-Cl pH 8,0.

5. sequencing bibliotheek voorbereiding

Opmerking: Alle bibliotheek stappen zijn gedaan met behulp van componenten uit een commerciële DNA bibliotheek voorbereiding kit (Zie Tabel van materialen). Echter kunnen alternatieve kits of andere reagentia worden vervangen. Neerslag neigt naar formulier in de bibliotheek voorbereiding agenten tijdens de diepvries opslag. Daarom is het belangrijk om ervoor te zorgen dat alle neerslag is ontbonden vóór het gebruik van de reagentia.

  1. Einde reparatie
    1. Spoel de suspensie van de parel in 50 µL van 10 mM Tris-Cl pH 8,0 in een nieuwe PCR-buis.
    2. Voeg 3 µL van einde Prep enzym Mix en 7 µL van einde Prep reactie Buffer. Meng door pipetteren omhoog en omlaag.
    3. Buis overbrengen in een thermische cycler en voer het volgende programma: 20 ° C gedurende 30 minuten, 65 ° C gedurende 30 minuten, en houd bij 4 ° C.
  2. Adapter afbinding
    1. Voeg 30 µL van afbinding Master Mix, 2.5 µL van 1,5 µM Sequencing adapter (verdund tot 1,5 µM uit voorraad) en 1 µL van afbinding Enhancer tot de schorsing van de kraal. Meng door pipetteren omhoog en omlaag.
    2. Incubeer bij 20 ° C gedurende 15 min. in een thermische cycler.
    3. Voeg 3 µL van gebruiker enzym. Meng door pipetteren omhoog en omlaag.
    4. Incubeer bij 37 ° C gedurende 15 min. in een thermische cycler.
    5. Scheid de kralen op een magnetische standaard en bovendrijvende vloeistof verwijderen.
    6. Resuspendeer te wassen kralen parels in 100 µL van 1 x B & W buffer + 0,1% Triton X-100. Meng door vortexing, en overdracht aan een nieuwe microcentrifuge buis. Scheid de kralen op een magnetische standaard en bovendrijvende vloeistof verwijderen.
    7. Herhaal deze keer met behulp van 600 µL van de dezelfde buffer wassing.
    8. Resuspendeer kralen in 600 µL van 10 mM Tris-Cl pH 8.0, Meng door vortexing, en kralen overbrengen in een nieuwe buis.
    9. Aparte parels op een magnetische staan, wordt weggeworpen en resuspendeer kralen in 50 µL van 10 mM Tris-Cl pH 8,0.
  3. PCR versterking
    1. Twee PCR buizen voor te bereiden en in elk, Meng 25 µL van Polymerase Master Mix, 1.5 µL van 10 µM Forward (niet-geïndexeerde) PCR Inleiding en 1,5 µL van 10 µM Reverse (geïndexeerde) PCR Inleiding.
      Opmerking: Sturen (niet-geïndexeerde) PCR Inleiding:
      5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC * T-3´.
      Omgekeerde (geïndexeerde) PCR Inleiding:
      5'-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC * T-3´. * geeft phosphorothioate obligaties en Ns in de geïndexeerde PCR-primer.
    2. In elke buis, voeg 22 µL kraal schorsing en meng door pipetteren omhoog en omlaag.
    3. Uitvoeren van PCR met behulp van het volgende programma: 98 ° C gedurende 1 min, (98 ° C gedurende 15 s, 65 ° C gedurende 75 s, speedramp 1,5 ° C/s) herhaald 9 - 12 keer, 65 ° C gedurende 5 minuten, en houd bij 4 ° C.
      Opmerking: Het aantal cycli van versterking moet empirisch worden bepaald. We vonden echter dat bibliotheken die meer dan 12 cycli vereist over het algemeen lage complexiteit waren en niet resulteren in hoge kwaliteit die Hi-C kaarten. Aan de andere kant, bibliotheken waarvoor minder dan 12 cycli niet negatief beïnvloed door sturen voor een volledige 12 cycli. Het is daarom mogelijk standaard 12 cycli van versterking.
    4. Zwembad de twee PCR reacties in een enkele microcentrifuge buis, scheiden van de kralen op een magnetische stand, en breng het supernatant met de bibliotheek om een nieuwe buis.
  4. Maat keuze
    1. Breng Ampure XP kraal schorsing aan kamertemperatuur en meng goed door schudden.
    2. Volume van de gebundelde PCR reactie op precies 200 µL met water te brengen. Tijdens de PCR en de magnetische scheiding is enkele van het oorspronkelijke volume meestal verloren. Controleer volume door het instellen van de pipet op 200 µL en het gehele volume van de reactie gecombineerd. Als lucht is aanzuiging, meer water moet worden toegevoegd. Als het volume groter is dan 200 µL, het volume van kralen toegevoegd in stap 5.4.3 en 5.4.6 proportioneel aanpassen.
      Noot: De volumes haakjes zijn geldig als het totale volume van de gebundelde PCR reacties precies 200 µL is.
    3. Voeg 0.55 x hoeveelheid (110 µL) Ampure XP kraal schorsing en meng door pipetteren op en neer ten minste 10 keer.
    4. Incubeer bij kamertemperatuur gedurende 5 minuten, aparte kralen op een magnetische stand gedurende 5 minuten.
    5. Supernatant verplaatsen naar een nieuwe buis. Gooi de buis met de kralen. De kralen hebben gebonden DNA > 700 bp, die is te groot om te worden gesequentieerd.
    6. Toevoegen aan het supernatant, 0,2 x volumes (40 µL, resulterend in een totaal van 0,75 x Ampure buffer in de steekproef) van Ampure XP kraal schorsing en meng door pipetteren op en neer 10 keer.
    7. Incubeer bij kamertemperatuur gedurende 5 minuten, aparte kralen op een magnetische stand gedurende 5 minuten.
    8. Vloeistof wordt weggeworpen waarin DNA < 200 bp, waaronder gratis inleidingen, inleidingsdimeer en fragmenten te klein aan het worden sequenced.
    9. Laat de buis op de magnetische stand. Te wassen kralen, voeg 700 µL van 80% ethanol, verzorgen niet te verstoren de kraal pellet en incubeer gedurende 30 s.
    10. Vloeistof wordt weggeworpen, dan nemen de buis van de magnetische standaard en resuspendeer kralen in 100 µL van 10 mM Tris-Cl pH 8,0. Meng door pipetteren op en neer 10 keer en Incubeer bij kamertemperatuur voor 1 min.
    11. Voeg 0.8 x hoeveelheid (80 µL) Ampure XP kraal schorsing. Meng door pipetteren op en neer 10 keer en Incubeer bij kamertemperatuur gedurende 5 minuten. Deze tweede ronde van ondergrens grootte selectie zorgt ervoor dat de definitieve bibliotheek volledig gratis primers en inleidingsdimeer is.
    12. Aparte parels op een magnetische staan voor 5 min en weggeworpen.
    13. Wassen van de kraal pellet tweemaal met 700 µL van 80% ethanol voor 30 s elk, terwijl het verlaten van de buis op de magnetische voet, zoals hierboven beschreven.
    14. Met de buis nog steeds op de magnetische stand, verwijderen van alle sporen van ethanol. Het helpt om te duwen druppels van ethanol uit de buis met behulp van een precisiepipet P10. Laat de resterende ethanol verdampen voor een maximum van 5 min.
    15. Neem van de buis van de magnetische standaard en resuspendeer kralen in 50 µL van 10 mM Tris-Cl pH 8,0. Meng door pipetteren op en neer 10 keer.
    16. Incubeer bij kamertemperatuur voor 5 minuten, dan is aparte kralen op een magnetische voet.
    17. Supernatant overbrengen in een verse buis. Dit is de laatste Hi-C bibliotheek, klaar om te worden gekwantificeerd en sequenced op volgende generatie sequencing machines, volgens de instructies van de fabrikant.

Representative Results

Gesorteerd op embryo populaties op nucleaire kringloop 12, 13 en 14 (overeenkomend met 1:30, 1:45 en 2:10 uren post bevruchting, respectievelijk12) en 3-4 h post bevruchting (hpf) zijn verkregen overeenkomstig de in het protocol beschreven procedures. Door het nemen van foto's van het signaal van de eGFP-PCNA van iedere partij gesorteerde embryo, is het mogelijk voor het documenteren van de precieze stadium en celcyclus status van elke één embryo die in downstream experimenten wordt gebruikt. Voorbeeld afbeeldingen van embryo's uit gesorteerde populaties worden getoond in figuur 1B-E. De uitvoer van de in situ Hi-C protocol is een nucleotide bibliotheek klaar om te worden sequenced op volgende generatie sequencing machines. Voor dit doel is een definitieve bibliotheek concentratie van ten minste 2-4 nM meestal vereist. Het gebruik van de aanbevolen hoeveelheid uitgangsmateriaal, deze concentratie is betrouwbaar bereikt (tabel 1).

De verwachte grootteverdeling van de fragmenten van DNA na maat keuze tussen 300 en 600 bp, met een maximum aan ongeveer 500 bp ()figuur 2A), afhankelijk van de exacte schuintrekken en grootte selectie parameters is. Voor sequencing raden we gekoppeld-einde leest van ten minste 75 bp lengte om het aantal unmappable beperkingsfragmenten in het genoom te minimaliseren. Hoge-resolutie kaarten met 1 – 2 kb bin grootte kunnen worden verkregen bij 400 miljoen leest. Het is raadzaam om elk, in plaats van een enkele repliceren op zeer hoge diepte sequencing rangschikken van meerdere biologische wordt gerepliceerd op een lagere diepte van 150 miljoen ~ leest. Dit maakt van de beoordeling van de biologische variatie en leidt tot een lager aantal afgedankte leest als gevolg van PCR duplicatie. Voor visuele weergave, kunnen de duplo's worden gecombineerd. Alvorens aan de sequencing van een monster op hoge diepte, is het raadzaam voorbeelden met behulp van ondiepe rangschikken (een paar miljoen leest per monster) om te bepalen van fundamentele bibliotheek kwaliteitsparameters zoals in figuur 2Buitvoeren.

Analyse van Hi-C gegevens vereist aanzienlijke computationele middelen en bio-informatica expertise. Als een kort overzicht, de gepaarde leest onafhankelijk worden toegewezen aan het genoom van de verwijzing, de daaruit voortvloeiende aanpassingen zijn gefilterd voor kwaliteit en de afdrukstand, dan een matrix van contacten op een bepaalde opslaglocatie-resolutie of fragment-niveau kan worden gegenereerd uit de gefilterde uitlijning. De contact matrix is de basis voor alle verdere downstream analyse verkennen TADs, loops en compartimenten. Voor de eerste analyse van de volgorde leest, zijn verschillende bioinformatics pijpleidingen beschikbaar waarmee de verwerking van ruwe leest in contact matrices zonder veel gespecialiseerde bioinformatics kennis18,19, 20,21,22,23. Hoe verdere analyse gebeurt hangt grotendeels af van de exacte biologische vraag bestudeerde en wellicht aanzienlijke ervaring in het programmeren en scripting in R of Python. Diverse gereedschappen en algoritmen Bel TADs zijn echter beschikbaar5,24,25,26,27,28, evenals software om te analyseren en Hi-C gegevens in de webbrowser en als stand-alone desktop applicaties29,30,31,32te verkennen.

Zodra verwerkt, kan de kwaliteit van de bibliotheek worden bepaald met behulp van verschillende statistieken (figuur 2B). Als eerste moet het tempo van de PCR duplicaten, oftewel het aantal gesequenceerd Lees paren die voortvloeien uit de oorspronkelijke molecuul, worden zo laag mogelijk om de hoeveelheid verspilde volgorde leest te beperken. Maar zelfs bibliotheken met > 40% PCR dubbel kan worden verwerkt tot hoogwaardige contact kaarten als de duplicaten zijn gefilterd. Ten tweede, het tarief van gefilterde luidt vanwege hun geaardheid, zoals beschreven in4, consequent moet lager dan 10% van de uitgelijnde Lees paren.

Tijdens pre gastrular ontwikkeling van Drosophila tussen nucleaire kringloop 12 en 14 is de nucleaire architectuur drastisch verbouwd33 (Figuur 3). Op nucleaire kringloop 12, paar TADs worden gedetecteerd en de algemene verdeling van contacten is erg glad zonder veel te onderscheiden functies. Dit is dramatisch veranderde op nucleaire kringloop 13 en 14, toen TADs steeds prominenter zijn en aspecifieke lange-afstands contacten zijn uitgeput.

Figure 1
Figuur 1: representatieve foto's van eGFP-PCNA embryo's bij het sorteren. (A) eGFP-PCNA signaal van een niet-gesorteerde bevolking van embryo's na 60 min collectie en 2 uur incubatie bij 25 ° C (B-E) voorbeelden van embryo's uit gesorteerde populaties op nucleaire kringloop 12 (B), nucleaire cyclus 13 (C), 14 (van de nucleaire kringloop D), en uit embryo's synchrone mitose (E) ondergaan. Schaal bars = 200 µm. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: Voorbeelden van in situ Hi-C bibliotheek kwaliteit statistieken. (A) Bioanalyzer sporen waarin de verdeling van DNA fragment maten uit een succesvolle Hi-C-bibliotheek (Library 1, top) en uit een bibliotheek waarin een piek van fragmenten die te groot zijn voor het rangschikken (bibliotheek 2, onderaan). Bibliotheek 2 was succesvol sequenced, maar zelfs grotere hoeveelheden ongewenste DNA-fragmenten kunnen leiden tot verminderde sequencing opbrengsten. (B) statistieken van twee Hi-C bibliotheken filteren: het aantal uitgelijnde Lees paren die worden uitgesloten van verdere analyse als gevolg lees richting en afstand (naar binnen, naar buiten)4 of PCR duplicatie (duplicate) weergegeven is. In elke staaf, zijn het aantal leest het filter (resterende) passeren en falende (gefilterd) uitgezet. Het percentage van luidt het filter passeren wordt bovendien weergegeven als tekst. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: Hi-C interactie kaarten van gefaseerde embryo's. Hi-C interactie kaarten zijn bij 10 kb resolutie weggegooid en evenwichtige zoals beschreven voor33. Komt te staan is een regio op chromosoom 2 L. Klik hier voor een grotere versie van dit cijfer.

Bibliotheek Stadium Aantal embryo 's Bedrag DNA voordat scheren (ng) Cycli van PCR Definitieve bibliotheek concentratie (nM)
1 nucleaire kringloop 12 71 46 12 28.2
2 nucleaire kringloop 12 46 40 12 22.2
3 nucleaire kringloop 12 60 13 13 12.3
4 nucleaire kringloop 13 36 39 12 22.2
5 nucleaire kringloop 13 35 10 12 5.0
6 nucleaire kringloop 13 48 18 12 8.7
7 nucleaire kringloop 14 33 30 12 39,8
8 nucleaire kringloop 14 24 36 12 20.4
9 nucleaire kringloop 14 14 8 12 4.2
10 3-4 hpf 17 30 12 24,0
11 3-4 hpf 18 42 11 19.1
12 3-4 hpf 22 63 11 48.4

Tabel 1: lijst van representatieve sequencing bibliotheek statistieken. Voor elke bibliotheek in de lijst, het aantal embryo's die werden gebruikt voor de generatie, het bedrag van de totale DNA vóór Biotine pulldown en afknippen gemeten door Qubit, cycli het aantal PCR gebruikt voor amplificatie, en de uiteindelijke concentratie van de sequencing-bibliotheek na zuivering en grootte selectie worden aangegeven.

Discussion

Het protocol hier gepresenteerd is zeer effectief in het genereren van hoge kwaliteit kaarten van de chromatine-architectuur in vroege Drosophila embryo's. Vergeleken met een eerder protocol34, de beschreven aanpak hier gebruikt een up-to-date in situ Hi-C procedure5, wat resulteert in snellere verwerking, hogere resolutie, en minder reagens gebruik. De algemene procedure, met inbegrip van de in situ Hi-C protocol wordt verwacht om te werken aan een breed scala van podia en experimentele systemen naast Drosophila. Aangezien het protocol een lage invoer vereiste heeft, kon het ook worden gebruikt op geïsoleerde cel populaties. In Drosophila, wanneer met behulp van het protocol voor embryo's buiten het bereik beschreven hier, sommige parameters, wellicht met name de vastlegging van het materiaal, worden aangepast. Aangezien oudere embryo's een zeer ondoordringbare schubbenlaag ontwikkelen, verhoging van de concentratie van formaldehyde en fixatie te verlengen kunnen worden gehouden. Voor verzamelen van embryo's in stadia dan nucleaire kringloop 14, de tijden van de incubatie van embryo's bij 25 ° C in stap 1.4 moeten als volgt worden aangepast: nucleaire kringloop 12, 70 min; nucleaire kringloop 13, 90 min; 3-4 hpf, 3:30 h.

Tijdens de 13 decollete divisies (fase 1-4), verdubbelt de kernen dichtheid ongeveer met elke divisie. De kernen kunnen gemakkelijk worden geïdentificeerd door hun heldere GFP-fluorescentie. Tijdens de mitose, eGFP-PCNA is niet gelegen in de kern en zijn signaal is verspreid over het embryo. Deze functie maakt identificerende embryo's die zich in een synchrone decollete divisie mogelijk. Voor de studie van chromatine bevleesdheid, zijn deze mitotische embryo's meestal niet wenselijk, aangezien de mitotische organisatie van de chromatine drastisch anders dan de interfase organisatie35 is. Het is mogelijk om aan te passen het protocol specifiek Schakel embryo's ondergaan een synchrone mitotische divisie. In dit geval alleen embryo's met verspreide, niet-nucleaire verdeling van eGFP-PCNA moeten worden gehouden, en alle andere embryo's moeten worden weggegooid. Aangezien de nucleaire dichtheid kan niet worden bepaald, moeten alternatieve methoden om fase embryo's door hun morfologie bekeken in de lichte microscopie van verzonden worden toegepast. Aanwezigheid van pole cellen en kernen aan de rand van het embryo geven aan dat het embryo is voltooid ten minste nucleaire kringloop 9, overwegende dat zichtbaar cellularization aan de rand van de nucleaire kringloop 1412blijkt.

Hi-C experimenten kunnen met succes worden uitgevoerd met behulp van een brede selectie van restrictie-enzymen5. Huidige aanpak gebruiken meestal enzymen die beide een sequentie van de 4-base, zoals MboI, of een 6-base erkenning site, zoals HindIII herkent. Het voordeel van 4-base kotters over 6-base scharen is dat ze hogere potentiële resolutie bieden, gezien genoeg sequencing diepte en een meer gelijkmatige dekking van beperkingsplaatsen in het genoom. Bij het kiezen van een 4-base cutter over nog eens5,23,36,,37biedt geen duidelijke voordelen. De twee meest gebruikte enzymen, MboI en DpnII, herkennen beide dezelfde GATC erkenning site. DpnII is minder gevoelig voor CpG methylering, die van geen belang in Drosophila is. Het hier gepresenteerde protocol kan ook worden voltooid met behulp van DpnII als een restrictie-enzym. In paragraaf 4.2. restrictie-enzym en buffer moeten worden aangepast voor compatibiliteit van de DpnII, volgens de aanbevelingen van de fabrikant.

Als de grootte van het fragment van de sequencing-bibliotheek van het bereik wordt weergegeven in figuur 2Aaanzienlijk afwijkt, kan clustervorming tijdens sequencing minder efficiënt of volledig mislukken. In dit geval de grootteverdeling na het scheren moet worden gecontroleerd en schuintrekken parameters aangepast. Pieken in de verdeling van de fragmenten van DNA van zeer kleine (< 100 bp) of zeer grote (> 1000 bp) maten geeft problemen met grootte selectie, zoals carry over kralen of bovendrijvende substantie die moeten worden verwijderd. Deze bibliotheken met kleine pieken bij deze ongewenste maten, zoals de een afgebeeld, zijn nog steeds sequenced vaak met succes met slechts een lichte daling in clusters van efficiëntie.

Hoge tarieven van PCR overlappingen moeten worden vermeden omdat dit drastisch het aantal bruikbare volgorde leest vermindert. Het tarief van PCR duplicaten is direct gerelateerd aan de hoeveelheid uitgangsmateriaal. Met behulp van meer input daarom verlicht meestal problemen met PCR dubbel.

Hogere aantallen leest gefilterd door Lees oriëntatie ()figuur 2B) geven onvoldoende vertering, die kan het resultaat van het gebruik van te weinig enzym, teveel uitgangsmateriaal of onvolledige homogenisering van de embryo's.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Dit onderzoek werd gefinancierd door het Max-Planck-Gesellschaft. C.B.H. werd gesteund door een beurs van de Onderzoekschool International Max Planck-moleculaire biologie. Wij danken Shelby Blythe en Eric Wieschaus voorziet vriendelijk de eGFP-PCNA Drosophila melanogaster lijn.

Materials

Name Company Catalog Number Comments
Biotin-14-dATP Life Technologies 19524016
MboI New England Biolabs R0147L
DNA Polymerase I Klenow Fragment New England Biolabs M0210L
T4 DNA Ligase Thermo Fisher EL0012 T4 DNA Ligase Buffer included
T4 DNA Polymerase New England Biolabs M0203L
Proteinase K AppliChem A4392
GlycoBlue Life Technologies AM9516
Complete Ultra EDTA-free protease inhibitors Roche 5892791001
NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) New England Biolabs E7335 Sequencing Adaptor, Forward (unindexed) PCR primer and Reverse (indexed) PCR primer and USER enzyme used in the Library preparation section are components of this kit
NEBNext Ultra II DNA Library Prep Kit New England Biolabs E7645 End Prep Enzyme Mix, End Prep Reaction Buffer, Ligation Enhancer, Ligation Master Mix and Polymerase Master Mix used in the Library preparation section are components of this kit
Covaris S2 AFA System Covaris
DNA LoBind Tubes, 1.5 mL Eppendorf 0030108051
Falcon cell strainer 100 µm Corning 352360 Embryo collection baskets
37% formaldehyde VWR 437536C
Heptane AppliChem 122062.1612
M165 FC fluorescent stereo microscope Leica
M165 FC DFC camera Leica
Metal micro pestle Carl Roth P985.1 Used to lyse embryos in step 4.1.4
RNase A AppliChem A3832,0050
Dynabeads MyOne Streptavidin C1 Life Technologies 65002 Streptavidin coated magnetic beads
Ampure XP beads Beckman Coulter A63881
Qubit 3.0 Fluorometer Thermo Fisher Scientific Q33216
Qubit assay tubes Thermo Fisher Scientific Q32856
Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Q32854
Phosphate buffered saline (PBS) Sigma-Aldrich P4417
eGFP-PCNA flies Gift from S. Blythe and E. Wieschaus
Sodium hypochlorite 13% Thermo Fisher AC219255000
Triton X-100 AppliChem A4975
Tris buffer pH 8.0 (1 M) for molecular biology AppliChem A4577
NaCl AppliChem A2942
IGEPAL CA-630 Sigma-Aldrich I8896
1.5 mL microcentrifuge tubes Greiner Bio-One 616201
SDS for molecular biology AppliChem A2263
10x CutSmart buffer New England Biolabs B7204S Restriction enzyme buffer
PCR Nucleotide Mix Sigma-Aldrich 11814362001 Unmodified dCTP, dGTP, dTTP
BSA, Molecular Biology Grade New England Biolabs B9000S
EDTA 0.5 M solution for molecular biology AppliChem A4892
Sodium acetate 3 M pH 5.2 Sigma-Aldrich S7899
DynaMag-2 Magnet Life Technologies 12321D Magnetic stand
Intelli-Mixer RM-2L Omnilab 5729802 Rotator
ThermoMixer F1.5 Eppendorf 5384000012 Mixer
Small Embryo Collection Cages Flystuff.com 59-100 Egg collection cage
Centrifuge 5424 R Eppendorf 5404000413
C1000 Touch Thermal Cycler Bio-Rad 1851148
PCR tube strips Greiner Bio-One 673275
NEBuffer 2.1 New England Biolabs B7202S T4 DNA Polymerase buffer

DOWNLOAD MATERIALS LIST

References

  1. Bonev, B., Cavalli, G. Organization and function of the 3D genome. Nat Rev Genet. 17, (11), 661-678 (2016).
  2. Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, (5950), 289-293 (2009).
  3. Dixon, J. R., et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 485, (7398), 376-380 (2012).
  4. Jin, F., et al. A high-resolution map of the three-dimensional chromatin interactome in human cells. Nature. (2013).
  5. Rao, S. S. P., et al. A 3D Map of the Human Genome at Kilobase Resolution Reveals Principles of Chromatin Looping. Cell. 159, (7), 1665-1680 (2014).
  6. Darbellay, F., Duboule, D. Topological Domains, Metagenes, and the Emergence of Pleiotropic Regulations at Hox Loci. Current topics in developmental biology. 116, 299-314 (2016).
  7. Beagan, J. A., et al. Local Genome Topology Can Exhibit an Incompletely Rewired 3D-Folding State during Somatic Cell Reprogramming. Cell stem cell. 18, (5), 611-624 (2016).
  8. Andrey, G., et al. Characterization of hundreds of regulatory landscapes in developing limbs reveals two regimes of chromatin folding. Genome Res. 27, (2), 223-233 (2017).
  9. Krijger, P. H. L., de Laat, W. Regulation of disease-associated gene expression in the 3D genome. Nature Reviews. Molecular Cell Biology. 17, (12), 771-782 (2016).
  10. Sexton, T., et al. Three-dimensional folding and functional organization principles of the Drosophila genome. Cell. 148, (3), 458-472 (2012).
  11. Ghavi-Helm, Y., et al. Enhancer loops appear stable during development and are associated with paused polymerase. Nature. 512, (7512), 96-100 (2014).
  12. Foe, V. E., Alberts, B. M. Studies of nuclear and cytoplasmic behaviour during the five mitotic cycles that precede gastrulation in Drosophila embryogenesis. J Cell Sci. 61, 31-70 (1983).
  13. Blythe, S. A., Wieschaus, E. F. Zygotic Genome Activation Triggers the DNA Replication Checkpoint at the Midblastula Transition. Cell. 160, (6), 1169-1181 (2015).
  14. Blythe, S. A., Wieschaus, E. F. Establishment and maintenance of heritable chromatin structure during early Drosophila embryogenesis. eLife. 5, e20148 (2016).
  15. JoVE Science Education Database. Embryo and Larva Harvesting and Preparation. Biology I: yeast, Drosophila and C. elegans. Drosophila melanogaster. JoVE, Cambridge, MA. (2017).
  16. Sicaeros, B., O'Dowd, D. K. Preparation of Neuronal Cultures from Midgastrula Stage Drosophila Embryos. Journal of Visualized Experiments. (5), (2007).
  17. Shermoen, A. W. Preparation of Baskets for Drosophila Egg Collections, Treatments, and Incubations. Cold Spring Harbor Protocols. (10), (2008).
  18. Ay, F., Noble, W. S. Analysis methods for studying the 3D architecture of the genome. Genome biology. 16, (1), 183 (2015).
  19. Lazaris, C., Kelly, S., Ntziachristos, P., Aifantis, I., Tsirigos, A. HiC-bench: comprehensive and reproducible Hi-C data analysis designed for parameter exploration and benchmarking. BMC Genomics. 18, (1), (2017).
  20. Servant, N., et al. HiC-Pro: an optimized and flexible pipeline for Hi-C data processing. Genome Biology. 16, (1), (2015).
  21. Durand, N. C., et al. Juicer Provides a One-Click System for Analyzing Loop-Resolution Hi-C Experiments. Cell systems. 3, (1), 95-98 (2016).
  22. Lajoie, B. R., Dekker, J., Kaplan, N. The Hitchhiker's guide to Hi-C analysis: Practical guidelines. Methods. 72, 65-75 (2015).
  23. Schmitt, A. D., Hu, M., Ren, B. Genome-wide mapping and analysis of chromosome architecture. Nature Reviews. Molecular Cell Biology. 17, (12), 743-755 (2016).
  24. Shin, H., et al. TopDom: an efficient and deterministic method for identifying topological domains in genomes. Nucleic Acids Res. 44, (7), e70 (2016).
  25. Kruse, K., Hug, C. B., Hernández-Rodríguez, B., Vaquerizas, J. M. TADtool: visual parameter identification for TAD-calling algorithms. Bioinformatics. 32, (20), 3190-3192 (2016).
  26. Lévy-Leduc, C., Delattre, M., Mary-Huard, T., Robin, S. Two-dimensional segmentation for analyzing Hi-C data. Bioinformatics. 30, (17), Oxford, England. i386-i392 (2014).
  27. Filippova, D., Patro, R., Duggal, G., Kingsford, C. Identification of alternative topological domains in chromatin. Algorithms for molecular biology: AMB. 9, (1), 14 (2014).
  28. Crane, E., et al. Condensin-driven remodelling of X chromosome topology during dosage compensation. Nature. 523, (7559), 240-244 (2015).
  29. Durand, N. C., et al. Juicebox Provides a Visualization System for Hi-C Contact Maps with Unlimited Zoom. Cell systems. 3, (1), 99-101 (2016).
  30. Zhou, X., et al. Exploring long-range genome interactions using the WashU Epigenome Browser. Nature Methods. 10, (5), 375-376 (2013).
  31. Ramírez, F., et al. High-resolution TADs reveal DNA sequences underlying genome organization in flies. bioRxiv. 115063 (2017).
  32. Kerpedjiev, P., et al. HiGlass: Web-based Visual Comparison And Exploration Of Genome Interaction Maps. bioRxiv. 121889 (2017).
  33. Hug, C. B., Grimaldi, A. G., Kruse, K., Vaquerizas, J. M. Chromatin Architecture Emerges during Zygotic Genome Activation Independent of Transcription. Cell. 169, (2), (2017).
  34. Berkum, N. L., et al. Hi-C: a method to study the three-dimensional architecture of genomes. Journal of Visualized Experiments: JoVE. (39), (2010).
  35. Naumova, N., et al. Organization of the mitotic chromosome. Science. 342, (6161), 948-953 (2013).
  36. Denker, A., de Laat, W. The second decade of 3C technologies: detailed insights into nuclear organization. Genes & development. 30, (12), 1357-1382 (2016).
  37. Belaghzal, H., Dekker, J., Gibcus, J. H. Hi-C 2.0: An optimized Hi-C procedure for high-resolution genome-wide mapping of chromosome conformation. Methods (San Diego, Calif). 123, 56-65 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics