Generation av Genome-wide kromatin konformation fånga bibliotek från tätt stegvis tidiga Drosophila embryon

Genetics
 

Summary

Detta arbete beskriver ett protokoll för generering av hög upplösning i situ Hi-C bibliotek från iscensatt tätt före gastrulation Drosophila melanogaster embryon.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Hug, C. B., Vaquerizas, J. M. Generation of Genome-wide Chromatin Conformation Capture Libraries from Tightly Staged Early Drosophila Embryos. J. Vis. Exp. (140), e57001, doi:10.3791/57001 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Utreda den tredimensionella arkitekturen av kromatin erbjuder ovärderlig inblick i mekanismerna för genreglering. Här beskriver vi ett protokoll för att utföra den kromatin konformation capture teknik i situ Hi-C på iscensatt Drosophila melanogaster embryo populationer. Resultatet är en sekvensering bibliotek som låter kartläggning av alla kromatin-interaktioner som inträffar i kärnan i ett enda experiment. Embryo sortering görs manuellt med en fluorescerande stereo Mikroskop och en transgena linan som innehåller en nukleär markör. Med hjälp av denna teknik, embryo populationer från varje nukleära division cykel, och med definierade cellcykeln status, kan erhållas med mycket hög renhet. Protokollet kan också anpassas till sortera äldre embryon bortom gastrulation. Sorterade embryon används som insatsvaror för i situ Hi-C. Alla experiment, inklusive sekvensering bibliotek förberedelse, kan slutföras i fem dagar. Protokollet har låga ingående krav och fungerar tillförlitligt med 20 blastoderm scenen embryon som insatsmaterial. Slutresultatet är en sekvensering bibliotek för nästa generations sekvensering. Efter sekvensering, kan data bearbetas till genome-wide kromatin interaktion kartor som kan analyseras med hjälp av ett brett utbud av tillgängliga verktyg för att få information om topologically associera domänstruktur (TAD), kromatin loopar och kromatin fack under Drosophila utveckling.

Introduction

Kromatin konformation capture (3C) har vuxit fram som en exceptionellt bra metod att studera topologin av kromatin i nucleus1. 3C varianten Hi-C tillåter mätning kontakt frekvenserna av alla kromatin-interaktioner som inträffar i kärnan i en enda experiment2. Tillämpningen av Hi-C har spelat en viktig roll i upptäckten och karakterisering av många grundläggande principer av kromatin organisation, till exempel TADs, fack och loopar3,4,5.

Studier av kromatin arkitektur inom ramen för utvecklingstoxicitet övergångar och celldifferentiering används alltmer att nysta upp mekanismer för genreglering vid dessa processer6,7,8, 9. En av modellorganismerna av stort intresse är Drosophila melanogaster, vars utveckling och arvsmassan är väl karakteriserade. Dock genomföras få studier som undersöker kromatin arkitektur i Drosophila utanför i vitro vävnadsodling inställningar har varit10,11. I embryon var 16 – 18 h post befruktning, TADs och fack som påminner om liknande strukturer i däggdjur identifierade10, vilket väcker frågan om vilken roll de spelar i genreglering vid Drosophila embryo utveckling. Särskilt i de tidiga stadierna av utveckling, före gastrulation, är sådana studier tekniskt utmanande. Innan gastrulation genomgå Drosophila embryon 13 synkron nukleära uppdelningar som går i en extremt snabb takt 8 – 60 min per cykel12,13. Utöver detta, bristen på visuella funktioner att skilja de olika stadierna gör det svårt att få tätt stegvis embryo material i tillräckliga mängder.

För att utveckla ett protokoll som tillåter studera kromatin arkitekturen i tidiga Drosophila utveckling på nukleära cykel upplösning, vi kombinerat två befintliga tekniker: i situ Hi-C, vilken tillåt generering av hög upplösning hela genomet kontakt kartor5och embryo iscensättning med hjälp av en transgen Drosophila uttrycker en andra-PCNA transgenens13,14. Detta transgenens lokaliserar till kärnan under interfasen och skingrar i hela den syncytial blastoderm under Mitos. Med den här egenskapen, är det möjligt att enkelt skilja olika stadier av deras nukleära densitet och mitotiska embryon av spridningen av GFP signalen.

Tillsammans, dessa tekniker möjliggör studera den tredimensionella strukturen av kromatin i hög upplösning från så få som 20 Drosophila embryon. Detta protokoll innehåller instruktionerna för skörd och sortering Drosophila embryon att få populationer av embryon från en division och kärn-cykel. Den beskriver vidare hur de erhållna embryona används för att utföra i situ Hi-C. Slutresultatet är en nukleotid bibliotek passar sekvensering på nästa generations sekvensering-maskiner. Den resulterande sekvensering läser kan sedan förädlas till detaljerad kromatin interaktion kartor som täcker hela Drosophila genomet.

Protocol

1. drosophila embryosamlingsgruppen

Obs: En motsvarande embryosamlingsgruppen kan utföras som visas i en tidigare publikation15.

  1. Överföra unga andra-PCNA flugor (< 1 vecka gammal) in ägg samling burar med yeasted samling tallrikar16 (1% etanol, 1% ättiksyra och 4% agar).
  2. Flytta samlingen burar till en inkubator inställd på 25 ° C. Inkubation i 1 – 2 dagar före insamling av ägg förbättrar ägg avkastningen avsevärt. Ändra samlingsplattor två gånger om dagen.
  3. Ta bort plattor som innehåller embryon från uppsamlingskammaren i 30 – 60 minuters intervall. Mindre mellanrum resultera i färre embryon, men hårdare distribution av utvecklingsstadier. Samla in från flera burar parallellt så som helst > 200 ägg varje 30 – 60 min.
  4. Lagra plattorna vid 25 ° C tills embryona når önskad ålder. För blastoderm scenen Inkubera embryon (nukleära cykel 14), i ca 2 h.
  5. Efter 2 h inkubation, lägga till kranvatten från en sprutande flaska samling plattan så att hela ytan är täckt med vatten. Avbryta embryon och jäst med en mjuk borste.
  6. Häll återsuspenderade embryon från samling plattan i ett embryo samlingen korg (kommersiella cell silar med 100 µm porstorlek eller hemmagjord korgar17 fungerar bra), lägga till ytterligare kranvatten från en sprutande flaska, om det behövs. I detta skede, kombinera embryon från alla plattor som samlades parallellt. Samlingsprov representerar ett parti.
  7. Tvätta embryon väl genom att skölja korgen med kranvatten från en sprutande flaska för 30 s tills all jäst rester tvättas bort.
  8. Dechorionate embryon genom att placera samling korgen i en 2,5% natriumhypokloritlösning i vatten. Ljus agitation av virvlande underlättar borttagning av chorion. Fortsätt tills embryon är tillräckligt hydrofoba så att de flyter på ytan av lösningen när korgen lyfts ut och nedsänkt igen, vilket bör ta ~1.75–2 min.
    Försiktighet: natriumhypoklorit är frätande. Använd lämplig personlig skyddsutrustning. Lösningar som innehåller < 10% natriumhypoklorit kan vanligen kasseras i diskhon, kontrollera reglementet av institutets värd.
  9. Ta bort korgen från lösningen och skölj med rinnande vatten från en sprutande flaska tills blekmedel lukten inte längre är märkbar.

2. embryot fixering

Obs: Optimal fixering förhållanden, främst koncentrationen av tvättmedel, formaldehyd och varaktigheten av fixering, måste vara empirically beslutsamt att passa scenen av embryon. För steg runt den syncytial blastoderm, en slutlig koncentration av 0,5% Triton x-100 och 1,8% formaldehyd i vattenfasen fungerar bra. För senare stadier bortom embryostadiet 9 kan ytterligare optimering av dessa parametrar vara nödvändigt. Alla lösningar som används under fixering och sortering ska innehålla proteashämmare.

  1. Invertera samlingen korg och placera den över en 15 mL koniska centrifugering tub. Spola embryon från korgen in i röret med Pasteur pipett dispensering PBS-T (PBS, 0,5% Triton x-100).
  2. Låt embryon bosätta sig på botten och justera den totala volymen på 2 mL med PBS-T.
  3. Tillsätt 6 mL heptan och 100 µL av 37% formaldehyd i vatten.
    Försiktighet: Heptan och formaldehyd är giftiga vid inandning eller efter hud kontakt. Använd lämplig personlig skyddsutrustning och arbeta i dragskåp. Avfall som innehåller heptan eller formaldehyd har skall kasseras separat enligt värd institutets föreskrifter.
  4. Efter tillägg av formaldehyd, starta en 15 min timer och skaka tuben upp och ner för 1 min för hand. Vattenfasen och den organiska fasen kommer att kombinera till form en schampo-liknande konsistens.
  5. Agitera på en roterande mixer tills 10 min efter tillsats av formaldehyd.
  6. Centrifugera 500 x g för 1 min i rumstemperatur att samla embryon på botten av röret.
  7. Aspirera hela schampo-liknande vätskan och kasta det, utan för att aspirera alla embryon. Återstående mängder schampo-liknande supernatanten orsakar inte problem.
  8. 15 min efter tillsats av formaldehyd, Återsuspendera embryon i 5 mL PBS-T med 125 mM glycin att släcka formaldehyd. Blanda kraftigt genom att skaka upp och ner i 1 min.
  9. Centrifugera 500 x g i rumstemperatur i 1 min och sug ut supernatant.
  10. Tvätta embryon genom omblandning dem i 5 mL iskallt PBS-T. Låt embryon kvitta och aspirera alla supernatant.
  11. Upprepa tvätten i steg 2.10 två gånger.
  12. Hålla embryon på is tills sortering. Vanligtvis är det en bra idé att samla 3 – 4 partier av flyga embryon innan du fortsätter till sortering. Embryon bör dock sorteras samma dag. Utökad lagring på is eller i kylen leder till förändrad embryo morfologi.

3. embryot sortering

Obs: Sortering kan göras på någon fluorescerande stereo Mikroskop utrustat med GFP filter på 60 – 80 X förstoring.

  1. Med 1000 µL pipett överföra ett parti av ungefärligt 100 embryon till ett litet glas fartyg passar sortering, helst i en mörk färg, och placera den på is.
  2. Sortera embryon av nukleära densitet och cellcykeln status (figur 1) genom att trycka in önskvärt embryon i en separat hög med en nål eller spruta spets.
    1. Ta bort alla embryon med spridda, icke-nukleära distribution av andra-PCNA (figur 1E). Dessutom bör tas bort embryon som delvis visar en icke-nukleära GFP-signal.
    2. För att underlätta sorteringen, montera en line-up av referens embryon på nukleära cykel 12, 13 och 14 i varje parti med bilderna i figur 1 som en guide. Använd denna line-up för att matcha embryon från en okänd scenen med en av referens embryon för att avgöra deras fas.
    3. För att verifiera utvecklingsstadiet för referens embryon, mäta nukleära densiteten av imaging embryot och räknar antalet kärnor på ytan av embryot i en yta på 2 500 µm2 använda bildprogram som ger avståndsinformation.
      Obs: Det förväntade antalet kärnor till en yta på 2 500 µm2 är 12 till 16 kärnor på nukleära cykel 12 och 20 till 30 nuclei kärn cykel 1313.
  3. När alla embryon i ett lämpligt stadium separeras, tar bilder av embryona för dokumentation och kvalitetskontroll. Om stereomikroskopet inte själv är utrustad med en kameramodul, får någon epifluorescensmikroskop med GFP filter användas.
  4. Pipettera upp önskad embryon med 1000 µL pipett, överföring till en färsk tube och plats på is.
  5. Fortsätt tills tillräckligt många embryon sorteras för planerade experimentet. För embryon som är äldre än etapp 9, är generellt 20 embryon tillräcklig för en i situ Hi-C experiment. På nukleära cykel 12 är 80 embryon en bra utgångspunkt. I tidigare cykler, bör antalet embryon ungefär fördubblas för varje cykel.
  6. Pool och split embryon i 1,5 mL rör på ett sådant sätt att en tub innehåller tillräckligt embryon för en enda i situ Hi-C experimentera. Det är tillrådligt att använda rören med låg DNA bindande egenskaper, eftersom samma rör kommer att användas för hela protokollet och adsorption av DNA kan leda till betydande förluster vid låga DNA koncentrationer.
  7. Snurra rören kort på 100 x g i rumstemperatur och ta bort supernatanten. Embryon bör vara så torr som möjligt för frysning.
  8. Blixt frysa embryon av dränka rören i flytande kväve och förvaras vid-80 ° C.

4. in Situ Hej-C

  1. Lysis
    1. Placera rören med frysta embryon på is.
    2. Återsuspendera embryon i 500 µL iskall lyseringsbuffert (10 mM Tris-Cl pH 8,0, 10 mM NaCl, 0.2% IGEPAL CA-630, proteashämmare, upplöst i vatten). Vänta sedan 1 min för att låta embryon som avsätts i botten av röret.
    3. Mala embryon med en metall micro mortelstöt, pre kyls på isen, som är utformad för att passa tätt ett 1,5 mL mikrocentrifug rör.
      1. För att undvika agitera embryon, infoga mortelstöten långsamt tills det når botten av röret, tryck ner och sedan slipa av roterande mortelstöten två gånger i båda riktningarna.
      2. Lyft mortelstöten mycket lite tryck till botten av röret igen och upprepa slipning.
      3. Upprepa 4.1.3.2 10 gånger, eller tills embryona är helt lyserat. Lösningen ska vara homogen, och ingen kvarvarande stora bitar av embryon bör förbli.
    4. Inkubera homogeniserad fjädringen på is för 15 min. snurra på 1 000 x g, 4 ° C i 5 minuter och Kassera supernatanten.
    5. Tvätta pelleten genom omblandning i 500 µL iskall lyseringsbuffert, pipettering upp och ner.
    6. Snurra igen som i 4.1.4 och Kassera supernatanten.
    7. Återsuspendera tvättade pelleten i 100 µL av 0,5% sodium dodecyl sulfate (SDS), pipettering upp och ner. Permeabilize atomkärnor genom ruvning i 10 min vid 65 ° C i ett värmeblock. Släcka SDS genom att lägga till 50 µL 10% Triton X-100 och 120 µL vatten. Blanda genom att snärta röret.
    8. Inkubera vid 37 ° C under 15 minuter i värme block.
  2. Restriktionsenzym matsmältningen
    1. Tillsätt 25 µL 10 x restriktionsenzym buffert och 20 U av 5 U/µL MboI. Blanda genom att snärta röret.
    2. Smälta DNA genom inkubation under 90 minuter vid 37 ° C i värme block under liten agitation (750 rpm).
    3. Tillsätt ytterligare 20 U av MboI och fortsätt inkubation i 90 min.
    4. Värme-inaktivera MboI genom inkubation vid 62 ° C i 20 min.
  3. Överhäng ifyllning
    Obs: Fylla i överhänget med biotinylerade dATP tillåter val av specifika sammanskrivna fragment. Biotin-dATP i ligatur korsningar är skyddad från den exonuclease aktiviteten av T4 DNA-polymeras (avsnitt 4.6), medan biotin-dATP i unligated trubbiga ändar avlägsnas effektivt. Rullgardinsmenyn använda streptividin-belagda pärlor i avsnitt 4.7 därför specifikt berikar för sammanskrivna, chimär DNA-fragment.
    1. Lägg till 18 µL av 0,4 mM biotin-14-dATP, 2,25 µL av en oförändrad dCTP/dGTP/dTTP mix (3,3 mM varje) och 8 µL av 5 U/µL DNA-polymeras I Klenow fragmentet.
    2. Blanda genom att snärta röret och inkubera vid 37 ° C i 90 minuter i värmen block.
  4. Ligatur
    1. Lägg till 657 µL av vatten, 120 µL 10 x T4 DNA Ligase buffert, 100 µL 10% Triton x-100, 6 µL 20 mg/mL bovint serumalbumin (BSA), och blanda genom att snärta röret. Slutligen tillsätt 5 µL 5 U/µL T4 DNA-Ligase och blanda genom att snärta röret.
    2. Vrid röret försiktigt (20 rpm) i rumstemperatur i 2 h.
    3. Lägga till en andra avbetalning av 5 µL 5 U/µL T4 DNA-Ligase och fortsätta rotera för 2 mer h.
    4. Snurra ner kärnorna vid 2500 x g i 5 min och Kassera supernatanten.
  5. DNA-extraktion
    1. Återsuspendera pelleten i 500 µL av utvinning buffert (50 mM Tris-Cl pH 8,0, 50 mM NaCl, 1 mM etylendiamintetraättiksyrans dinatriumsalt (EDTA), 1% SDS, upplöst i vatten) och tillsätt 20 µL av 20 mg/mL proteinas K. Mix genom att snärta röret.
    2. Smälta protein genom inkubation vid 55 ° C i 30 min, skakningar vid 1000 rpm.
    3. Till de-crosslink, lägga 130 µL 5 M NaCl och inkubera över natten vid 68 ° C, skaka vid 1000 rpm.
    4. Pipett provet i en ny 2 mL tub, företrädesvis med låg DNA bindande egenskaper.
    5. Tillsätt 0,1 x volymer (63 µL) 3 M natrium acetat pH 5.2 och 2 µL av 15 mg/mL GlycoBlue. Blanda väl genom att vända. Lägg till 1,6 x-volymer (1 008 µL) av ren absolut etanol och blanda genom att vända.
    6. Inkubera vid-80 ° C under 15 min. Centrifugera vid 20 000 x g vid 4 ° C i minst 30 min. DNA pelleten är ofta mycket små, nästan osynliga, och kan bara upptäckas på grund av den blå färgen på GlycoBlue.
    7. Avlägsna supernatanten mycket noga, flytta pipettspetsen i röret längs den motsatta väggen från där DNA pelleten finns. Små återstående droppar avlägsnas ofta lätt under detta steg och de följande tvättarna genom att trycka dem ur rören med hjälp av en P10 spets snarare än pipettering dem ut.
    8. Tvätta pelleten genom att lägga till 800 µL av 70% etanol. Blanda genom att vända och centrifugera vid 20 000 x g i rumstemperatur i 5 min. Upprepa detta tvätta minst en gång.
    9. Ta bort alla spår av etanol och lämna den tube stående med locket öppet för upp till 5 min lufttorka. När ingen vätska återstår, tillsätt 50 µL 10 mM Tris-Cl pH 8,0. Upprepade gånger Pipettera lösningen över området på väggen av röret där pelleten lokaliserades till solubilize DNA.
    10. Tillsätt 1 µL 20 mg/ml RNase A, mix genom att snärta röret, och inkubera vid 37 ° C i 15 min att smälta RNA. Provet kan nu förvaras i kylskåp över natten eller fryst vid-20 ° C på obestämd tid.
    11. Kontrollera koncentrationen av DNA med ett fluorescerande färgämne baserat analys enligt tillverkarens anvisningar. Den totala mängden DNA i provet bör vara minst 10 ng, annars för lite material finns tillgängligt för förstärkning och bibliotek komplexitet kommer sannolikt att vara låg. När detta händer, förmodligen inte räckte för mängden utgångsmaterial eller material var förlorat längs vägen, kanske under Lys och nederbörd.
  6. Biotin borttagning och DNA klippning
    1. Lägga ihop 12 µL 10 x T4 DNA-polymeras buffert, 3 µL av 1 mM dATP, 3 µL av 1 mM dGTP och 46 µL av vatten. Blanda genom att snärta röret. Tillsätt 5 µL 3 U/mL T4 DNA-polymeras, blanda genom att snärta röret och inkubera vid 20 ° C i 30 min.
    2. Lägg 3 µL 0,5 M EDTA att stoppa reaktionen, och använda vatten för att få provet till en volym av ca 120 µL.
    3. Skeva DNA till en storlek på 200 – 400 bp använder en ultraljudsbehandling enhet enligt tillverkarens instruktioner. Använda den någon sonikator nämns i Tabell för material, följande program är lämpligt: 2 cykler varje 50 s, 10% tull, intensitet 5, 200 cykler/burst.
  7. Biotin pulldown
    1. Pipettera 30 µL av 10 mg/mL streptividin belagda magnetiska pärlor i en ny tub, separera dem på en magnetisk stå och Kassera supernatanten.
    2. Återsuspendera pärlor i 1 x B & W buffert (5 mM Tris-Cl pH 7,4, 0,5 mM EDTA, 1 M NaCl, upplöst i vatten) + 0,1% Triton x-100 och mix av vortexa. Placera röret på en magnetisk stå och vänta i 1 – 5 min tills pärlorna är åtskilda, beroende på märke och modell.
    3. Aspirera och kasta bort supernatanten medan glidande pipettspetsen längs väggen mittemot var pärlorna är belägna. Återsuspendera pärlor i 120 µL av 2 x B & W buffert (10 mM Tris-Cl pH 7,4, 1 mM EDTA och 2 M NaCl). Blanda genom vortexa.
    4. Överföra klippt DNA till en ny låg DNA bindande tub, och blanda med 120 µL pärla suspensionen i 2 X B & W buffert av vortexa. Rotera pärlor med DNA-provet vid 20 rpm i 15 min.
    5. Separata pärlor på en magnetisk stå och kasta bort supernatanten.
    6. Återsuspendera pärlor i 600 µL 1 x B & W + 0,1% Triton x-100 och inkubera vid 55 ° C i 2 min, skakningar vid 1000 rpm. Efter separationen, Kassera supernatanten. Upprepa denna tvätt en gång.
    7. Tvätta pärlor en gång med 600 µL 10 mM Tris-Cl pH 8,0 och Kassera supernatanten efter separation.
    8. Återsuspendera pärlor i 50 µL 10 mM Tris-Cl pH 8,0.

5. sekvensering bibliotek förberedelse

Obs: Alla bibliotek steg är gjort med komponenter från en kommersiell DNA bibliotek beredning kit (se Tabell för material). Dock kan alternativa kit eller andra reagenser ersättas. Nederbörd tenderar att formulär i biblioteket förberedelse agenter under frys förvaring. Det är därför viktigt att se till att alla nederbörd är upplöst innan med reagens.

  1. Slutet reparation
    1. Över pärla i 50 µL 10 mM Tris-Cl pH 8,0 till en ny PCR-röret.
    2. Lägga till 3 µL av slutet Prep enzym Mix och 7 µL av slutet Prep reaktion buffert. Blanda genom pipettering upp och ner.
    3. Överföra röret till en termocykel och kör följande program: 20 ° C i 30 min, 65 ° C i 30 min, och håll vid 4 ° C.
  2. Adapter ligatur
    1. Tillsätt 30 µL av ligering Master Mix, 2,5 µL 1,5 µm sekvensering adapter (utspädd till 1,5 µM från lager) och 1 µL Ligation förstärkare till bead upphängningen. Blanda genom pipettering upp och ner.
    2. Inkubera vid 20 ° C i 15 min i en termocykel.
    3. Tillsätt 3 µL av användaren enzym. Blanda genom pipettering upp och ner.
    4. Inkubera vid 37 ° C i 15 min i en termocykel.
    5. Separata pärlor på en magnetisk stå och ta bort supernatanten.
    6. Att tvätta pärlor, Omsuspendera pärlor i 100 µL av 1 x B & W buffert + 0,1% Triton x-100. Mix av vortexa och överföring till en ny mikrocentrifug rör. Separata pärlor på en magnetisk stå och ta bort supernatanten.
    7. Upprepa detta tvättas en gång med 600 µL av samma bufferten.
    8. Återsuspendera pärlor i 600 µL 10 mM Tris-Cl pH 8,0, mix av vortexa, och överföra pärlor till en ny tub.
    9. Separat pärlor på en magnetisk stå, Kassera supernatanten och återsuspendera pärlor i 50 µL 10 mM Tris-Cl pH 8,0.
  3. PCR-amplifiering
    1. Förbered två PCR-rören och i varje, blanda 25 µL av polymeras Master Mix, 1,5 µL 10 µM framåt (icke indexerade) PCR primer och 1,5 µL 10 µM omvänd (indexerade) PCR primer.
      Obs: Framåt (icke indexerade) PCR primer:
      5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC * T-3´.
      Omvänd (indexerade) PCR primer:
      5'-CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC * T-3´. * anger phosphorothioate obligationer och Ns i den indexerade PCR-primern.
    2. I varje rör, lägga till 22 µL pärla fjädring och blanda genom pipettering upp och ner.
    3. Köra PCR använder följande program: 98 ° C i 1 min, (98 ° C under 15 s, 65 ° C för 75 s, rampning 1,5 ° C/s) upprepade 9 - 12 gånger, 65 ° C i 5 min, och håll vid 4 ° C.
      Obs: Antalet förstärkning cykler har bestäms empiriskt. Dock fann vi att bibliotek som krävs mer än 12 behandlingscykler var i allmänhet av låg komplexitet och resulterade inte i hög kvalitet Hi-C kartor. Å andra var bibliotek som krävs mindre än 12 behandlingscykler inte påverkas negativt genom att förstärka för en fullständig 12 cykler. Det är därför möjligt att standard 12 cykler av förstärkning.
    4. Pool två PCR-reaktioner i ett enda mikrocentrifug rör, separata pärlor på en magnetisk stå och överför supernatanten innehållande biblioteket till en ny tub.
  4. Storlek urval
    1. Föra Ampure XP pärla suspension till rumstemperatur och blanda väl genom att skaka.
    2. Få volym av poolade PCR-reaktionen till exakt 200 µL med vatten. Under PCR och magnetisk separation är några av den ursprungliga volymen vanligtvis förlorade. Kontrollera volymen genom att ange pipetten till 200 µL och aspirera hela volymen av reaktionen. Om luften är aspirerade, mer vatten behöver tillsättas. Om volymen överstiger 200 µL, volymen av pärlor som lagts till i steg 5.4.3 och 5.4.6 proportionellt.
      Obs: Volymerna inom parentes är giltiga om den totala volymen av de poolade PCR-reaktionerna är exakt 200 µL.
    3. Lägg till 0.55 x-volymer (110 µL) Ampure XP pärla suspension och blanda genom pipettering upp och ner minst 10 gånger.
    4. Odla i rumstemperatur i 5 min, separat pärlor på en magnetisk stå i 5 min.
    5. Flytta supernatanten till en ny tub. Kassera den tube innehåller pärlorna. Pärlorna har bundna DNA > 700 bp, som är alltför stort att sekvenseras.
    6. Supernatanten, tillsätt 0,2 x volymer (40 µL, vilket resulterar i totalt 0,75 x Ampure buffert i provet) Ampure XP pärla upphängning och mix av pipettering upp och ner 10 gånger.
    7. Odla i rumstemperatur i 5 min, separat pärlor på en magnetisk stå i 5 min.
    8. Kassera supernatanten som innehåller DNA < 200 bp, som inkluderar gratis primer, primer dimerer och fragment för liten till sekvenseras.
    9. Låt röret på magnetiska stativet. Att tvätta pärlor, tillsätt 700 µL av 80% etanol, noga med att inte störa pärla pelleten och inkubera i 30 s.
    10. Kassera supernatanten, sedan ta tunnelbanan av magnetiska stativet och återsuspendera pärlor i 100 µL av 10 mM Tris-Cl pH 8,0. Blanda genom pipettering upp och ner 10 gånger och odla i rumstemperatur i 1 min.
    11. Lägg till 0.8 x-volymer (80 µL) Ampure XP pärla suspension. Blanda genom pipettering upp och ner 10 gånger och odla i rumstemperatur i 5 min. Denna andra omgång nedre gräns storlek urval säkerställer att slutliga biblioteket är helt fria från primers och primer dimerer.
    12. Separata pärlor på en magnetisk stå i 5 min och Kassera supernatanten.
    13. Tvätta pärla pelleten två gånger med 700 µL av 80% etanol för 30 s varje, medan röret i magnetiska montern, som ovan.
    14. Med röret fortfarande på det magnetiska stativet, ta bort alla spår av etanol. Det hjälper för att driva droppar etanol ur röret med P10 pipett. Låt resterande etanol avdunsta för max 5 min.
    15. Ta tube av magnetiska stativet och resuspendera pärlor i 50 µL 10 mM Tris-Cl pH 8,0. Blanda genom pipettering upp och ner 10 gånger.
    16. Odla i rumstemperatur i 5 min, sedan separat pärlor på en magnetisk stå.
    17. Överför supernatanten till en frisk slang. Detta är det slutliga Hi-C biblioteket, redo att kvantifieras och sekvenserade i nästa generations sekvensering maskiner, enligt tillverkarens instruktioner.

Representative Results

Sorterade embryo populationer på nukleära cykel 12, 13 och 14 (motsvarande 1:30, 1:45, och 2:10 timmar efter befruktning, respektive12) och 3-4 h efter befruktning (hpf) erhölls enligt de förfaranden som beskrivs i protokollet. Genom att ta bilder av andra-PCNA signalen av varje sorterad embryo parti, är det möjligt att dokumentera varje enda embryo som används i nedströms experiment exakt scenen och cellcykeln status. Exempel bilder av embryon från sorterade populationer visas i figur 1B-E. Produktionen av protokollet i situ Hi-C är en nukleotid bibliotek redo att sekvenseras på nästa generations sekvensering-maskiner. För detta ändamål krävs vanligtvis en sista bibliotek koncentration av minst 2 – 4 nM. Med de rekommendera mängderna insatsmaterial, denna koncentration är tillförlitligt uppnås (tabell 1).

Förväntad storlek distribution av DNA-fragment efter storlek urval är mellan 300 – 600 bp, med ett maximum på runt 500 bp ()figur 2A), beroende på den exakta klippning och storlek urvalsparametrar. För sekvensering rekommenderar vi Parade-end läsningar av minst 75 bp längd att minimera antalet unmappable begränsning fragment i genomet. Högupplösta kartor med 1 – 2 kb bin storlek kan erhållas från 400 miljoner läsningar. Vi rekommenderar sekvensering flera biologiska replikat på ~ 150 miljoner lägre djup läser varje, i stället för sekvensering en enda replikera på mycket stora djup. Detta tillåter bedömning av den biologiska variationen och leder till ett lägre antal kasserade läsningar på grund av PCR dubbelarbete. För visuell representation, kan replikerar kombineras. Innan de bestämmer sig sekvensering ett prov på hög djup, rekommenderar vi kör exempel med grunt sekvensering (några miljoner läsningar per prov) att fastställa grundläggande bibliotek kvalitetsparametrar som i figur 2B.

Analys av Hi-C data kräver betydande computational resurser och bioinformatik expertis. Som en grov översikt, den parkopplade läser mappas självständigt till referens genomet, de resulterande linjeföring filtreras för kvalitet och orientering, då en matris av kontakter på en given bin upplösning eller fragment nivå kan genereras från de filtrerade linjeföring. Kontakt matrisen är grunden för all vidare nedströms analys att utforska TADs, loopar och fack. För den inledande analysen av sekvensering läser, det finns flera bioinformatik rörledningar som aktiverar bearbetning av raw-läsningar till kontakt matriser utan mycket specialiserade bioinformatik kunskap18,19, 20,21,22,23. Hur ytterligare analys bärs ut beror till stor del på den exakta biologiska frågan under studien och kan kräva betydande erfarenhet av programmering och scripting i R eller Python. Flera verktyg och algoritmer att kalla TADs är dock tillgängliga5,24,25,26,27,28, samt programvara för att analysera och utforska Hi-C data i webbläsaren och som fristående skrivbordsprogram29,30,31,32.

När bearbetat, kan kvaliteten på biblioteket bestämmas med hjälp av olika mätvärden (figur 2B). Först, PCR dubbletter, som är antalet sekvenserade Läs par som härrör från samma ursprungliga molekyl, bör vara så låg som möjligt för att begränsa mängden bortkastad sekvens läsningar. Men även bibliotek med > 40% PCR dubbelarbete kan bearbetas till högkvalitativa kontakt kartor om dubbletter filtreras. För det andra bör graden av filtrerade läsningar på grund av sin läggning, enligt4, konsekvent lägre än 10% av justerad Läs par.

Under pre gastrular utvecklingen av Drosophila mellan nukleära cykel 12 och 14 är nukleära arkitekturen drastiskt ombyggda33 (figur 3). På nukleära cykel 12, några TADs upptäcks, och den totala fördelningen av kontakter är mycket smidigt utan många urskiljbara funktioner. Detta är dramatiskt förändrades på nukleära cykel 13 och 14, när TADs är alltmer framträdande och ospecifikt långväga kontakter är uttömda.

Figure 1
Figur 1: representativa bilder av andra-PCNA embryon under sortering. (A) andra-PCNA signal från en osorterade befolkning av embryon efter 60 min insamling och 2 h inkubation vid 25 ° C (B-E) exempel på embryon från sorterade populationer på nukleära cykel 12 (B), nukleära cykel 13 (C), 14 () kärntekniska cykel ( D), och från embryon som genomgår synkron Mitos (E). Skala barer = 200 µm. vänligen klicka här för att visa en större version av denna siffra.

Figure 2
Figur 2: Exempel på i situ Hi-C bibliotek kvalitet mätvärden. (A) Bioanalyzer spår visar fördelningen av DNA fragment storlekar från en framgångsrik Hi-C bibliotek (bibliotek 1, övre) och ett bibliotek som visar en topp av fragment som är för stora för sekvensering (bibliotek 2, undre). Biblioteket 2 sekvenserades framgångsrikt, men även större mängder oönskade DNA-fragment kan leda till minskad sekvensering avkastning. (B) filtrering statistik av två Hi-C-bibliotek: visas är antalet justerad Läs par som är undantagna från ytterligare analys på grund av Läs orientering och avstånd (inåt, utåt)4 eller PCR dubbelarbete (dubbla). I varje stapel ritas antalet läsningar som passerar filtret (återstående) och sviktande (filtrerat). Procentandelen av läser passerar filtret visas dessutom som text. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: Hej-C interaktion kartor från stegvis embryon. Hi-C interaktion kartorna är kastas i papperskorgen på 10 kb upplösning och balanserad som beskrivs innan33. Visas är en region på kromosom 2 L. vänligen klicka här för att visa en större version av denna siffra.

Bibliotek Skede Antal embryon Mängden DNA innan klippning (ng) PCR-cykler Slutliga bibliotek koncentration (nM)
1 nukleära cykel 12 71 46 12 28,2
2 nukleära cykel 12 46 40 12 22,2
3 nukleära cykel 12 60 13 13 12.3
4 nukleära cykel 13 36 39 12 22,2
5 nukleära cykel 13 35 10 12 5.0
6 nukleära cykel 13 48 18 12 8,7
7 nukleära cykel 14 33 30 12 39,8
8 nukleära cykel 14 24 36 12 20,4
9 nukleära cykel 14 14 8 12 4.2
10 3-4 hpf 17 30 12 24,0
11 3-4 hpf 18 42 11 19,1
12 3-4 hpf 22 63 11 48,4

Tabell 1: förteckning över representativa sekvensering Statistikbiblioteket. För varje bibliotek i listan antalet embryon som användes för sin generation, mängden totala DNA innan biotin pulldown och klippning mätt med Qubit, cykler antalet PCR används för förstärkning och sekvensering biblioteket slutliga koncentration efter rening och storlek urvalet indikeras.

Discussion

Det protokoll som presenteras här är mycket effektiv på att skapa högkvalitativa kartor av kromatin arkitektur i tidiga Drosophila embryon. Jämfört med ett tidigare protokoll34, använder den metod som beskrivs här en aktuell i situ Hi-C förfarande5, vilket resulterar i snabbare bearbetning, högre upplösning, och mindre reagens användning. Det övergripande förfarandet inklusive i situ Hi-C protokollet förväntas arbeta på en rad olika stadier och experimentella system förutom Drosophila. Eftersom protokollet har en låg ingång krav, kan det också användas på isolerade cellpopulationer. I Drosophila, när använda protokollet för embryon utanför intervallet som beskrivs här, vissa parametrar, kan särskilt fixering av materialet, behöva justeras. Eftersom äldre embryon utveckla en mycket tät nagelband, kan höja koncentrationen av formaldehyd och förlänga fixering vara lämpligt. För insamling av embryon i skeden än kärnkraft cykel 14, de andra inkubationstider embryon vid 25 ° C i steg 1.4 behöver justeras enligt följande: nukleära cykel 12, 70 min; nukleära cykel 13, 90 min; 3 – 4 hpf, 3:30 h.

Under divisionerna 13 klyvning (etapp 1-4), fördubblas kärnor tätheten ungefär med varje division. Atomkärnor kan lätt identifieras genom sin ljusa GFP-fluorescens. Under Mitos, andra-PCNA ligger inte i kärnan och dess signal är spridda över hela embryot. Denna funktion gör att identifiera embryon som genomgår en synkron klyvning division möjligt. För att studera kromatin konformation, är dessa mitotiska embryon oftast inte önskvärt, eftersom den mitotiska organisationen av kromatin är drastiskt annorlunda än de interphase organisation35. Det är möjligt att anpassa protokollet specifikt Markera embryon som genomgår en synkron mitotiska division. I detta fall endast embryon med spridda, icke-nukleära distribution av andra-PCNA bör hållas, och alla andra embryon ska kasseras. Eftersom den nukleära tätheten inte kan fastställas, måste alternativa metoder till scenen embryon av deras morfologi i överförda ljusmikroskopi användas. Förekomsten av pole celler och atomkärnor embryo periferi indikera att embryot har avslutat minst kärnkraft cykel 9, medan synliga cellularization i periferin indikerar nukleära cykel 1412.

Hi-C experiment kan utföras framgångsrikt med ett brett urval av restriktionsenzym5. Nuvarande metoder använder vanligtvis enzymer som känner igen antingen en 4-base-sekvens, till exempel MboI eller en 6-base erkännande webbplats, till exempel HindIII. Fördelen med 4-base fräsar över 6-base fräsar är att de erbjuder högre potentiella upplösning, gett tillräckligt sekvensering djup och en mer jämn täckning av begränsning platser över genomet. Det finns ingen tydlig fördel att välja en 4-base cutter över ytterligare5,23,36,37. De två vanligaste enzymerna, MboI och DpnII, igen båda samma GATC erkännande plats. DpnII är mindre känslig för CpG metylering, som inte berör i Drosophila. Det protokoll som presenteras här kan även slutföras med DpnII som ett restriktionsenzym. I avsnitt 4.2. restriktionsenzym och buffert måste justeras för DpnII kompatibilitet, enligt tillverkarens rekommendationer.

Om fragmentet storleken av sekvensering biblioteket avviker väsentligt från det område som visas i figur 2A, kan kluster bildas under sekvensering vara mindre effektiv eller misslyckas helt. I det här fallet storleksfördelning efter klippning bör kontrolleras och klippning parametrar justeras därefter. Toppar i fördelningen av DNA-fragment av mycket små (< 100 bp) eller mycket stora (> 1000 bp) storlekar indikerar problem med storlek urval, såsom carry över av pärlor eller supernatanten som ska kasseras. Ofta dessa bibliotek med små toppar på dessa oönskade storlekar, såsom den på bilden, är fortfarande sekvenserade framgångsrikt med endast en smärre minskning klustring effektivitet.

Höga priser för PCR dubbelarbete bör undvikas eftersom detta minskar drastiskt antalet användbara sekvensen läser. Graden av PCR dubbletter är direkt relaterad till mängden ingående material. Med mer input därför avhjälper vanligtvis problem med PCR dubbelarbete.

Högre antal läsningar filtreras på grund av Läs orientering ()figur 2B) indikera otillräcklig matsmältningen, vilket kan vara resultatet av att använda för lite enzym, för mycket insatsmaterial eller ofullständig homogenisering av embryon.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Forskningen finansierades av Max Planck Society. C.B.H. stöddes av ett stipendium från den internationella Max Planck forskarskolan – molekylär biomedicin. Vi tackar Shelby Blythe och Eric Wieschaus för vänligt att ge andra-PCNA Drosophila melanogaster linjen.

Materials

Name Company Catalog Number Comments
Biotin-14-dATP Life Technologies 19524016
MboI New England Biolabs R0147L
DNA Polymerase I Klenow Fragment New England Biolabs M0210L
T4 DNA Ligase Thermo Fisher EL0012 T4 DNA Ligase Buffer included
T4 DNA Polymerase New England Biolabs M0203L
Proteinase K AppliChem A4392
GlycoBlue Life Technologies AM9516
Complete Ultra EDTA-free protease inhibitors Roche 5892791001
NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) New England Biolabs E7335 Sequencing Adaptor, Forward (unindexed) PCR primer and Reverse (indexed) PCR primer and USER enzyme used in the Library preparation section are components of this kit
NEBNext Ultra II DNA Library Prep Kit New England Biolabs E7645 End Prep Enzyme Mix, End Prep Reaction Buffer, Ligation Enhancer, Ligation Master Mix and Polymerase Master Mix used in the Library preparation section are components of this kit
Covaris S2 AFA System Covaris
DNA LoBind Tubes, 1.5 mL Eppendorf 0030108051
Falcon cell strainer 100 µm Corning 352360 Embryo collection baskets
37% formaldehyde VWR 437536C
Heptane AppliChem 122062.1612
M165 FC fluorescent stereo microscope Leica
M165 FC DFC camera Leica
Metal micro pestle Carl Roth P985.1 Used to lyse embryos in step 4.1.4
RNase A AppliChem A3832,0050
Dynabeads MyOne Streptavidin C1 Life Technologies 65002 Streptavidin coated magnetic beads
Ampure XP beads Beckman Coulter A63881
Qubit 3.0 Fluorometer Thermo Fisher Scientific Q33216
Qubit assay tubes Thermo Fisher Scientific Q32856
Qubit dsDNA HS Assay Kit Thermo Fisher Scientific Q32854
Phosphate buffered saline (PBS) Sigma-Aldrich P4417
eGFP-PCNA flies Gift from S. Blythe and E. Wieschaus
Sodium hypochlorite 13% Thermo Fisher AC219255000
Triton X-100 AppliChem A4975
Tris buffer pH 8.0 (1 M) for molecular biology AppliChem A4577
NaCl AppliChem A2942
IGEPAL CA-630 Sigma-Aldrich I8896
1.5 mL microcentrifuge tubes Greiner Bio-One 616201
SDS for molecular biology AppliChem A2263
10x CutSmart buffer New England Biolabs B7204S Restriction enzyme buffer
PCR Nucleotide Mix Sigma-Aldrich 11814362001 Unmodified dCTP, dGTP, dTTP
BSA, Molecular Biology Grade New England Biolabs B9000S
EDTA 0.5 M solution for molecular biology AppliChem A4892
Sodium acetate 3 M pH 5.2 Sigma-Aldrich S7899
DynaMag-2 Magnet Life Technologies 12321D Magnetic stand
Intelli-Mixer RM-2L Omnilab 5729802 Rotator
ThermoMixer F1.5 Eppendorf 5384000012 Mixer
Small Embryo Collection Cages Flystuff.com 59-100 Egg collection cage
Centrifuge 5424 R Eppendorf 5404000413
C1000 Touch Thermal Cycler Bio-Rad 1851148
PCR tube strips Greiner Bio-One 673275
NEBuffer 2.1 New England Biolabs B7202S T4 DNA Polymerase buffer

DOWNLOAD MATERIALS LIST

References

  1. Bonev, B., Cavalli, G. Organization and function of the 3D genome. Nat Rev Genet. 17, (11), 661-678 (2016).
  2. Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, (5950), 289-293 (2009).
  3. Dixon, J. R., et al. Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature. 485, (7398), 376-380 (2012).
  4. Jin, F., et al. A high-resolution map of the three-dimensional chromatin interactome in human cells. Nature. (2013).
  5. Rao, S. S. P., et al. A 3D Map of the Human Genome at Kilobase Resolution Reveals Principles of Chromatin Looping. Cell. 159, (7), 1665-1680 (2014).
  6. Darbellay, F., Duboule, D. Topological Domains, Metagenes, and the Emergence of Pleiotropic Regulations at Hox Loci. Current topics in developmental biology. 116, 299-314 (2016).
  7. Beagan, J. A., et al. Local Genome Topology Can Exhibit an Incompletely Rewired 3D-Folding State during Somatic Cell Reprogramming. Cell stem cell. 18, (5), 611-624 (2016).
  8. Andrey, G., et al. Characterization of hundreds of regulatory landscapes in developing limbs reveals two regimes of chromatin folding. Genome Res. 27, (2), 223-233 (2017).
  9. Krijger, P. H. L., de Laat, W. Regulation of disease-associated gene expression in the 3D genome. Nature Reviews. Molecular Cell Biology. 17, (12), 771-782 (2016).
  10. Sexton, T., et al. Three-dimensional folding and functional organization principles of the Drosophila genome. Cell. 148, (3), 458-472 (2012).
  11. Ghavi-Helm, Y., et al. Enhancer loops appear stable during development and are associated with paused polymerase. Nature. 512, (7512), 96-100 (2014).
  12. Foe, V. E., Alberts, B. M. Studies of nuclear and cytoplasmic behaviour during the five mitotic cycles that precede gastrulation in Drosophila embryogenesis. J Cell Sci. 61, 31-70 (1983).
  13. Blythe, S. A., Wieschaus, E. F. Zygotic Genome Activation Triggers the DNA Replication Checkpoint at the Midblastula Transition. Cell. 160, (6), 1169-1181 (2015).
  14. Blythe, S. A., Wieschaus, E. F. Establishment and maintenance of heritable chromatin structure during early Drosophila embryogenesis. eLife. 5, e20148 (2016).
  15. JoVE Science Education Database. Embryo and Larva Harvesting and Preparation. Biology I: yeast, Drosophila and C. elegans. Drosophila melanogaster. JoVE, Cambridge, MA. (2017).
  16. Sicaeros, B., O'Dowd, D. K. Preparation of Neuronal Cultures from Midgastrula Stage Drosophila Embryos. Journal of Visualized Experiments. (5), (2007).
  17. Shermoen, A. W. Preparation of Baskets for Drosophila Egg Collections, Treatments, and Incubations. Cold Spring Harbor Protocols. (10), (2008).
  18. Ay, F., Noble, W. S. Analysis methods for studying the 3D architecture of the genome. Genome biology. 16, (1), 183 (2015).
  19. Lazaris, C., Kelly, S., Ntziachristos, P., Aifantis, I., Tsirigos, A. HiC-bench: comprehensive and reproducible Hi-C data analysis designed for parameter exploration and benchmarking. BMC Genomics. 18, (1), (2017).
  20. Servant, N., et al. HiC-Pro: an optimized and flexible pipeline for Hi-C data processing. Genome Biology. 16, (1), (2015).
  21. Durand, N. C., et al. Juicer Provides a One-Click System for Analyzing Loop-Resolution Hi-C Experiments. Cell systems. 3, (1), 95-98 (2016).
  22. Lajoie, B. R., Dekker, J., Kaplan, N. The Hitchhiker's guide to Hi-C analysis: Practical guidelines. Methods. 72, 65-75 (2015).
  23. Schmitt, A. D., Hu, M., Ren, B. Genome-wide mapping and analysis of chromosome architecture. Nature Reviews. Molecular Cell Biology. 17, (12), 743-755 (2016).
  24. Shin, H., et al. TopDom: an efficient and deterministic method for identifying topological domains in genomes. Nucleic Acids Res. 44, (7), e70 (2016).
  25. Kruse, K., Hug, C. B., Hernández-Rodríguez, B., Vaquerizas, J. M. TADtool: visual parameter identification for TAD-calling algorithms. Bioinformatics. 32, (20), 3190-3192 (2016).
  26. Lévy-Leduc, C., Delattre, M., Mary-Huard, T., Robin, S. Two-dimensional segmentation for analyzing Hi-C data. Bioinformatics. 30, (17), Oxford, England. i386-i392 (2014).
  27. Filippova, D., Patro, R., Duggal, G., Kingsford, C. Identification of alternative topological domains in chromatin. Algorithms for molecular biology: AMB. 9, (1), 14 (2014).
  28. Crane, E., et al. Condensin-driven remodelling of X chromosome topology during dosage compensation. Nature. 523, (7559), 240-244 (2015).
  29. Durand, N. C., et al. Juicebox Provides a Visualization System for Hi-C Contact Maps with Unlimited Zoom. Cell systems. 3, (1), 99-101 (2016).
  30. Zhou, X., et al. Exploring long-range genome interactions using the WashU Epigenome Browser. Nature Methods. 10, (5), 375-376 (2013).
  31. Ramírez, F., et al. High-resolution TADs reveal DNA sequences underlying genome organization in flies. bioRxiv. 115063 (2017).
  32. Kerpedjiev, P., et al. HiGlass: Web-based Visual Comparison And Exploration Of Genome Interaction Maps. bioRxiv. 121889 (2017).
  33. Hug, C. B., Grimaldi, A. G., Kruse, K., Vaquerizas, J. M. Chromatin Architecture Emerges during Zygotic Genome Activation Independent of Transcription. Cell. 169, (2), (2017).
  34. Berkum, N. L., et al. Hi-C: a method to study the three-dimensional architecture of genomes. Journal of Visualized Experiments: JoVE. (39), (2010).
  35. Naumova, N., et al. Organization of the mitotic chromosome. Science. 342, (6161), 948-953 (2013).
  36. Denker, A., de Laat, W. The second decade of 3C technologies: detailed insights into nuclear organization. Genes & development. 30, (12), 1357-1382 (2016).
  37. Belaghzal, H., Dekker, J., Gibcus, J. H. Hi-C 2.0: An optimized Hi-C procedure for high-resolution genome-wide mapping of chromosome conformation. Methods (San Diego, Calif). 123, 56-65 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics