הדור של אבות לב שדה דמויי הלב הראשון, דמוי-חדרית Cardiomyocytes מתאי גזע Pluripotent אנושי

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

כאן נתאר שיטת מדרגיים, באמצעות שילוב פשוט של Activin A ו- Id1 בתיווך lentivirus-ביטוי, כדי ליצור אבות לב שדה דמויי הלב הראשון וחדרית דמוי cardiomyocytes מתאי גזע pluripotent אנושי.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Yu, M. S., Spiering, S., Colas, A. R. Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells. J. Vis. Exp. (136), e57688, doi:10.3791/57688 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

הדור של כמויות גדולות של pluripotent האנושי פונקציונלי תאי גזע-derived לב אבות, cardiomyocytes הלב מוגדרים שדה המקור הוא מהווה דרישה מוקדמת עבור טיפולים לב מבוססת תא ומודלים המחלה. אנחנו לאחרונה הראו כי מזהה גנים הדרושים והן מספיקות לציין אבות הראשון של שדה לב במהלך הפיתוח חוליות. פרוטוקול בידול זה ממנף את הממצאים הללו ומשתמש Id1 ביטוי בשילוב עם Activin כמו רמזים ציון חזק כדי לייצר הראשון הלב כמו שדה (FHF-L) אבות. חשוב, וכתוצאה מכך אבות להבדיל ביעילות (~ 70-90%) לתוך cardiomyocytes דמוי חדרית. כאן אנו מתארים שיטה מפורטת ליצירה 1) hPSCs Id1 overexpressing 2) להבדיל כמויות מדרגי של אבות FHF-L cryopreservable חדרית דמוי cardiomyocytes.

Introduction

ייצור בקנה מידה גדול של תאי גזע pluripotent אנושי (hPSCs)-נגזר לב אבות, cardiomyocytes זה מהווה דרישה מוקדמת עבור טיפולים מבוססי תאי גזע1, מחלת מידול2,3 ואפיון מהירה הרומן משעולים ויסות בידול לב4,5,6 , פיזיולוגיה7,8. למרות מספר מחקרים9,10,11,12,13,14,15 יש שתואר קודם לכן יעיל ביותר פרוטוקולים בידול לב hPSCs, אף אחד לא שלח המקור תחום הלב של cardiomyocytes וכתוצאה מכך, למרות הזיהוי של הבדלים משמעותיים מולקולרי בין שמאל (שדה הלב הראשון) ימינה (שדה הלב השני) cardiomyocytes חדרית16 וקיומו של הלב ספציפיים לשדה מחלות לב מולדים; קרי, שמאלי תסמונת17 או arrhythmogenic דיספלזיה חדרית18. לפיכך, הדור של לב אבות, cardiomyocytes ממוצא שדה מוגדר הלב של hPSCs הופך להיות הכרח כדי להגביר את הרלוונטיות שלהם כמו טיפולית ומחלות כלי מידול.

פרוטוקול זה מסתמך על ביטוי המכונן של Id1, שזוהה לאחרונה5 הראשון לב ציון שדה רמז אשר בשילוב עם Activin A, הן חיוני ומספיק ליזום cardiogenesis ב hPSCs. ראוי לציין, קנינגהם. et al. (2017) 5 מראים כי אבות Id1-induced במיוחד להביע בשדה הלב הראשון (HCN4, TBX5) אבל לא שני סמנים לב שדה (SIX2, ISL1) כפי הם עוברים התמיינות הלב. בנוסף, המחברים גם מראים כי עוברי העכבר הטרנסגניים חסר לכל המשפחה מזהה של גנים (Id1-4), לפתח ללא ויוצרים הראשון הלב שדה לב אבות, בזמן (אבות לב המדיאלי, אחורי נוסף לב השדה השני) יכולים ליצור עדיין, ובכך רומז כי מזהה חלבונים חיוניים ליזום הראשון הלב שדה cardiogenesis ויוו. בנוחות, אבות הנוצרות על-ידי Id1 יכול להיות cryopreserved, להבדיל באופן ספונטני לתוך cardiomyocytes הצגת מאפיינים כמו חדרית, כולל ביטוי סמנים ייחודיים חדרית (IRX4, MYL2), פוטנציאל פעולה כמו חדרית.

כאן אנו מתארים שיטה פשוטה, וניתן להרחבה כדי ליצור הראשון הלב כמו שדה (FHF-L) אבות לב וחדרית דמוי cardiomyocytes מתוך Id1 overexpressing hPSCs. תכונה חשובה של פרוטוקול זה הוא האפשרות לנתק לב דור מייצור cardiomyocyte הבאים באמצעות צעד הקפאה קריוגנית נוח. לסיכום, פרוטוקול זה מפרט את הצעדים הדרושים (1) ליצור hPSCs Id1 overexpressing (2) ליצור את אבות לב FHF-L מ- hPSCs, (3) cryopreserve אבות וכתוצאה מכך, (4) לחדש את הבידול לב FHF-L וצור מאוד מועשר (> 70-90%) להכות cardiomyocytes דמוי חדרית.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Id1 וירוס והכנה זיהום

  1. צור Id1 lentivirus overexpressing על ידי שיתוף transfecting pCMVDR8.74, pMD2.G, pCDH-EF1-Id1-PGK-PuroR (Addgene: פלסמיד #107735) לתוך התאים HEK293T. לאסוף חלקיקי נגיפי, filtrate, לטהר מ תגובת שיקוע, ולאחסן ב-80 מעלות צלזיוס כמו קיטאמורה. et al. (2003) 19. לחלופין, לייצר מסחרית Id1 lentivirus על-ידי שליחת pCDH-EF1-Id1-PGK-PuroR ליצרן לייצר lentivirus.
    התראה: אנא עקוב אחר תקנות הבטיחות lentiviral ופרוטוקולים סטנדרטיים מבצע.
    הערה: חשוב: כייל נוגדנים אופטימלית וירוס צריך להיות לפחות 108 עד 109 Transducing יחידות/mL (טו/mL).
  2. לפני ההדבקה, מעיל אחד טוב של צלחת טוב 96 עם 50 µl של ציפוי ריאגנט, בדרך כלל תערובת חלבונים כמו ג'לי, מופרש על ידי Engelbreth-הולם-נחיל העכבר סרקומה תאים (ראה טבלה של חומרים).
  3. מביצועם טוב אחד של גזע pluripotent גדל לתוך צלחת טוב 6 על-ידי הוספת 1 מ"ל של PBS ללא Ca2 + ו- Mg2 + ועם 0.5 מ מ EDTA.
    הערה: זמן דיסוציאציה נע בין 3 – 10 דקות. כאשר יותר מ- 80% של התאים הם צמודי קרקע מהחלק התחתון של הלוח, המשך לשלב הבא.
  4. לאסוף תא הבולם עם pipet סטרילי לתוך צינור פלסטיק צנטריפוגה 15 מ"ל.
  5. לנטרל דיסוציאציה מגיב עם 5 מ של Ca המכילות PBS2 + ו- Mg2 +.
  6. צניפה תאים על ידי צנטריפוגה (200 גרם x במשך 3 דקות).
  7. להסיר את תגובת שיקוע וחבוט בעדינות את הצינור כדי לסלק את גלולה.
  8. להשעות מחדש תאים 1 מ"ל של תאי גזע מדיה.
  9. לספור תאים באמצעות מונה הניתן תא אוטומטית בעקבות הוראות הספק.
  10. צלחת 20,000 התאים קיימא לכל מצופה היטב (96-ובכן צלחת) 50 µL של תאי גזע מדיה בתוספת 2 מיקרומטר RHO/רוק מסלול מעכב (ראה טבלאות 1 ו- 2).
  11. לאחר 24 שעות, לפקח על התא מצורף ולהחליף מדיה עם 100 מדיה תאי גזע µl, בתוספת 2 מיקרומטר RHO/רוק מסלול מעכב ו 6 ng/mL hexadimethrine ברומיד (ראה טבלאות 1 ו -2), h אחד לפני זיהום lentiviral.
    הערה: תאים צריך להיות מחובר היטב לתחתית של הצלחת.
  12. הפשרת Id1-lentivirus על הקרח.
  13. להוסיף 3 µL של lentivirus מטוהרים לכל טוב (וירוס כייל צריך להיות בין 108 עד 109 טו/mL), ולאחר מכן להעביר את הצלחת לחזור חממה התרבות התא (37 מעלות צלזיוס, 5% CO2, 20% O2).
  14. זיהום פוסט-ויראלי 24 שעות ביממה, להוסיף 100 µL של תאי גזע טריים מדיה לתאים נגועים.
  15. זיהום שלאחר lentiviral 48 שעות, החלף וירוס המכיל מדיה עם 200 µL של תאי גזע טריים מדיה בתוספת 1 puromycin µg/mL.
  16. רענן מדיה מדי יום עם 200 µL של תאי גזע מדיה בתוספת 1 puromycin µg/mL.
  17. כאשר תרבויות מגיעים 80% confluency, מביצועם תאים באמצעות µL 200 ל- PBS ללא Ca2 + ו Mg2 + + 0.5 מ מ EDTA (עבור טוב אחד של צלחת 96-ובכן).
  18. איסוף תאים ההשעיה לתוך שפופרת צנטרפוגה.
  19. לנטרל דיסוציאציה מגיב עם 5 מ של Ca המכילות PBS2 + ו- Mg2 +.
  20. צניפה תאים על ידי צנטריפוגה (200 גרם x במשך 3 דקות).
  21. להסיר את תגובת שיקוע וחבוט בעדינות את הצינור כדי לסלק את גלולה.
  22. להשעות מחדש תאים 1 מ"ל של תאי גזע מדיה בתוספת 2 מיקרומטר RHO/רוק מסלול מעכב.
  23. העברת כל התאים (1 מ"ל) מצופה היטב של צלחת 12-. טוב.
  24. לאחר 24 שעות, צג עבור התא מצורף לתקשורת. ובכן והחלף עם 1 מ"ל של תאי גזע מדיה בתוספת 2 מיקרומטר RHO/רוק מסלול מעכב ו 6 ng/mL hexadimethrine ברומיד, h אחד לפני התמרה חושית.
  25. הפשרת Id1-lentivirus על הקרח.
  26. להוסיף 5 µL של וירוס מטוהרים לכל טוב (12-ובכן צלחת).
  27. זיהום פוסט-lentiviral 24 שעות ביממה, החלף וירוס המכיל מדיה עם 1 מ"ל של תאי גזע טריים מדיה בתוספת 3 puromycin µg/mL.
  28. 48 שעות פוסט זיהום lentiviral, החלף וירוס המכיל מדיה עם 1 מ"ל של תאי גזע טריים מדיה בתוספת 6 puromycin µg/mL.
  29. כאשר תרבויות מגיעים 80% confluency, מביצועם תאים באמצעות µL 500 ל- PBS ללא Ca2 + ו- Mg2 + ועם 0.5 מ מ EDTA (עבור טוב אחד של צלחת 12-טוב).
  30. העברת מחצית (250 µL) של התליה תא ל אחד טוב של ריאגנט ציפוי מצופה צלחת 6-ובכן המכיל 2 מ"ל של תאי גזע מדיה בתוספת 2 מיקרומטר RHO/רוק מסלול מעכב.
  31. השתמש בחצי השני (250 µL) של המדגם עבור החילוץ-RNA ולרביעיית-PCR על מנת לקבוע lentiviral בתיווך Id1 רמות הביטוי, כמו קולה. et al. (2012) 4.
    הערה: חשוב: אם Id1 mRNA ביטוי רמות נמוכות מ- 0.005 קיפול של רמות הביטוי GAPDH (ראו טבלה 3 צבעי יסוד לרביעיית-PCR), חזור זיהום התהליך כמתואר לעיל עד רמות הביטוי Id1 יעלה הסף.

2. hPSCsId1 תחזוקה

  1. תרבות hPSCsId1 ב 6 מצופה היטב-פלטות ולגדול ב- 3 מ לכל טוב של תאי גזע מדיה בתוספת 6 puromycin µg/mL.
  2. כאשר hPSCsId1 מגיעים 80% confluency, מעבר תאים כמו אגרגטים (פיצול-יחס של 1:6) באמצעות ריאגנט דיסוציאציה ללא אנזים בעקבות הנחיות הספק ולגדול ב- 3 מ לכל טוב של תאי גזע מדיה בתוספת 6 puromycin µg/mL.

3. הכנה של hPSCsId1 בידול

  1. מעיל צלחת 12-טוב עם µL 500 לכל טוב של ריאגנט ציפוי.
  2. כאשר hPSCsId1 להגיע 90% confluency מביצועם תאים על-ידי הוספת 1 מ"ל של PBS ללא Ca2 + ו- Mg2 + ועם 0.5 מ מ EDTA לכל טוב עבור 5 – 10 דקות לבדוק דיסוציאציה תהליך כל דקה, פעם 80% של התאים הם לזהויות את הצלחת , המשך לשלב הבא.
  3. איסוף תאים ההשעיה לתוך שפופרת צנטרפוגה.
  4. לנטרל דיסוציאציה מגיב עם 5 מ של Ca המכילות PBS2 + ו- Mg2 +.
  5. צניפה תאים על ידי צנטריפוגה (200 גרם x במשך 3 דקות).
  6. להסיר את תגובת שיקוע וחבוט בעדינות את הצינור כדי לסלק את גלולה.
  7. להשעות מחדש תאים 2 מ"ל של תאי גזע מדיה בתוספת 2 מיקרומטר RHO/רוק מסלול מעכב.
  8. ספירת תאים באמצעות מונה הניתן תא אוטומטית.
  9. צלחת 300,000 תאים לכל באר 1 מ"ל של תאי גזע מדיה בתוספת 2 מיקרומטר RHO/רוק מסלול מעכב 6 puromycin µg/mL, ואת הצלחת העברת לתוך החממה תרביות רקמה.
  10. רענן מדיה מדי יום עם 2 מ"ל של תאי גזע מדיה בתוספת 6 µg/mL puromycin עד תרבויות מגיעים 90% confluency. בשלב זה, ליזום בידול הלב (השלב הבא).

4. הבידול של hPSCsId1 לתוך הלב הראשון שדה דמוי לב אבות (CPs FHF-L)

  1. עבור תבנית לוח 12-ובכן, בידול אתחול (יום 0) על-ידי החלפת מדיה תא גזע 1.5 מ של אינדוקציה מדיה (טבלה 1) בתוספת Activin של (100 ננוגרם למ"ל) (ראה בטבלה 2 עבור מומלץ Activin A ואמצעי ריכוזים עבור צלחת שונה תבניות).
  2. יום 1 (24 שעות לאחר בידול מאותחלת), להחליף מדיה 2 מ"ל של אינדוקציה מדיה ללא Activin A (לכל טוב של צלחת 12-טוב).
  3. יום 3, החלף מדיה 2 מ"ל של אינדוקציה מדיה ללא Activin A (לכל טוב של צלחת 12-טוב).
  4. יום 5, לאסוף CPs FHF-L עבור הקפאה קריוגנית (השלב הבא).
    הערה: חשוב: הקפאה קריוגנית הוא מועדף בנקודה זו, כפי שהיא מאפשרת לנתק לב דור מ- cardiomyocyte הבאים ייצור, biobank קבוצות גדולות של תאים. הערה כך לחלופין, יום 5 FHF-L CPs ניתן להעביר את צלחת טרי מצופה להמשיך בידול, עיין צעדים 5.1 – 5.5 לשל passFHF-L, לאחר מכן המשך שלב 6.5 עבור בידול.

5. הקפאה קריוגנית של CPs FHF-L

  1. תשאף כל המדיה מבארות המכיל יום 5 CPs FHF-L במהירות להוסיף 1 מ"ל חמים (37 מעלות צלזיוס) 1 x המכיל אנזים ריאגנט דיסוציאציה (ראה טבלה של חומרים). מניחים צלחת בחממה תרביות רקמה.
  2. לאחר 1 דקות, לנער צלחת לצד בחממה.
  3. לאחר 2 דקות (סה כ זמן), הסר את לוחית מן החממה ולהוסיף 1 מ"ל של 10% FBS מדיה.
  4. בעדינות pipet תאים למעלה ולמטה עם pipet מ ל כדי להקל על ניתוק התא לצלחת.
  5. לאסוף ההשעיה התא לתאים צניפה ובשעות צנטריפוגה על ידי צנטריפוגה ב g x 200 למשך 3 דקות
  6. מחדש להשעות תא גלולה ב 2 מ של ריאגנט הקפאה קריוגנית.
  7. ספירת תאים באמצעות מונה הניתן תא אוטומטית.
  8. הוספת ריאגנט הקפאה קריוגנית (ראה טבלה של חומרים) בווליום מספיק כדי cryopreserve תאים על הריכוז הרצויה (בדרך כלל 5 – 10 x 106 תאים/mL).
  9. העברת תאי הקפאה קריוגנית בקבוקונים, מניחים צלוחיות קירור ההתקן (1 ° C/דקה) ומכניסים קירור למכשיר למקפיא-80 ° C בן לילה.
  10. לאחר 24 שעות, להעביר בקבוקונים קפוא חנקן נוזלי לאחסון לטווח ארוך.
    הערה: הפרוטוקול אפשר לעצור כאן.

6. FHF-L בידול CP לתוך Cardiomyocytes דמוי-חדרית

  1. להעביר יום 5 CPs FHF-L קפוא בקבוקונים אחסון בחנקן נוזלי לתוך מיכל קרח יבש.
  2. מקום בקבוקונים 37 מעלות צלזיוס המים הרותחים למשך 2-3 דקות, עד מופשר תא ההשעיה הוא לחלוטין.
    הערה: חשוב: תהליך שהביקושים רגיש בזמן. חשיפת תאים לכלי התקשורת הקפאה קריוגנית עבור כמות מוגזמת של זמן (קרי, 10 דקות) יקטן תא הכדאיות.
  3. העברת תאים 15 או 50 מ"ל צנטריפוגה שפופרת, בהתאם למספר בקבוקונים המופשרים.
  4. לוותר על dropwise (5 טיפות כל 30 שניות) מראש ומחוממת (37 מעלות צלזיוס) קרדיוגני מדיה (טבלה 1) תא פתרון. המשך בתהליך זה עד 1:3 הקפאה קריוגנית מדיה: יחס התקשורת קרדיוגני מתמלאת. בשלב זה, להגביר את קצב הוספת מדיה קרדיוגני עד 1:10 הקפאה קריוגנית מדיה: יחס התקשורת קרדיוגני מתמלאת.
    הערה: חשוב: שינויים osmolarity מהירה יגדל מות תאים במהלך תהליך שהביקושים; לפיכך, תוספת dropwise של המדיה קרדיוגני כמתואר לעיל מומלץ מאוד.
  5. צנטריפוגה תאי השעיה וגלולה התא על ידי צנטריפוגה (200 גרם x במשך 3 דקות).
  6. להסיר את תגובת שיקוע וחבוט בעדינות צנטריפוגה צינור מכך תא גלולה.
  7. להשעות מחדש תאים עם מדיה קרדיוגני בתוספת 2 מיקרומטר RHO/רוק מסלול מעכב.
    הערה: תא הכדאיות יכול להשתנות להפשיר הפשרה, באופן כללי, > 65% הכדאיות מנבאת ציפוי טוב יעילות.
  8. שתדללו מרוכז תא הבולם עם מדיה קרדיוגני בתוספת 2 מיקרומטר, רו-רוק מסלול מעכב להשגת ריכוז התא הרצוי עבור ציפוי (ראו טבלה 2 תבניות צלחת שונה).
    הערה: חשוב: שימו לב כי יעילות בידול הלב עלולה לרדת אם התאים נמצאים נזרע גם בדלילות.
  9. תאי הזרע על הצלחת.
  10. להשאיר צלחת בשכונה תרביות רקמה כעשרים דקות לפני העברת אותו חממה תרביות רקמה.
  11. ביום 6 של בידול, לפקח על התא מצורף.
    הערה: דום לב אבות הם cryopreserved ביום 5 של הבידול. 24 שעות לאחר מפשיר את התאים יהיה ביום 6 של הבידול.
    הערה: הנוכחות של תאים (מתים) צף נפוץ.
  12. יום 7, תשאף 50% של המדיה ולהחליף עם כמות שווה של מדיה קרדיוגני טריים.
    הערה: התוספת של RHO/רוק מסלול מעכב את התקשורת קרדיוגני אין צורך לאחר הנקודה הזו.
  13. להחליף 50% של המדיה מדיה קרדיוגני בכל יום אחר.
  14. הערה להכות ספונטני זה מופיע בין היום ה-11 יום 13.
  15. ביום 15, לכמת בידול לב יעילות על-ידי immunofluorescence באמצעות דאפי (גרעין כתם) ו- ACTC1 (סמן פאן-לב).

7. העברת ותחזוקה של Cardiomyocytes דמוי-חדרית

הערה: מאת ביום 14 – 16, טפט להידבקות באופן ספונטני כמו חדרית cardiomyocytes צריכה להתקבל. בשלב זה, הוא הציע מביצועם של מחדש צלחת cardiomyocytes כדי homogenize את התרבות ולמנוע תאים ניתוק מהצלחת.

  1. תשאף כל המדיה מבארות ולהוסיף במהירות 1 מ"ל של טרום ומחוממת (37 מעלות צלזיוס) 1 x המכיל אנזים ריאגנט דיסוציאציה.
    הערה: 1 x המכיל אנזים דיסוציאציה ריאגנט אחסון משתנים בהתאם לתבנית צלחת, אבל לחלוטין אמור לכסות את החלק התחתון של השטח היטב.
  2. להעביר את הצלחת לתוך חממה תרביות רקמה.
  3. בעדינות לנער צלחת לצד כל 2 דקות בתוך החממה כדי להאיץ את תהליך הניתוק.
  4. לאחר 5-15 דקות, כאשר 80% עד 100% מהתאים הם צמודי קרקע מהחלק התחתון של הלוח, הסר את הלוחית של החממה, לעכב 1 x המכיל אנזים דיסוציאציה ריאגנט פעילות על-ידי הוספת אמצעי שווים של 10% FBS מדיה.
    הערה: זמן הדגירה עם דיסוציאציה המכיל אנזים x 1 עבור תהליך זה ישתנו מן אצווה-כדי-אצווה.
  5. לאסוף תא ההשעיה שפופרת צנטרפוגה.
  6. מערבבים תא הבולם עם pipet, ספירת תאים באמצעות מונה הניתן תא אוטומטית.
  7. לדלל תא ההשעיה כדי ריכוז התא הרצוי (ראה טבלה 2 תבניות שונות צלחת) עם תחזוקה מדיה בתוספת 2 מיקרומטר RHO/רוק מסלול מעכב.
  8. לאחר זריעה cardiomyocytes לצלחת, פזר את התאים באופן שווה ולאפשר את התאים לצרף 10 – 20 דקות לפני העברת צלחת חממה תרביות רקמה.
  9. 24 שעות לאחר ציפוי מחדש, לפקח על התא מצורף ושחזור.
    הערה: הנוכחות של תאים (מתים) צף נפוץ. 48-72 שעות לאחר ציפוי מחדש, cardiomyocyte צריך לחדש את התכווצות ספונטנית.
  10. כדי לשמור על התרבות cardiomyocyte, להחליף 50% של התקשורת עם התקשורת תחזוקה כל יומיים עד השימוש חדרית דמוי cardiomyocytes לניסויים הבאים.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

דור של hPSCs Id1 קווים
hPSCs נגוע lentivirus תיווכה ביטוי Id1 (איור 1א'). ברגע hPSCId1 נוצרים, transgene ביטוי לכמת על ידי לרביעיית-PCR (איור 1B). רק hPSCId1 שורות לבטא Id1 mRNA ברמות גדול מ- 0.005 קיפול של GAPDH צריך לשמש עבור בידול.

hPSCs Id1 תחזוקה והכנה D ifferentiation
תנאים אופטימליים תרבות הם קריטיים והכרחיים קודם מוצלח לב שדה דמוי לב קדמון בידול (איור 2א). hPSCId1 תרבויות צריך לפקח מדי יום עבור גזע מורפולוגיה תחזוקה והתפשטות רציפה. צריך להיות יזם בידול כאשר מגיעים תאי גזע אציקלוביר המושבות > 90% confluency (איור 2B). אם בידול מאותחלת לפני confluency אופטימלית, מוות של תאים מוגברת, בידול יעילות עלולה לרדת (איור 2C). באופן דומה, תרבויות מגודל יבצע גרוע (איור 2D).

מהדור הראשון הלב שדה דמוי לב אבות (CPs FHF-L) מ hPSCs Id1
יום 1 (24 שעות ביממה פוסט בידול חניכה), צריך לפקח תאים להתבונן אובדן של גזע מורפולוגיה (תאים מופיעות להחמיא ושחור יותר תאי גזע). שימו לב כי מות תאים נפוץ במהלך היום הראשון של בידול, אך תא הנהרות צריכים להישמר > 75% (איור 2E). אם לאחר 24 שעות של בידול, 50% או יותר על פני השטח המקורה הוא איבד, התאים צריכים להיות מושלך.

יום 3, המבדילים התאים צריכים להישאר מקובצים, מילאו את הפערים שנוצרו במהלך ה 24 הראשונית תקופת זמן (איור 2F). תאים שטוחים גדל באופן עצמאי מעידים על בידול שיוצרת תנאים.

יום 4, בידול אופטימלית צריך להראות המשך הרחבתה וכיסוי של הצלחת.

יום 5 תאים שנקטפו, cryopreserved. Differentiations אופטימלית צריך לגרום מחוברים בחוזקה בצברים של תאים עם מראה הומוגני מורפולוגיה (איור 2G). שימו לב כי צפיפות נמוכה אשכולות של תאים שטוחים לסמן תוצאה שיוצרת בידול. לקבלת התשואה הממוצעת של היום 5 לב אבות לכל טוב שונות תרבות תבניות, ראה בטבלה 2 .

דור של דמוי חדרית Cardiomyocytes מש FHF-L
יום 5 FHF-L CPs הן הקרת-צלחת תלויי עיצוב צפיפויות המתוארות בטבלה 2, על מנת למקסם שלהם בידול לב פוטנציאלי (איור 3א ו לטבלה 2). הכדאיות לאחר מפשיר צריך להיות במעקב. באופן כללי, הכדאיות נע בין 70-80%. אם הכדאיות מתחת ל 60%, התשואה של cardiomyocytes יושפעו.

יום 6 (24 שעות לאחר חידוש בידול), אמור לכסות CPs FHF-L > 90% זמינים משטח אזור ומופיעים כשכבה אחת הומוגנית של תאים (איור 3ב). זרימה נמוכה ביום 6 תפחית FHF-L CPs בידול לתוך cardiomyocytes.

Cardiomyocytes וכתוצאה מכך מתחיל להכות על ידי ביום 11 – 13 של בידול (איור 3C וסרט 1). במהלך תהליך replating יום 14-16, ראה בטבלה 2 התשואה הממוצעת של cardiomyocytes לכל טוב בפורמטים שונים של תרבות. בידול יעילות בדרך כלל שקובעת מאת immunofluorescence הלב (ACTC1), פיברובלסט (TAGLN), סמני אנדותל כלי הדם (CDH5) וסמנים (דאפי) גרעיני. השושלת כימות מתבצעת באמצעות הדמיה אוטומטית כימות פלורסצנטיות, כמו קנינגהם. et al. (2017) 5 (איור 3D-E). סוג של אפיון cardiomyocytes וכתוצאה מכך מתבצע על ידי לרביעיית-PCR (איור 3F) וניתוח ארעי פוטנציאל הפעולה באמצעות הדמיה קינטי ומתח חישה רגשים (איור 3G ו- 2 סרט). קרינה פלואורסצנטית כימות כדי להפוך את מתח המכשיר ניתוח מעקב וכתוצאה מכך פוטנציאל הפעולה (איור 3H) מתבצע כפי שמתואר McKeithan. et al. (2017) 7.

Figure 1
איור 1: דור של hPSCId1 קווים. (א) ייצוג סכמטי של hPSCs פרוטוקול ליצירתId1 . (B) דוגמאות לרביעיית-PCR תוצאות מציג רמות Id1 mRNA נציג שנוצרו על-ידי ביטוי lentiviral בתיווך מ קווים ברורים של hPSCId1 כולל hESC שורה אחת, שתי שורות שורות hPSC. קו מקווקו מייצג Id1 ביטוי הסף, מתחת איזה hPSCId1 קווים צריך לעבור על מחזור נוסף של זיהום Id1-lentivirus. "p" מציינים את מספר מעבר. המספר בתוך הסוגריים מציין את מספר סיבובים של זיהום Id1-lentiviral. קווי שגיאה לייצג סטיית התקן של ניסויים שבוצעו דולר. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: בידול הדור של הראשון הלב Field-Like לב אבות (CPs FHF-L) מ hPSCId1. (א) ייצוג סכמטי של פרוטוקול דור CP FHF-L. שדה בהיר נציג תמונות של hPSCId1 (יום 0)-אופטימלית (B), confluent משנה (חץ צהוב מציינים את האזורים הריק בין תאים) צפיפות (ד) (ג) ו- confluent יתר. נציג תמונות בהיר-שדה להבדיל hPSCId1 ביום 1, 3 ו-5 בהתאמה (E), (F), (G). סרגל קנה מידה = 100 מיקרומטר. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: דור של Cardiomyocyte חדרית כמו מש FHF-L. (א) ייצוג סכמטי של פרוטוקול דור חדרית דמוי cardiomyocyte. תמונת שדה בהיר (B) של יום 6 התמיינות תאים (יום אחד פוסט מפשיר). (ג) תמונת שדה בהיר של תרבות הכאה יום 12. (ד) נציג immunofluorescence תמונה של תרבויות 15 יום (384-ובכן צלחת תבנית). ACTC1 מסמן cardiomyocytes, TAGLN: שריר fibroblasts/חלק, CDH5: תאי אנדותל כלי הדם, דאפי: גרעינים (שמוצג שיבוץ). (ה) כימות שושלת היוחסין של תרבויות 15 יום. נתונים לרביעיית-PCR (נ) זמן ביטוי קורס מ יום 5 ליום 25 של סמנים ייחודיים חדרית (IRX4 ו- MYL2), סמן פאן-הלב (MYL7). מעקב אחר מדמוי-חדרית cardiomyocytes ביום 25 של בידול (G) מייצג פוטנציאל הפעולה. (H) פוטנציאל הפעולה משך מדידות (APD50 ו- APD90) וכתוצאה מכך חדרית דמוי cardiomyocytes (n = 12). קווי שגיאה לייצג סטיית התקן של ניסויים הופיעה ארבע פעמים (אלא אם כן צוין אחרת). גודל ברים = 100 מיקרומטר. RFU, יחידת קרינה פלואורסצנטית היחסי. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

בינוני בסיס בינוני תוסף
תא גזע מדיה mTesR1 n/a
אינדוקציה מדיה RPMI 1640 בינוני B-27 סרום ללא תוספת ללא אינסולין, 1 x
אינדוקציה מדיה RPMI 1640 בינוני Puromycin, µg 6/ml
אינדוקציה מדיה RPMI 1640 בינוני פניצילין-סטרפטומיצין, 1 x
מדיה קרדיוגני RPMI 1640 בינוני תוספת ללא סרום B-27, 1 x
מדיה קרדיוגני RPMI 1640 בינוני פניצילין-סטרפטומיצין, 1 x
תחזוקה מדיה RPMI 1640 בינוני תוספת ללא סרום B-27, 1 x
תחזוקה מדיה RPMI 1640 בינוני החלפת סרום נוקאאוט, 2%
תחזוקה מדיה RPMI 1640 בינוני פניצילין-סטרפטומיצין, 1 x

טבלה 1: רכיבי מדיה (ראה טבלה של חומרים על בסיס מדיה ותוספים).

384 טוב 96 טוב 12 טוב 6 טוב 100 מ מ 150 מ מ
ציפוי נפח (לכל טוב) 10 ΜL 50 ΜL 500 ΜL 1 מ"ל 5 מ 10 מ
אמצעי אחסון בינונית
(לכל טוב)
100 ΜL 300 ΜL 2 מ 5 מ 12 מ 30 מ
בידול יום 0 activin ריכוז (ng/mL) 100 100 100 300
לב
יום 5 תשואה
(תאים/טוב)
1.0-1.2 x 105 2.5 – 3.0 x 105 1.0-1.5 x 107 2.0 – 3.0 x 107
לב יום 5 replating או מפשיר צפיפות (תאים/טוב) 2.0 x 104 7.5 x 105 4.5 x 106 8.0 x 106 2.2 x 107
חדרים כמו cardiomyocyte
יום 14 – 16 תשואה
(תאים/טוב)
2.0 – 5.0 x 104 0.8-1.2 x 106 3.5 – 5.0 x 106 0.8-1.2 x 107 1.8-2.5 x 107
Cardiomyocyte חדרים כמו replating צפיפות
(תאים/טוב)
2.5 10x4 1.0 x 106 4.5 x 106 1.0 x 107 2.2 x 107

טבלה 2: בידול מדרגי פרמטרים (ציפוי נפח, נפח בינוני, ריכוז Activin A, תשואות, replating צפיפויות).

שם הגן בנק הגנים הצטרפותן רצף
GAPDH NM_001256799 F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
עכבר Id1 NM_010495 F: CCTAGCTGTTCGCTGAAGGC
R: CTCCGACAGACCAAGTACCAC
IRX4 NM_016358 F: GGCTCCCCAGTTCTTGATGG
R: TAGACCGGGCAGTAGACCG
MYL2 NM_000432 F: TTGGGCGAGTGAACGTGAAAA
R: CCGAACGTAATCAGCCTTCAG
MYL7 NM_021223 F: GCCCAACGTGGTTCTTCCAA
R: CTCCTCCTCTGGGACACTC

טבלה 3: לרביעיית-PCR פריימר רצפים.

Movie 1
סרט 1: שדה בהיר הקלטה (מסגרות לשנייה 100) של היום 15 cardiomyocytes שבו יכול להיות שנצפו צירים ספונטניים. אנא לחץ כאן כדי לצפות בסרטון. (לחיצה ימנית כדי להוריד.)

Movie 2
סרט 2: הדמיה קינטי (מסגרות לשנייה 100) של המכשיר פלורסנט רגיש מתח היום 25 cardiomyocytes חדרית דמוי הנוצרות על-ידי id1. אנא לחץ כאן כדי לצפות בסרטון. (לחיצה ימנית כדי להוריד.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Differentiations מוצלח, ודא לעקוב מקרוב אחר ההוראות המפורטות לעיל. בנוסף, כאן אנחנו מדגישים פרמטרים מרכזיים אשר משפיעים מאוד על תוצאות בידול. לפני שמתחילים הבחנה, להתייחס הפרמטרים הבאים מורפולוגי שלושה: מורפולוגיה גזע של hPSCsId1, דחיסה גבוהה הסלולר ועל זרימה גבוהה (> 90%) של התרבות ביום 0. בהקשר הזה, תנאים אופטימליים בידול נוצרים בצורה הטובה ביותר על ידי ציפוי הפומבית hPSCsId1 כמו תאים בודדים, המאפשר להם טופס בחוזקה התקבצו monolayers לגדול כדי הנהרות ~ 90% במהלך 2-3 ימים. לעומת זאת, אם hPSCId1 תרבויות להראות תא המסכן, מורפולוגיה המושבה, דחיסה נמוך המושבה ואת נוכחותם של שטחים גדולים של בידול בתוך התרבות, סביר בידול FHF-L CP מוצלחת.

אחסון מדיה Activin A ריכוזים פרמטרים קריטיים של בידול CP FHF-L, צלחת עיצוב מותנה (ראה טבלה 2) בקרב אנשי עסקים ותיירים כאחד. גם שים לב ריכוזים Activin של האופטימלית עשויים להשתנות בהתאם קו hPSC משומשים, עשויים לדרוש ריכוז אופטימיזציה.

רמות ה-mRNA Id1 hPSCs מכריעים לקדם ביעילות FHF-L CP. שיוצרת Id1 רמות ייכשל לייצר בידול FHF-L CP חזקים, מוות של תאים מסיבית על ידי יום 1 של בידול יתקיימו. היחס ביטוי היחסי של Id1- כדי -GAPDH צריך לחרוג 0.005 לקדם בידול יעיל. המשך הקטע שבחרת תוך שימוש במינונים גבוהים של puromycin (6-10 µg/mL) מומלץ על מנת לשמור על רמות גבוהות של lentiviral בתיווך ביטוי Id1. הערכה של Id1 mRNA רמות כל הקטעים 10 מומלץ.

ציפוי צפיפויות של יום 5 FHF-L CPsis גם פרמטר קריטי ליעילות בידול הלב. אם יום 5 FHF-L CPs הן מצופה ב צפיפות נמוכה, התשואה לב יחסית יקטן. צפיפויות אופטימלית ציפוי מפורטים בטבלה מס ' 2 , צלחת תלויי עיצוב.

המגבלה העיקרית עבור פרוטוקול זה הוא השימוש של ביטוי Id1 lentiviral בתיווך כדי בידול CP promoteFHF-L אשר עשוי להגביל את השימוש הטיפולי אבות וכתוצאה מכך cardiomyocytes חדרית דמוי. כמו כן, מאז lentiviruses עשויים לשלב באתרי כי יכול באופן פוטנציאלי משפיעים על hPSC תחזוקה ו/או פוטנציאל התפתחותי, stemness של hPSCsId1 מושבות צריך לפקח על-ידי הערכת גזע סימנים מורפולוגיים של ביטוי גנים והתבוננות בידול. שים לב overexpressing Id1 באמצעות וקטורים בלתי-אינטגרטיבית להתגבר על מגבלה זו, כעת נחקרת במעבדה שלנו.

תכונה אחת נוחה של שיטה זו הוא הפשטות של פרוטוקול בידול כפי שהיא דורשת רק ציטוקין אחד, A Activin, לייצר CPs FHF-L hPSCsId1. לשם השוואה, אחרים פרוטוקולים 9,10,11,12,13,14,15 דורשים רצפים המורכבים של שילובים של ציטוקינים ו/או מולקולות קטנות על מנת לקדם ולשמור על בידול הלב. בנוסף, פרוטוקול זה מתאר באופן ייחודי צעד הקפאה קריוגנית נוחה המאפשרת כדי לנתק FHF-L CP דור מייצור cardiomyocyte הבאים. תכונה זו מאפשרת biobank קבוצות גדולות של CPs FHF-L, לייצר במהירות cardiomyocytes אבות קפואים, כמו הלב בידול ממצב ביום 5 מפשיר. אסטרטגיה זו מאפשרת להשיג 1 עד 2 שבועות של זמן בהשוואה ל החל בידול הלב hPSCs. בנוסף, והכי חשוב, פרוטוקול זה הוא הפרוטוקול הראשון תאריך כדי ליצור לב אבות ממוצא שדה הלב מוגדרים, בעוד אחרים פרוטוקולים9,10,11,12 ,13,14,15 נשאר לא מוגדר בהקשר הזה.

לסיכום, פרוטוקול זה מתאר שיטה חזקה, וניתן להרחבה כדי לייצר כמויות גדולות (> 108–109) של CPs FHF-L מבחינת רלוונטיות, cardiomyocytes דמוי חדרית. בתורו, התאים וכתוצאה מכך יכול לשמש כדי לזהות את הרומן משעולים רגולטוריות שליטה בידול לב ופיזיולוגיה, ועבור משובי ומחלות מידול למטרות.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

אנו מודים חברי המעבדה קולה לדיונים מועיל, ביקורות קריטי של כתב היד. מחקר זה נתמך על ידי NIH/NIEHS R44ES023521-02, CIRM DISC2-10110 מעניקה ד ר קולה.

Materials

Name Company Catalog Number Comments
ACTC1 antibody Sigma A7811
Activin A Stem Cell Technologies Hu Recom Activin A
Antibiotic Antimycotic (Anti-Anti) Thermo Fisher Scientific 15240062
B27 supplement Thermo Fisher Scientific 17504044
B27 supplement w/o - insulin Thermo Fisher Scientific A1895601
B27 supplement w/o - vitamin A Thermo Fisher Scientific 12587001
CDH5 antibody R&D Systems AF938
CryoStor CS10 Stem Cell Technologies 7930 Cryopreservation reagent
DMEM high Glucose Mediatech 10-013-CV 
DPBS w/ Ca & Mg Corning 21-030-CV
EDTA Thermo Fisher Scientific 15575-038
FBS VWR 89510-186
FluoVolt membrane potential kit   Thermo Fisher Scientific F10488 For optical action potential acquisition, please refer to McKeithan et al. 2017
KnockOut Serum Replacement Gibco 10828010
Matrigel, Growth Factor Reduced Corning 356231 Coating reagent
mTeSR1 media kit Stem Cell Technologies 5850
PBS w/o Ca & Mg Corning 21-040-CV
Penicillin-Streptomycin Gibco
Puromycin  Acros 227422500
ReLeSR Stem Cell Technologies 5872 Enzyme-free dissociation reagent
RPMI 1640 Thermo Fisher Scientific 11875-093
TAGLN antibody Abcam ab14106
Thiazovivin Stem Cell Technologies 72254 RHO/ROCK pathway inhibitor
TrypLE Express Thermo Fisher Scientific 12605 -010 1X enzyme-containing dissociation reagent
Tyrodes solution mix packets   Sigma T2145-10X1L (For optical action potential acquisition, please refer to McKeithan et al. 2017)

DOWNLOAD MATERIALS LIST

References

  1. Chong, J. J., et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature. 510, 273-277 (2014).
  2. Kodo, K., et al. iPSC-derived cardiomyocytes reveal abnormal TGF-beta signalling in left ventricular non-compaction cardiomyopathy. Nature cell biology. 18, 1031-1042 (2016).
  3. Kim, C., et al. Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs. Nature. 494, 105-110 (2013).
  4. Colas, A. R., et al. Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis. Genes & development. 26, 2567-2579 (2012).
  5. Cunningham, T. J., et al. Id genes are essential for early heart formation. Genes & development. (2017).
  6. McKeithan, W. L., Colas, A. R., Bushway, P. J., Ray, S., Mercola, M. Serum-free generation of multipotent mesoderm (Kdr+) progenitor cells in mouse embryonic stem cells for functional genomics screening. Current protocols in stem cell biology. Chapter 1, Unit 1F 13 (2012).
  7. McKeithan, W. L., et al. An automated platform for assessment of congenital and drug-induced arrhythmia with hipsc-derived cardiomyocytes. Frontiers in physiology. 8, 766 (2017).
  8. Sharma, A., et al. High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells. Science translational medicine. 9, (2017).
  9. Burridge, P. W., et al. Chemically defined generation of human cardiomyocytes. Nature methods. 11, 855-860 (2014).
  10. Kattman, S. J., et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell. 8, 228-240 (2011).
  11. Laflamme, M. A., et al. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nature biotechnology. 25, 1015-1024 (2007).
  12. Lian, X., et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America. 109, 1848-1857 (2012).
  13. Willems, E., et al. Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells. Cell stem cell. 11, 242-252 (2012).
  14. Yang, L., et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature. 453, 524-528 (2008).
  15. Palpant, N. J., et al. Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nature protocols. 12, 15-31 (2017).
  16. DeLaughter, D. M., et al. Single-cell resolution of temporal gene expression during heart development. Developmental cell. 39, 480-490 (2016).
  17. Liu, X., et al. The complex genetics of hypoplastic left heart syndrome. Nature genetics. 49, 1152-1159 (2017).
  18. Corrado, D., Link, M. S., Calkins, H. Arrhythmogenic right ventricular cardiomyopathy. New England journal of medicine. 376, 1489-1490 (2017).
  19. Kitamura, T., et al. Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Experimental hematology. 31, 1007-1014 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics