Создание первого поля как сердце сердца прародителями и кардиомиоцитов желудочков как от человеческих плюрипотентных стволовых клеток

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Здесь мы описываем масштабируемый метод, используя простое сочетание Activin и Лентивирусы опосредованной Id1-гиперэкспрессия, для создания первого сердца поле как сердечная прародителями и кардиомиоцитов желудочков как из человеческих плюрипотентных стволовых клеток.

Cite this Article

Copy Citation | Download Citations

Yu, M. S., Spiering, S., Colas, A. R. Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells. J. Vis. Exp. (136), e57688, doi:10.3791/57688 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Поколение большое количество функциональных человеческих плюрипотентных стволовых клеток, полученных сердца прародителями и кардиомиоцитов определенных сердце области происхождения является предварительным условием для терапии сердечной клетки и моделирование болезней. Недавно мы показали, что гены Id необходимых и достаточных для указания первого прародителями поля сердца во время развития позвоночных. Эта дифференциация протокол использует эти выводы и использует гиперэкспрессия Id1 в сочетании с Activin как мощным указание подсказки производить первый сердце поля как прародителями (FHF-L). Важно отметить, что результирующая прародителями эффективно дифференцироваться (~ 70 – 90%) в кардиомиоцитов желудочков как. Здесь мы описываем подробный метод 1) генерировать Id1 экспрессирующих hPSCs и 2) дифференцировать cryopreservable прародителями FHF-L и кардиомиоцитов желудочков как масштабируемые количествах.

Introduction

Крупномасштабное производство человеческих плюрипотентных стволовых клеток (hPSCs)-производных сердца прародителями и кардиомиоцитов является предпосылкой для основанного на стволовых клеток лечение1, болезни,2,3 и быстрое характеристика моделирования Роман пути регулирования сердца дифференциация4,5,6 и физиологии7,,8. Хотя ряд исследования9,10,,11,12,13,,14,15 ранее описал высокоэффективных сердца дифференциация протоколы от hPSCs, никто не обратился сердца поле происхождение результате кардиомиоцитов, несмотря на выявление существенных молекулярные различия между левой (первое поле сердца) и правый (второе сердце поле) кардиомиоцитов желудочков16 и существование врожденных пороков сердца сердце конкретного поля; то есть, гипоплазии левого желудочка синдром17 или аритмогенная дисплазия правого желудочка18. Таким образом, поколение сердечной прародителями и кардиомиоцитов определенных сердце области происхождения из hPSCs становится необходимостью для того, чтобы повысить их актуальность как терапевтические и болезни, инструменты моделирования.

Этот протокол основывается на учредительном гиперэкспрессия Id1, недавно выявленных5 первый сердце поле Указание подсказки, в сочетании с Activin, необходимыми и достаточными для возбуждения cardiogenesis в hPSCs. В частности, Каннингем и др. (2017) 5 показывают, что Id1-индуцированной прародителями специально Экспресс первое поле сердца (HCN4, TBX5), но не второй маркеры поля сердца (SIX2, ISL1), как они проходят сердца дифференциации. Кроме того авторы также показывают, что трансгенные мыши эмбрионы не хватает вся семья Id генов (Id1-4), без формирования первого сердце поля сердца прародителями, при более медиальной и задняя сердца прародителями ( Второе сердце поле) по-прежнему могут образовывать, тем самым предлагая, что белки Id необходимо начать первый сердце поля cardiogenesis в естественных условиях. Удобно, Id1-индуцированной прародителями может быть замораживают и спонтанно дифференцироваться в кардиомиоцитов, отображение желудочков подобные характеристики, включая выражение желудочков специфических маркеров (IRX4, MYL2) и желудочков как потенциалы действия.

Здесь мы опишем простой и масштабируемый метод для создания первого сердца поле как (FHF-L) сердечной прародителями и кардиомиоцитов желудочков как от Id1 избытком hPSCs. Важной особенностью этого протокола является возможность расцепить сердца прародитель поколения от последующих cardiomyocyte производства, используя удобный криоконсервирования шаг. Таким образом этот протокол детали необходимые шаги (1) генерировать Id1 экспрессирующих hPSCs, (2) создать сердца прародителями FHF-L от hPSCs, (3) криоконсервировать результате прародителями и (4) возобновить FHF-L сердца прародитель дифференциации и генерировать высокообогащенного (> 70 – 90%) избиение кардиомиоцитов желудочков как.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Id1 вирус подготовки и инфекции

  1. Генерировать Id1 избытком человека совместно transfecting pCMVDR8.74, pMD2.G и pCDH-EF1-Id1-ПГК-PuroR (Addgene: плазмида #107735) в HEK293T клетки. Собирать вирусных частиц, фильтрата, очищают от супернатант и хранить при температуре-80 ° C как Китамура и др. (2003) 19. Кроме того, производят Id1 человека коммерчески, отправив pCDH-EF1-Id1-ПГК-PuroR Лентивирусы производителей поставщиков.
    Предупреждение: Пожалуйста, следуйте лентивирусные безопасности правила и стандартные операции протоколов.
    Примечание: Важно: титр оптимального вирус должен быть по крайней мере 108 -109 Transducing единиц/мл (TU/мл).
  2. До инфекции пальто одной скважиной 96 также пластины с 50 мкл Реагента покрытие, обычно смесь желатиновой белка выделяется клетками Engelbreth-холм-Рой мыши саркома (см. Таблицу материалы).
  3. Отделить один хорошо плюрипотентных стволовых клеток, выращиваемых в 6 хорошо пластины, добавив 1 мл PBS без Ca2 + и Mg2 + и с 0,5 мм ЭДТА.
    Примечание: Время диссоциации варьируется от 3-10 мин. Когда более чем 80% клеток отсоединяются от нижней части пластины, переходите к следующему шагу.
  4. Соберите суспензию клеток с стерильные пипетки в 15 мл пластиковых пластиковых пробирок.
  5. Нейтрализовать диссоциации реагента с 5 мл PBS-содержащих Ca2 + и Mg2 +.
  6. Пелле клетки центрифугированием (200 g x 3 мин).
  7. Удалить супернатант и мягко проведите трубки для того, чтобы выбить гранулы.
  8. Вновь приостановите клеток в 1 мл стволовых клеток средств массовой информации.
  9. Подсчитать ячейки, используя счетчик автоматизированных клеток, следуя инструкциям производителя.
  10. Пластина 20000 жизнеспособных клеток за покрытием хорошо (96-луночных Латы) в 50 мкл стволовых клеток СМИ с 2 мкм Ро/рок путь ингибитор (см. таблицы 1 и 2).
  11. После 24 часов, контролировать ячейки вложения и заменить средства массовой информации 100 мкл стволовых клеток СМИ с 2 мкм Ро/рок путь ингибитора и 6 нг/мл hexadimethrine бромид (см. таблицы 1 и 2), один час до лентивирусные инфекции.
    Примечание: Клетки должны прочно прикреплены к нижней пластине.
  12. Оттепель Id1-человека на льду.
  13. 3 мкл очищенный человека за хорошо (титр вируса должна быть между 108 -109 ту/мл) и затем передать пластины обратно в инкубатор культуры клеток (37 ° C, 5% CO2, 20% O2).
  14. 24 ч после вирусной инфекции, 100 мкл СМИ свежие стволовых клеток в инфицированных клетках.
  15. 48 ч после лентивирусные инфекции, заменить вирус, содержащий СМИ с 200 мкл свежие стволовых клеток СМИ с 1 мкг/мл puromycin.
  16. Обновление средства массовой информации ежедневно с 200 мкл стволовых клеток СМИ с 1 мкг/мл puromycin.
  17. Когда культур достигают 80% confluency, разбить ячейки с помощью 200 мкл PBS без Ca2 + и Mg2 + + 0,5 мм ЭДТА (для одной скважиной 96-луночных плиты).
  18. Соберите суспензию клеток в пластиковых пробирок.
  19. Нейтрализовать диссоциации реагента с 5 мл PBS-содержащих Ca2 + и Mg2 +.
  20. Пелле клетки центрифугированием (200 g x 3 мин).
  21. Удалить супернатант и мягко проведите трубки для того, чтобы выбить гранулы.
  22. Вновь приостановите клеток в 1 мл стволовых клеток СМИ дополнена ингибитор путь Ро/рок-2 мкм.
  23. Передать все клетки (1 мл) покрытием о 12-ну пластины хорошо.
  24. После 24 часов монитор для клеток привязанность к хорошо и замена средств массовой информации с 1 мл стволовых клеток СМИ дополнена ингибитор путь Ро/рок 2 мкм и 6 нг/мл hexadimethrine бромид, один час до трансдукции.
  25. Оттепель Id1-человека на льду.
  26. 5 мкл очищенный вирус в колодец (12-ну плита).
  27. 24 ч после лентивирусные инфекции, заменить вирус, содержащий СМИ с 1 мл свежего стволовых клеток СМИ, дополненный 3 мкг/мл puromycin.
  28. 48 ч пост лентивирусные инфекции, заменить вирус, содержащий СМИ с 1 мл свежего стволовых клеток СМИ с 6 мкг/мл puromycin.
  29. Когда культур достигают 80% confluency, разъединять клеток с использованием 500 мкл PBS без Ca2 + и Mg2 + и с 0,5 мм ЭДТА (для одной скважиной 12-ну плиты).
  30. Половина передачи (250 мкл) суспензии клеток к одной скважиной покрытие реагента покрытием 6-ну пластины, содержащий 2 мл стволовых клеток СМИ с 2 мкм Ро/рок путь ингибитор.
  31. Используйте другой половины (250 мкл) образца для РНК добыча и qRT ПЦР для того чтобы определить лентивирусные опосредованной Id1 уровни выражения, как кола и др. (2012) 4.
    Примечание: Важно: Если Id1 уровни mRNA выражение меньше 0,005 раза GAPDH выражение уровней (см. таблицу 3 для qRT ПЦР праймеры), повторите процесс инфицирования, как описано выше, до тех пор, пока превышают уровни выражения Id1 порог.

2. hPSCsId1 обслуживания

  1. Культура hPSCsId1 в колодец пластины с покрытием 6 и расти в 3 мл на хорошо стволовых клеток СМИ с 6 мкг/мл puromycin.
  2. Когда hPSCsId1 достигают 80% confluency, проход клетки, как агрегатов (Сплит соотношение 1:6) с помощью фермента бесплатно диссоциации реагента, следование рекомендациям поставщика и расти в 3 мл на хорошо стволовых клеток СМИ с 6 мкг/мл puromycin.

3. Подготовка hPSCsId1 дифференциация

  1. Покройте 12-ну плита с 500 мкл на хорошо покрытием реагента.
  2. КогдаId1 достигают 90% confluency hPSCs отделить клетки, добавив 1 мл PBS без Ca2 + и Mg2 + и с 0,5 мм ЭДТА в колодец на 5 – 10 минут проверить процесса диссоциации каждую минуту, и однажды 80% клеток отделить от пластины , перейдите к следующему шагу.
  3. Соберите суспензию клеток в пластиковых пробирок.
  4. Нейтрализовать диссоциации реагента с 5 мл PBS-содержащих Ca2 + и Mg2 +.
  5. Пелле клетки центрифугированием (200 g x 3 мин).
  6. Удалить супернатант и мягко проведите трубки для того, чтобы выбить гранулы.
  7. Вновь приостановите клетки в 2 мл стволовых клеток СМИ дополнена ингибитор путь Ро/рок-2 мкм.
  8. Подсчитать ячейки, используя счетчик автоматизированных клеток.
  9. Плита 300 000 ячеек на скважину в 1 мл стволовых клеток СМИ, дополненная 2 мкм Ро/рок путь ингибитора и 6 мкг/мл puromycin и пластина передачи в инкубатор культуры ткани.
  10. Обновление средства массовой информации ежедневно по 2 мл стволовых клеток СМИ, дополненные 6 мкг/мл puromycin культур до 90% confluency. На данный момент, инициировать сердца дифференциации (следующий шаг).

4. дифференциация hPSCsId1 в первый сердце поля как сердечная прародителями (CPs FHF-L)

  1. Для формат 12-ну пластины, инициировать дифференциации (день 0), заменив СМИ стволовых клеток с 1,5 мл индукции СМИ (Таблица 1) дополняется Activin (100 нг/мл) (см. в таблице 2 для рекомендованных томов и Activin A концентрации для плиты различных форматов).
  2. День 1 (24 ч после того, как дифференциация инициируется) Замените СМИ с 2 мл индукции СМИ без Activin A (за хорошо 12-ну плиты).
  3. На третий день замените 2 мл индукции СМИ без Activin A (за хорошо плиты 12-а) средства массовой информации.
  4. На 5 день, собирать CPs FHF-L для криоконсервации (следующий шаг).
    Примечание: Важно: криоконсервирования является предпочтительным в этот момент, как это позволяет расцепить сердца прародитель поколения от последующих cardiomyocyte производства и биобанке больших партий клеток. Обратите внимание, что Кроме того, день 5 CPs FHF-L может быть передан свежезаваренным покрытием плиты продолжать дифференциации, пожалуйста просмотрите шаги 5.1 – 5,5 до passFHF-L CPs и затем перейти к шагу 6.5 для дифференциации.

5. криоконсервирования FHF-L CPs

  1. Аспирационная всех средств массовой информации из скважин, содержащих 5 день FHF-L CPs и быстро добавить 1 мл теплой (37 ° C) 1 x фермента содержащих диссоциации реагента (см. Таблицу материалы). Место пластину в инкубатор культуры ткани.
  2. После 1 мин встряхните пластины стороны в сторону в инкубаторе.
  3. Через 2 мин (полное время) удалить пластину из инкубатора и добавить 1 мл 10% FBS средств массовой информации.
  4. Аккуратно клетки накапайте вверх и вниз с 5 мл пипетки для облегчения ячейке отрешенности от пластины.
  5. Собирать суспензию клеток для центрифуг трубки и Пелле клетки центрифугированием при 200 g x 3 мин
  6. Вновь приостановите Пелле клеток в 2 мл реагента криоконсервирования.
  7. Подсчитать ячейки, используя счетчик автоматизированных клеток.
  8. Добавить криоконсервирования реагента (см. Таблицу материалы) в достаточном объеме для криоконсервации клеток в нужной концентрации (обычно 5 – 10 х 106 клеток/мл).
  9. Передать флаконов криоконсервирования клетки и место флаконов в охлаждения устройства (1 ° C/мин) и поместите устройство охлаждения в морозильной камере-80 ° C на ночь.
  10. После 24 часов передавать жидкого азота для длительного хранения замороженных флаконов.
    Примечание: Протокол может быть приостановлена здесь.

6. FHF-Л CP дифференцировку в кардиомиоцитов желудочков как

  1. Передача 5 день FHF-L CPs замороженные флаконы от хранения жидкого азота в контейнер сухого льда.
  2. Место флаконов в ванну воды 37 ° C для 2-3 мин, до тех пор, пока полностью разморожен суспензию клеток.
    Примечание: Важно: процесс размораживания чувствителен к время. Разоблачение клетки для криоконсервирования СМИ за чрезмерное количество времени (т.е., 10 мин) будет уменьшаться жизнеспособность клеток.
  3. Клетки перехода к 15 или 50 мл пластиковых пробирок, в зависимости от количество талой флаконов.
  4. Отказаться от прикапывают (5 капель каждые 30 секунд) подогретым (37 ° C) кардиогенным СМИ (Таблица 1) клетки решения. Продолжать этот процесс до 1:3 криоконсервирования СМИ: кардиогенный СМИ соотношение достигается. На данный момент, увеличить частоту добавления кардиогенным СМИ до 1:10 криоконсервирования СМИ: кардиогенный СМИ соотношение достигается.
    Примечание: Важно: быстрое осмолярности изменения увеличит смерти клетки во время процесса размораживания; Таким образом прикапывают добавлением кардиогенным СМИ как описано выше настоятельно рекомендуется.
  5. Центрифуга подвеска и Пелле клетки клетки центрифугированием (200 g x 3 мин).
  6. Удалить супернатант и мягко проведите пластиковых пробирок выбить клеток Пелле.
  7. Вновь приостановить клетки с кардиогенным СМИ, дополнена ингибитор путь Ро/рок-2 мкм.
    Примечание: Жизнеспособность клеток может варьироваться от оттепели в оттепель и, в целом, > 65% жизнеспособность предсказывает хорошее покрытие эффективности.
  8. Разбавить сосредоточены суспензию клеток с кардиогенным СМИ с 2 мкм Ро/рок путь ингибитора для получения нужной ячейки концентрации для обшивки (см. таблицу 2 плиты различных форматов).
    Примечание: Важно: Обратите внимание, что эффективность сердечных дифференциация может отказаться, если клетки являются семенами слишком редко.
  9. Клетки семян на плите.
  10. Держите пластины в культуре ткани капот за 20 мин до передачи его в инкубатор культуры ткани.
  11. На 6 день дифференциации контролировать ячейки вложение.
    Примечание: Сердечная прародителями являются замораживают на 5 день дифференциации. 24 ч после отогрева клетки будет на 6 день дифференциации.
    Примечание: Наличие плавающего (мертвый) клеток является общим.
  12. На 7 день аспирационная 50% средств массовой информации и заменить с равным количеством свежих кардиогенным средств массовой информации.
    Примечание: Добавлением ингибитора Ро/рок-путь к кардиогенным СМИ нет необходимости после этой точки.
  13. Замените 50% средств массовой информации с кардиогенным средств массовой информации каждый день.
  14. Обратите внимание, что спонтанное избиение, которая появляется между 11 и 13 день.
  15. На 15 день, количественную оценку эффективности сердечной дифференциации, иммунофлюоресценции с использованием DAPI (ядро пятно) и ACTC1 (pan сердечная маркер).

7. Передача и поддержание кардиомиоцитов желудочков как

Примечание: День 14 – 16, однослойная спонтанно Договаривающихся кардиомиоцитов желудочков как должно быть получено. На данный момент предлагается отделить и повторно пластины кардиомиоцитов для гомогенизации культуры и предотвращения клетки отсоединение от пластины.

  1. Аспирационная всех средств массовой информации из скважин и быстро добавить 1 мл подогретым (37 ° C) 1 x фермента содержащих диссоциации реагента.
    Примечание: 1 x фермента содержащих диссоциации реагент томов зависят формат пластины, но должен полностью охватывать в нижней части поверхности хорошо.
  2. Перевести пластины в инкубатор культуры ткани.
  3. Осторожно встряхните пластины бокового каждые 2 мин внутри инкубатор для ускорения процесса отряд.
  4. После 5-15 мин когда 80% до 100% клеток отсоединяются от нижней части пластины, удалить пластину из инкубатора и подавляют 1 x фермента содержащих активность реагента диссоциации, добавляя равным объемом 10% FBS СМИ.
    Примечание: Время инкубации с 1 x фермента содержащих диссоциации этого процесса будет меняться от партии к партии.
  5. Соберите суспензию клеток для пластиковых пробирок.
  6. Перемешать суспензию клеток с пипетки и количество клеток, используя счетчик автоматизированных клеток.
  7. Разбавления суспензии клеток для нужной ячейки концентрации (см. таблицу 2 плиты различных форматов) с обслуживания средствами массовой информации дополнена ингибитор путь Ро/рок-2 мкм.
  8. После посева кардиомиоцитов на пластину, равномерно распределить клетки и позволяют клеткам прикрепить на 10 – 20 мин до перевода пластины в инкубатор культуры ткани.
  9. 24 ч после повторного покрытия, контролировать привязанность клеток и восстановления.
    Примечание: Наличие плавающего (мертвый) клеток является общим. 48-72 ч после повторного покрытия, cardiomyocyte следует возобновить спонтанного сокращения.
  10. Для поддержания культуры cardiomyocyte, замените 50% средств массовой информации содержание средств массовой информации каждый день до использования кардиомиоцитов желудочков как для последующих экспериментов.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Поколение hPSCs Id1 линии
hPSCs, инфицированных человека посреднической Id1 гиперэкспрессия (рис. 1А). После того, как создаются hPSCId1 , выражение трансген количественно qRT-ПЦР (рис. 1Б). Только hPSCId1 линии выражая Id1 мРНК на уровнях более 0,005 лоно, GAPDH следует использовать для дифференциации.

hPSCs Id1 Техническое обслуживание и подготовка для D ifferentiation
Условия оптимального культуры являются необходимыми и критических для успешного первого сердца сердца поле как прародитель дифференциации (рисA). hPSCId1 культур должно контролироваться ежедневно стволовых морфология поддержания и непрерывного распространения. Дифференциация должны инициироваться, когда плотно упакованных стволовых клеток колонии достигают > 90% confluency (рис. 2B). Если дифференциация инициируется до оптимальной confluency, гибель клеток повышается и эффективность дифференциация может снижаться (рис. 2C). Аналогичным образом заросший культур будет выполнять плохо (Рисунок 2D).

Поколение первого сердца прародителями поле как сердца (FHF-L CPs) от hPSCs Id1
День 1 (24 h пост дифференциация посвящения) клетки должны контролироваться наблюдать потери стволовых морфологии (клетки появляются льстить и темнее, чем стволовых клеток). Обратите внимание, что смерть клетки является общим в первый день дифференциации, но слияния клеток должен быть сохранен на > 75% (2 рисунокE). Если после 24 ч дифференциации, теряется 50% или более из крытой площади поверхности, клетки должны быть отброшены.

На 3 день дифференцирования клетки должны оставаться кластерного и заполнили пробелы, созданные во время первоначальных 24 h период времени (рис. 2F). Плоские клетки самостоятельно растущих показательны субоптимальные дифференциации условий.

День 4 Оптимальная дифференциация должен показать дальнейшее расширение и освещение номерного знака.

На 5 день клетки собирают и замораживают. Оптимальное дифференцирования должно привести к кластеры тесно связанных ячеек с однородной морфология вид (рис. 2G). Обратите внимание, что низкой плотности кластеры плоских клеток Марк субоптимальные дифференциация результатов. Приведена в таблице 2 средняя урожайность дня культуры 5 сердца прародителями за хорошо в различных форматах.

Поколение кардиомиоцитов желудочков как от FHF-L CPs
День 5 FHF-L CPs талой на пластины формат зависит от плотности описаны в таблице 2, чтобы максимизировать их сердца дифференциации потенциальных (рис. 3A и Таблица 2). Жизнеспособность после оттаивания необходимо контролировать. Как правило жизнеспособность колеблется от 70-80%. Если жизнеспособность ниже 60%, выход кардиомиоцитов будут затронуты.

День 6 (24 ч после возобновления дифференциации), должна охватывать CPs FHF-L > 90% имеющихся площадь поверхности и появляются как однородных один слой клеток (рис. 3B). Низкая слияния на 6 день снизит FHF-L CPs дифференцировку в кардиомиоцитов.

Результате кардиомиоцитов начинают бить, день 11 – 13 дифференциации (рис. 3C и 1 кино). Во время процесса replating день 14 – 16 см. таблицу 2 средняя урожайность кардиомиоцитов за хорошо в различных форматах культуры. Дифференциация эффективность оценивается обычно иммунофлюоресценции для сердца (ACTC1), фибробластов (TAGLN) и сосудистого эндотелия маркеры (CDH5) и ядерных маркеров (DAPI). Родословная количественной оценки осуществляется с помощью автоматизированной обработки изображений и флуоресценции количественной оценки, как Каннингем et al. (2017) 5 (рис. 3D-E). Подтип характеристика результате кардиомиоцитов осуществляется qRT ПЦР (рис. 3F) и потенциал действия при анализе переходных процессов с помощью кинетических изображений и зонды (рис. 3G и фильм 2) напряжения. Количественная оценка флуоресценции для напряжения зонда и результирующая анализ трассировки потенциал действия (Рисунок 3H) выполняется, как описано в McKeithan et al. (2017) 7.

Figure 1
Рисунок 1: поколение hPSCId1 линий. (A) схематическое представление hPSCsId1 поколение протокол. (B) примеры qRT ПЦР результаты показаны представитель уровни Id1 mRNA, порожденных лентивирусные опосредованной выражение от различных линий hPSCId1 , включая одну линию Госкомсанэпиднадзором и две линии hPSC линий. Пунктирная линия представляет Id1 выражение порог, ниже которого hPSCId1 линии необходимо пройти дополнительный цикл инфекции Id1-человека. «p» указывает номер прохода. Число в скобках указывает количество раундов Id1-лентивирусные инфекции. Планки погрешностей представляют собой стандартное отклонение эксперименты, проведенные в трех экземплярах. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: Поколение из первого сердца Field-Like сердца прародителями (FHF-L CPs) дифференциации от hPSCId1. (A) схематическое представление протокола поколения CP FHF-Л. Представитель светлые области фотографии hPSCId1 (день 0) на оптимальное (B), суб притока (Желтые стрелки показывают недействительным регионах между ячейками) (C) и чрезмерного притока плотности (D) . Представитель светлые области фотографии дифференциации hPSCId1 в день 1, 3 и 5 соответственно (E), (F), (G). Шкалы бар = 100 µm. пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: поколения желудочков как Cardiomyocyte от FHF-L CPs. (A) Схематическое представление cardiomyocyte желудочков как поколение протокола. (B) светлые области изображения день 6 дифференцировки клеток (один день после оттаивания). (C) светлые области изображения 12 день избиения культуры. (D) представитель иммунофлюоресценции образ день 15 культур (формат 384-ну пластины). ACTC1 помечает кардиомиоцитов, TAGLN: фибробластов/гладких мышц, CDH5: сосудистая эндотелиальных клеток и DAPI: ядра (см. вставку). (E) Lineage количественная оценка день 15 культур. (F) qRT ПЦР данных время выражение курс из 5 день день 25 желудочков специфических маркеров (IRX4 и MYL2) и Пан сердечная маркер (MYL7). (G) представитель потенциал действия след от кардиомиоцитов желудочков как на день 25 дифференциации. (H) потенциал действия продолжительность измерения (APD50 и90APD) результирующий кардиомиоцитов желудочков как (n = 12). Планки погрешностей представляют собой стандартное отклонение эксперименты, проведенные в составленном (если не указано иное). Масштаб баров = 100 µm. РФС, блок относительной флуоресценции. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Средний Базовый Средний Добавка
Стволовых клеток СМИ mTesR1 н/д
Индукции СМИ RPMI 1640 среднего B-27 Serum-Free дополнения без инсулина, 1 x
Индукции СМИ RPMI 1640 среднего Puromycin, 6 мкг/мл
Индукции СМИ RPMI 1640 среднего Пенициллин стрептомицином, 1 x
Кардиогенным СМИ RPMI 1640 среднего B-27 сыворотка бесплатные дополнения, 1 x
Кардиогенным СМИ RPMI 1640 среднего Пенициллин стрептомицином, 1 x
Обслуживание средств массовой информации RPMI 1640 среднего B-27 сыворотка бесплатные дополнения, 1 x
Обслуживание средств массовой информации RPMI 1640 среднего Нокаут сыворотки замена, 2%
Обслуживание средств массовой информации RPMI 1640 среднего Пенициллин стрептомицином, 1 x

Таблица 1: Компоненты средств массовой информации (см. таблицу материалов для базового средства массовой информации и добавок).

384 хорошо хорошо 96 12 хорошо 6 хорошо 100 мм 150 мм
Объем покрытия (в а) 10 МКЛ 50 МКЛ 500 МКЛ 1 мл 5 мл 10 мл
Средний объем
(за хорошо)
100 МКЛ 300 МКЛ 2 мл 5 мл 12 мл 30 мл
Дифференциация день 0 activin концентрации (нг/мл) 100 100 100 300
Сердца прародителя
5 день доходность
(клетки/хорошо)
1.0-1.2 x 105 2,5-3,0 x 105 1,0-1,5 x 107 2.0-3.0 x 107
Сердца прародитель день 5 replating или размораживание плотность (клетки/хорошо) 2,0 x 104 7.5 x 105 4.5 x 106 8,0 х 106 2.2 x 107
Желудочков как cardiomyocyte
день 14 – 16 доходность
(клетки/хорошо)
2,0-5,0 x 104 0,8 – 1,2 х 106 3,5-5,0 x 106 0,8 – 1,2 х 107 1,8 – 2,5 x 107
Желудочков как cardiomyocyte replating плотность
(клетки/хорошо)
2,5 х 104 1,0 x 106 4.5 x 106 1,0 x 107 2.2 x 107

Таблица 2: Масштабируемая дифференциация параметры (объем покрытия, средний объем, концентрация Activin A, урожайности, replating плотности).

Имя Джин Генный банк присоединение Последовательность
GAPDH NM_001256799 F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
мышь Id1 NM_010495 F: CCTAGCTGTTCGCTGAAGGC
R: CTCCGACAGACCAAGTACCAC
IRX4 NM_016358 F: GGCTCCCCAGTTCTTGATGG
R: TAGACCGGGCAGTAGACCG
MYL2 NM_000432 F: TTGGGCGAGTGAACGTGAAAA
R: CCGAACGTAATCAGCCTTCAG
MYL7 NM_021223 F: GCCCAACGTGGTTCTTCCAA
R: CTCCTCCTCTGGGACACTC

Таблица 3: qRT-PCR праймер последовательности.

Movie 1
Фильм 1: яркие поля записи (100 кадров/сек) по 15 день кардиомиоцитов, где можно наблюдать спонтанное схватки. Пожалуйста нажмите здесь, чтобы посмотреть это видео. (Правой кнопкой мыши для загрузки.)

Movie 2
Фильм 2: Кинетическая изображений (100 кадров/сек) напряжения чувствительных флуоресцентного зонда в день 25 id1-индуцированной кардиомиоцитов желудочков как. Пожалуйста нажмите здесь, чтобы посмотреть это видео. (Правой кнопкой мыши для загрузки.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Для успешной дифференциации убедитесь, что внимательно следуйте инструкциям, перечисленным выше. Кроме того здесь мы выделить ключевые параметры, которые сильно влияют на дифференциации результатов. Перед началом дифференциация, должны соблюдаться следующие три морфологические параметры: морфология стволовых hPSCsId1, высокая сотовые уплотнения и сочетанием высокой (> 90%) культуры в день 0. В этой связи Оптимальная дифференциация условия лучше всего создаются hPSCsId1 в отрыве покрытия как отдельные клетки и позволяя им сформировать плотно кластеризованный монослои, которые растут в слиянии ~ 90% в течение 2-3 дней. И наоборот если hPSCId1 культур показывают плохое клеток и колонии морфологии, низкой колонии уплотнения и наличие больших площадей дифференциации в рамках культуры, успешной дифференциации FHF-L CP маловероятно.

Объем средств массовой информации и Activin A концентрации являются критическими параметрами FHF-L CP дифференциации и пластины формат зависимые (см. таблицу 2). Также, обратите внимание, что оптимальной концентрации Activin A может варьироваться в зависимости от используемых hPSC линии и может потребоваться оптимизация концентрации.

Уровни mRNA id1 в hPSCs крайне эффективно содействовать FHF-L CP. субоптимальные Id1 уровни удастся производить надежные FHF-L CP дифференциации и массивные клеточной гибели день 1 дифференциации будет соблюдаться. Относительное выражение отношение Id1- к -GAPDH должна превышать 0,005 для содействия эффективной дифференциации. Продолжение выделения с помощью более высоких доз puromycin (6 – 10 мкг/мл) рекомендуется для того, чтобы сохранить высокий уровень экспрессии, лентивирусные опосредованной Id1. Оценку уровня мРНК Id1 рекомендуется каждые 10 ходов.

Обшивка плотности 5 день FHF-L CPsis также критических параметров эффективности сердечной дифференциации. Если день 5 FHF-L CPs покрытием на низкой плотности, относительной сердечной доходность будет уменьшаться. Оптимальное покрытие плотности, перечислены в таблице 2 и являются плиты формат зависимых.

Основным ограничением для этого протокола является использование лентивирусные опосредованной Id1 гиперэкспрессия дифференциации CP promoteFHF Л, который может ограничить терапевтического использования результате прародителями и кардиомиоцитов желудочков как. Кроме того поскольку lentiviruses может интегрировать на местах что может потенциально влияет на hPSC обслуживания и/или потенциал развития, stemness hPSCsId1 колоний должны контролироваться путем оценки стволовых экспрессии генов и наблюдения морфологические признаки дифференциация. Обратите внимание, что экспрессирующих Id1 с использованием не интегративный векторов бы преодолеть это ограничение и в настоящее время изучается в нашей лаборатории.

Удобной особенностью этого метода является простота дифференциация протокола как он требует только одного цитокина, Activin A, чтобы генерировать CPs FHF-L от hPSCsId1. Для сравнения, другие протоколы 9,10,11,12,13,,1415 требуют сложных последовательностей комбинаций цитокинов и/или малые молекулы для поощрения и поддержания сердца дифференциации. Кроме того этот протокол однозначно описывает удобный криоконсервирования шаг, который позволяет расцепить FHF-L CP поколения от последующих cardiomyocyte производства. Эта функция позволяет биобанке крупные партии FHF-L CPs и быстро генерировать кардиомиоцитов из замороженных прародителями, как сердечная дифференциация возобновляется с 5-й день после оттаивания. Эта стратегия позволяет получить 1 до 2 недель времени по сравнению с начиная сердца дифференциации от hPSCs. Кроме того и, самое главное этот протокол является первый протокол к настоящему времени для создания сердца прародителями определенных сердце поле происхождения, в то время как другие протоколы9,10,11,12 ,13,,1415 остаются неопределенными в этом отношении.

Таким образом, этот протокол определяет надежный и масштабируемый метод для производства больших количеств (> 108– 109) вследствие порока развития соответствующих FHF-L CPs и кардиомиоцитов желудочков как. В свою очередь, результате клетки может использоваться для идентификации Роман нормативные пути контроля сердечной дифференциации и физиологии и для регенерации и болезни целей моделирования.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Мы благодарим членов кола лаборатории для полезные обсуждения и критические обзоры рукописи. Это исследование было поддержано NIH/NIEHS R44ES023521-02 и CIRM диск2-10110 предоставляет доктора кола.

Materials

Name Company Catalog Number Comments
ACTC1 antibody Sigma A7811
Activin A Stem Cell Technologies Hu Recom Activin A
Antibiotic Antimycotic (Anti-Anti) Thermo Fisher Scientific 15240062
B27 supplement Thermo Fisher Scientific 17504044
B27 supplement w/o - insulin Thermo Fisher Scientific A1895601
B27 supplement w/o - vitamin A Thermo Fisher Scientific 12587001
CDH5 antibody R&D Systems AF938
CryoStor CS10 Stem Cell Technologies 7930 Cryopreservation reagent
DMEM high Glucose Mediatech 10-013-CV 
DPBS w/ Ca & Mg Corning 21-030-CV
EDTA Thermo Fisher Scientific 15575-038
FBS VWR 89510-186
FluoVolt membrane potential kit   Thermo Fisher Scientific F10488 For optical action potential acquisition, please refer to McKeithan et al. 2017
KnockOut Serum Replacement Gibco 10828010
Matrigel, Growth Factor Reduced Corning 356231 Coating reagent
mTeSR1 media kit Stem Cell Technologies 5850
PBS w/o Ca & Mg Corning 21-040-CV
Penicillin-Streptomycin Gibco
Puromycin  Acros 227422500
ReLeSR Stem Cell Technologies 5872 Enzyme-free dissociation reagent
RPMI 1640 Thermo Fisher Scientific 11875-093
TAGLN antibody Abcam ab14106
Thiazovivin Stem Cell Technologies 72254 RHO/ROCK pathway inhibitor
TrypLE Express Thermo Fisher Scientific 12605 -010 1X enzyme-containing dissociation reagent
Tyrodes solution mix packets   Sigma T2145-10X1L (For optical action potential acquisition, please refer to McKeithan et al. 2017)

DOWNLOAD MATERIALS LIST

References

  1. Chong, J. J., et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature. 510, 273-277 (2014).
  2. Kodo, K., et al. iPSC-derived cardiomyocytes reveal abnormal TGF-beta signalling in left ventricular non-compaction cardiomyopathy. Nature cell biology. 18, 1031-1042 (2016).
  3. Kim, C., et al. Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs. Nature. 494, 105-110 (2013).
  4. Colas, A. R., et al. Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis. Genes & development. 26, 2567-2579 (2012).
  5. Cunningham, T. J., et al. Id genes are essential for early heart formation. Genes & development. (2017).
  6. McKeithan, W. L., Colas, A. R., Bushway, P. J., Ray, S., Mercola, M. Serum-free generation of multipotent mesoderm (Kdr+) progenitor cells in mouse embryonic stem cells for functional genomics screening. Current protocols in stem cell biology. Chapter 1, Unit 1F 13 (2012).
  7. McKeithan, W. L., et al. An automated platform for assessment of congenital and drug-induced arrhythmia with hipsc-derived cardiomyocytes. Frontiers in physiology. 8, 766 (2017).
  8. Sharma, A., et al. High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells. Science translational medicine. 9, (2017).
  9. Burridge, P. W., et al. Chemically defined generation of human cardiomyocytes. Nature methods. 11, 855-860 (2014).
  10. Kattman, S. J., et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell. 8, 228-240 (2011).
  11. Laflamme, M. A., et al. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nature biotechnology. 25, 1015-1024 (2007).
  12. Lian, X., et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America. 109, 1848-1857 (2012).
  13. Willems, E., et al. Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells. Cell stem cell. 11, 242-252 (2012).
  14. Yang, L., et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature. 453, 524-528 (2008).
  15. Palpant, N. J., et al. Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nature protocols. 12, 15-31 (2017).
  16. DeLaughter, D. M., et al. Single-cell resolution of temporal gene expression during heart development. Developmental cell. 39, 480-490 (2016).
  17. Liu, X., et al. The complex genetics of hypoplastic left heart syndrome. Nature genetics. 49, 1152-1159 (2017).
  18. Corrado, D., Link, M. S., Calkins, H. Arrhythmogenic right ventricular cardiomyopathy. New England journal of medicine. 376, 1489-1490 (2017).
  19. Kitamura, T., et al. Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Experimental hematology. 31, 1007-1014 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics