Generasjon første hjertet felt-lignende Cardiac Progenitors og ventrikkel som Cardiomyocytes fra menneskelige Pluripotent stamceller

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her beskriver vi en skalerbar metode, bruke en enkel kombinasjon av Activin A og lentivirus-mediert Id1-overexpression, generere første hjertet felt-lignende cardiac progenitors og ventrikkel som cardiomyocytes fra menneskelige pluripotent stamceller.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Yu, M. S., Spiering, S., Colas, A. R. Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells. J. Vis. Exp. (136), e57688, doi:10.3791/57688 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Generering av store mengder funksjonell menneskelige pluripotent stamceller-avledet cardiac progenitors og cardiomyocytes definert hjertet feltet Opprinnelsesland er en forutsetning for cellebasert cardiac terapier og sykdom modellering. Vi har nylig vist at Id gener er både nødvendig og tilstrekkelig til å angi første hjertet feltet progenitors under virveldyrenes utvikling. Denne differensieringen protokollen utnytter disse funnene og bruker Id1 overuttrykte i kombinasjon med Activin A som potent angir signaler for å produsere første hjertet felt-lignende (FHF-L) progenitors. Viktigere, skille resulterende progenitors effektivt (~ 70-90%) i ventrikkel-lignende cardiomyocytes. Her beskriver vi en detaljert metode 1) generere Id1-overexpressing hPSCs og 2) skille skalerbar mengder cryopreservable FHF-L progenitors og ventrikkel-lignende cardiomyocytes.

Introduction

Storskala produksjon av menneskelig pluripotent stamceller (hPSCs)-avledede cardiac progenitors og cardiomyocytes er en forutsetning for stilk cellen-basert behandling1, sykdom modellering2,3 og rask karakterisering av romanen trasé regulerer hjerte differensiering4,5,6 og fysiologi7,8. Selv om en rekke studier9,10,11,12,13,14har,15 tidligere beskrevet høyeffektive CARDIAC differensiering protokoller fra hPSCs, ingen har adressert hjertet feltet opprinnelsen til resulterende cardiomyocytes, til tross for identifikasjon av betydelige molekylær forskjeller mellom venstre (første hjertet feltet) og høyre (andre hjertet felt) ventrikkel cardiomyocytes16 og eksistensen av hjertet Feltspesifikke medfødte hjertesykdommer; dvs hypoplastic venstre hjertet syndrom17 eller arrhythmogenic høyre ventrikkel dysplasia18. Dermed generering av cardiac progenitors og cardiomyocytes definert hjertet feltet opprinnelse fra hPSCs er blitt en nødvendighet for å øke relevansen som terapeutiske og sykdom modellverktøy.

Denne protokollen er avhengig av den grunnleggende overuttrykte Id1, en nylig identifisert5 første hjertet feltet-angir bunke som i kombinasjon med Activin A, er både nødvendig og tilstrekkelig å starte cardiogenesis i hPSCs. Cunningham et al. spesielt (2017) 5 viser at Id1-indusert progenitors spesielt uttrykke første hjertet-feltet (HCN4, TBX5), men ikke andre hjertet feltet indikatorer (SIX2, ISL1) som de gjennomgå cardiac differensiering. I tillegg viser forfatterne at transgene mouse embryoer mangler hele Id familien av gener (Id1-4), utvikle uten forming første hjertet feltet cardiac progenitors, mens mer mediale og posterior cardiac progenitors ( andre hjertet feltet) kan fortsatt danne, og dermed antyder at Id proteiner er avgjørende å starte første hjertet feltet cardiogenesis i vivo. Praktisk, Id1-indusert progenitors kan være cryopreserved og differensiere spontant i cardiomyocytes vise ventrikkel-lignende egenskaper, inkludert ventrikkel-spesifikke indikatorer (IRX4, MYL2) uttrykk og ventrikkel-lignende handling potensialer.

Her beskriver vi en enkel og skalerbar metode for å generere første hjertet felt-lignende (FHF-L) cardiac progenitors og ventrikkel som cardiomyocytes fra Id1 overexpressing hPSCs. Et viktig trekk ved denne protokollen er muligheten til å uncouple hjerte stamfar generasjon fra påfølgende cardiomyocyte produksjonen ved hjelp av en praktisk kryonisk bevaring trinn. I sammendraget, denne protokollen detaljer de nødvendige skritt for å (1) generere Id1-overexpressing hPSCs, (2) generere FHF-L cardiac progenitors fra hPSCs, (3) cryopreserve resulterende progenitors og (4) fortsette FHF-L cardiac stamfar differensiering og generere høyanriket (> 70-90%) slo ventrikkel-lignende cardiomyocytes.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Id1 Virus forberedelse og infeksjon

  1. Generere Id1 overexpressing lentivirus med transfecting pCMVDR8.74, pMD2.G og pCDH-EF1-Id1-PGK-PuroR (Addgene: plasmider #107735) i HEK293T celler. Samle virus partikler, Filtrer, rense fra nedbryting og lagre-80 ° c som Kitamura et al. (2003) 19. også produsere Id1 lentivirus kommersielt ved å sende pCDH-EF1-Id1-PGK-PuroR til lentivirus-produserende leverandør.
    Forsiktig: Følg lentiviral sikkerhetsforskrifter og standardoperasjon protokoller.
    Merk: Viktig: Optimal virus titer bør være minst 108 til 109 Transducing enheter/mL (TU/mL).
  2. Før infeksjon, coat en brønn av en 96 godt plate med 50 µl av belegg reagens, vanligvis en geléaktige proteinet blanding skilles ut av Engelbreth-Holm-sverm musen sarkomspesialitet celler (se Tabell for materiale).
  3. Distansere en brønn pluripotent stamceller vokst i en 6 godt plate ved å legge til 1 mL av PBS uten Ca2 + og Mg2 + og 0,5 mM EDTA.
    Merk: Dissosiasjon tid varierer fra 3-10 minutter. Når mer enn 80% av cellene er løsrevet fra bunnen av platen, videre til neste trinn.
  4. Samle celle hjuloppheng med sterilt Pipetter i 15 mL plast sentrifuge rør.
  5. Nøytralisere dissosiasjon reagens med 5 mL PBS inneholder Ca2 + og Mg2 +.
  6. Pellet celler med sentrifugering (200 x g for 3 min).
  7. Fjern nedbryting og forsiktig sveip røret for å dislodge pellet.
  8. Nytt suspendere celler i 1 mL av stilk cellen media.
  9. Telle celler ved hjelp av en automatisert celle teller følge leverandørens instrukser.
  10. Plate 20.000 levedyktig celler per belagt godt (96-brønns plate) i 50 µL av stilk cellen media med 2 µM RHO/ROCK veien hemmer (se tabell 1 og 2).
  11. Etter 24 timer, overvåke celle vedlegg og erstatte media med 100 µl stilk cellen media supplert med 2 µM RHO/ROCK veien hemmer og 6 ng/mL hexadimethrine bromide (se tabell 1 og 2), en h før lentiviral infeksjon.
    Merk: Celler bør være godt festet til bunnen av platen.
  12. Tine Id1-lentivirus på is.
  13. Legge 3 µL av renset lentivirus per brønn (virus titer bør være mellom 108 til 109 TU/mL), og deretter overføre platen tilbake til celle kultur inkubator (37 ° C, 5% CO2, 20% O2).
  14. 24 timer etter virusinfeksjon, legge til 100 µL av friske stamceller media i infiserte celler.
  15. 48 timer etter lentiviral infeksjon, Erstatt virus som inneholder medier med 200 µL av friske stamceller media med 1 µg/mL puromycin.
  16. Oppdater media daglig med 200 µL av stilk cellen media med 1 µg/mL puromycin.
  17. Når kulturer når 80% confluency, distansere celler med 200 µL av PBS uten Ca2 + og Mg2 + + 0,5 mM EDTA (for en godt av en 96-brønns plate).
  18. Samle celle suspensjon i en sentrifuge rør.
  19. Nøytralisere dissosiasjon reagens med 5 mL PBS inneholder Ca2 + og Mg2 +.
  20. Pellet celler med sentrifugering (200 x g for 3 min).
  21. Fjern nedbryting og forsiktig sveip røret for å dislodge pellet.
  22. Nytt suspendere celler i 1 mL av stilk cellen media med 2 µM RHO/ROCK veien inhibitor.
  23. Overføre alle celler (1 mL) til en belagt godt av en 12-vel plate.
  24. Etter 24 timer, skjermen for cellen vedlegg til vel og erstatt media med 1 mL av stilk cellen media supplert med 2 µM RHO/ROCK veien hemmer og 6 ng/mL hexadimethrine bromide, en h før signaltransduksjon.
  25. Tine Id1-lentivirus på is.
  26. Legge til 5 µL av renset virus per brønn (12-vel plate).
  27. 24 timer etter lentiviral infeksjon, Erstatt virus som inneholder medier med 1 mL av friske stamceller media med 3 µg/mL puromycin.
  28. 48t post lentiviral infeksjon, erstatte virus som inneholder medier med 1 mL av friske stamceller media med 6 µg/mL puromycin.
  29. Når kulturer når 80% confluency, distansere celler med 500 µL av PBS uten Ca2 + og Mg2 + og 0,5 mM EDTA (for en godt av en 12-vel plate).
  30. Overføre halvparten (250 µL) av cellen suspensjon i en brønn av et belegg reagensen belagt 6-vel plate inneholder 2 mL av stilk cellen media med 2 µM RHO/ROCK veien inhibitor.
  31. Bruke den andre halvparten (250 µL) av utvalget for RNA utvinning og qRT PCR for å bestemme lentiviral-mediert Id1 uttrykk nivåer, som Colas et al. (2012) 4.
    Merk: Viktig: Hvis Id1 mRNA uttrykk nivåer er lavere enn 0.005 fold GAPDH uttrykk nivåer (se tabell 3 qRT PCR primere), gjenta infeksjon prosessen slik til Id1 uttrykk nivåene er høyere enn den terskelen.

2. hPSCsId1 vedlikehold

  1. Kultur hPSCsId1 i belagt 6 vel-plater og vokse i 3 mL per brønn stamcelleforskningen medier med 6 µg/mL puromycin.
  2. Når hPSCsId1 når 80% confluency, passasje celler som aggregater (1:6 delt ratio) ved hjelp av enzym-fri dissosiasjon reagens etter leverandør retningslinjer og vokse i 3 mL per brønn stamcelleforskningen medier med 6 µg/mL puromycin.

3. forberedelse av hPSCsId1 for differensiering

  1. Coat en 12-vel plate med 500 µL per brønn av belegg reagensen.
  2. Når hPSCsId1 nå 90% confluency distansere celler ved å legge til 1 mL av PBS uten Ca2 + og Mg2 + og 0,5 mM EDTA per brønn for 5 – 10 min. Sjekk dissosiasjon prosessen hvert minutt, og når 80% av cellene er atskilt fra platen , videre til neste trinn.
  3. Samle celle suspensjon i en sentrifuge rør.
  4. Nøytralisere dissosiasjon reagens med 5 mL PBS inneholder Ca2 + og Mg2 +.
  5. Pellet celler med sentrifugering (200 x g for 3 min).
  6. Fjern nedbryting og forsiktig sveip røret for å dislodge pellet.
  7. Nytt suspendere celler i 2 mL av stilk cellen media med 2 µM RHO/ROCK veien inhibitor.
  8. Telle celler ved hjelp av en automatisert celle teller.
  9. Plate 300.000 celler per brønn i 1 mL av stilk cellen media supplert med 2 µM RHO/ROCK veien hemmer 6 µg/mL puromycin og overføre plate i vev kultur inkubator.
  10. Oppdater media daglig med 2 mL av stilk cellen media supplert med 6 µg/mL puromycin til kulturer når 90% confluency. På dette punktet, starte cardiac differensiering (neste trinn).

4. differensiering av hPSCsId1 i første felt-lignende Cardiac Progenitors (FHF-L CPs)

  1. For 12-vel plate format, initiere differensiering (dag 0) ved å erstatte stilk cellen media med 1,5 mL induksjon medier (tabell 1) supplert med Activin en (100 ng/mL) (se tabell 2 for anbefalt volumer og Activin A konsentrasjoner for forskjellige plate formater).
  2. På dag 1 (24 timer etter at differensiering er startet), erstatte media med 2 mL induksjon media uten Activin A (per brønn av en 12-vel plate).
  3. Dag 3, erstatte media med 2 mL induksjon media uten Activin A (per brønn av en 12-vel plate).
  4. På dag 5, samle FHF-L CPs for kryonisk bevaring (neste trinn).
    Merk: Viktig: kryonisk bevaring er foretrukket på dette punktet, som gjør det mulig for å uncouple hjerte stamfar generasjon fra påfølgende cardiomyocyte produksjon og biobank store grupper av celler. Vær oppmerksom på at eventuelt dag 5 FHF-L CPs kan sendes til en fersk belegg plate fortsette differensiering, se 5.1-5.5 slik passFHF-L CPs og går videre til trinn 6.5 for differensiering.

5. kryonisk bevaring av FHF-L CPs

  1. Sug opp alle medier fra brønner som inneholder dag 5 FHF-L CPs og raskt legge til 1 mL av varm (37 ° C) 1 x enzym inneholder dissosiasjon reagens (se Tabell for materiale). Plasser platen i vev kultur inkubator.
  2. Etter 1 min, riste plate siden i inkubator.
  3. Etter 2 min (Totaltid), Fjern plate fra inkubator og tilsett 1 mL av 10% FBS media.
  4. Forsiktig Pipetter celler opp og ned med en 5 mL Pipetter å lette celle løsgjøring fra platen.
  5. Samle celle suspensjon en sentrifuge rør og pellets celler med sentrifugering 200 x g for 3 min
  6. Nytt avbryte celle pellet 2 mL kryonisk bevaring reagens.
  7. Telle celler ved hjelp av en automatisert celle teller.
  8. Legge til kryonisk bevaring reagens (se Tabell for materiale) med tilstrekkelig volum til cryopreserve cellene på ønsket konsentrasjon (vanligvis 5-10 x 106 celler/mL).
  9. Overføre celler til kryonisk bevaring ampuller og plassere ampuller i kjøling enhet (1 ° C/min) og plassere kjøling enhet i-80 ° C fryseren over natten.
  10. Etter 24 timer, kan du overføre frosne ampuller til flytende nitrogen for langtidslagring.
    Merk: Protokollen kan pauses her.

6. FHF-L CP differensiering inn ventrikkel-lignende Cardiomyocytes

  1. Overføre dag 5 FHF-L CPs frosset ampuller fra flytende nitrogen oppbevaring i tørris beholder.
  2. Plasserer ampuller i 37 ° C vannbad i 2-3 min, til cellen suspensjon er tint opp helt.
    Merk: Viktig: tiner prosessen er tidssensitiv. Utsette celler til kryonisk bevaring media for en overdreven mengde tid (dvs. 10 min) vil redusere celle levedyktighet.
  3. Overføre celler til 15 eller 50 mL sentrifuge tube, avhengig av antall tinte hetteglass.
  4. Dispensere dropwise (5 dråper 30 sekunder) forvarmes (37 ° C) kardiogent medier (tabell 1) cell løsningen. Fortsett denne prosessen inntil 1:3 kryonisk bevaring media: kardiogent media forholdet er nådd. På dette punktet, øke kardiogent media tillegg hastigheten til en 1:10 kryonisk bevaring media: kardiogent media forholdet er nådd.
    Merk: Viktig: rask osmolaritet endringer vil øke celledød under tiner prosessen; Derfor anbefales dropwise tillegg kardiogent medier som beskrevet ovenfor.
  5. Sentrifuge celle hjuloppheng og pellets celler med sentrifugering (200 x g for 3 min).
  6. Fjern nedbryting og forsiktig sveip sentrifuge tube å dislodge celle pellets.
  7. Nytt suspendere celler med kardiogent medier med 2 µM RHO/ROCK veien inhibitor.
    Merk: Cellen levedyktighet kan variere fra tine å tine og, generelt, > 65% levedyktighet spår god plating effektivitet.
  8. Fortynne konsentrert celle suspensjon med kardiogent medier med 2 µM RHO/ROCK veien inhibitor for å få ønsket celle konsentrasjonen for plating (se tabell 2 for ulike plate formater).
    Merk: Viktig: Merk at cardiac differensiering effektivitet kan avta hvis cellene er seeded for tynt.
  9. Frø celler på plate.
  10. Holde platen i vev kultur panseret for 20 min før du overfører den til vev kultur inkubator.
  11. På dag 6 av differensiering, overvåke celle vedlegg.
    Merk: Cardiac progenitors er cryopreserved på dag 5 av differensiering. 24 timer etter tining cellene vil være på dag 6 av differensiering.
    Merk: Tilstedeværelsen av flytende (død) celler er vanlig.
  12. På dag 7, Sug opp 50% av media og erstatte med en lik mengde frisk kardiogent media.
    Merk: Tillegg av RHO/ROCK veien hemmer til kardiogent media er ikke nødvendig etter dette tidspunktet.
  13. Erstatt 50% av media med kardiogent media annenhver dag.
  14. Merk spontan slo som vises mellom 11 og dagen 13.
  15. På dag 15, kvantifisere cardiac differensiering effektivitet av immunofluorescence DAPI (kjernen flekken) og ACTC1 (pan-hjerte markør).

7. bestått og vedlikehold av ventrikkel-lignende Cardiomyocytes

Merk: Ved dag 14-16, en monolayer av spontant kontraktørselskaper ventrikkel-lignende cardiomyocytes kan skaffes. På dette punktet, er det foreslått å distansere og re plate cardiomyocytes for å homogenize kultur og forhindre at celler frakobling fra platen.

  1. Sug opp alle medier fra brønner og raskt legge til 1 mL av forvarmes (37 ° C) 1 x enzym inneholder dissosiasjon reagens.
    Merk: 1 x enzym inneholder dissosiasjon reagens volumer varierer plate format, men bør dekker nederst godt overflaten.
  2. Overføre plate til en vev kultur inkubator.
  3. Forsiktig risting plate siden hver 2 min i inkubator å akselerere avdeling prosessen.
  4. Etter 5-15 min, når 80% til 100% av cellene er løsrevet fra bunnen av platen, fjerne platen fra inkubator og hemme 1 x enzym inneholder dissosiasjon reagens aktivitet ved å legge til en lik mengde 10% FBS media.
    Merk: Inkubasjon med 1 x enzym inneholder avstandtagen for denne prosessen vil variere fra parti til parti.
  5. Samle celle suspensjon slik sentrifuge.
  6. Bland celle suspensjon med Pipetter og antall celler ved hjelp av en automatisert celle teller.
  7. Fortynne celle suspensjon til ønsket celle konsentrasjon (se tabell 2 for ulike plate formater) med vedlikehold medier med 2 µM RHO/ROCK veien inhibitor.
  8. Etter seeding cardiomyocytes på platen, fordele cellene jevnt, og at cellene å feste i 10-20 minutter før du overfører plate til vev kultur inkubator.
  9. 24 timer etter re plating, overvåke celle vedlegg og gjenoppretting.
    Merk: Tilstedeværelsen av flytende (død) celler er vanlig. 48-72 timer etter re plating, cardiomyocyte fortsette spontan sammentrekning.
  10. For å opprettholde cardiomyocyte kultur, erstatte 50% av media med vedlikehold media annenhver dag før bruk av ventrikkel-lignende cardiomyocytes for etterfølgende eksperimenter.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Generering av hPSCs Id1 linjer
hPSCs er infisert med en lentivirus formidle Id1 overuttrykte (figur 1A). Når hPSCId1 genereres, er transgene uttrykk kvantifisert ved qRT PCR (figur 1B). Bare hPSCId1 linjer uttrykke Id1 mRNA på nivåer høyere enn 0.005 fold av som GAPDH skal brukes for differensiering.

hPSCs Id1 Vedlikehold og forberedelse til D ifferentiation
Optimal oppdrettsforholdene er nødvendig og avgjørende for vellykket første hjerte felt-lignende cardiac stamfar differensiering (figur 2A). hPSCId1 kulturer bør overvåkes daglig for stammen morfologi vedlikehold og kontinuerlig spredning. Differensiering skal startes når tett pakket stamcelleforskningen kolonier > 90% confluency (figur 2B). Hvis differensiering startes før optimale confluency, celledød er forbedret og differensiering effektivitet kan avslå (figur 2C). Tilsvarende utfører overgrodd kulturer dårlig (figur 2D).

Generasjon av første hjertet felt-lignende Cardiac Progenitors (FHF-L CPs) fra hPSCs Id1
På dag 1 (24 h innlegget differensiering innvielse), bør celler overvåkes for å observere tap av stammen morfologi (celler vises flatere og mørkere enn stamceller). Merk at celledød er vanlig under den første dagen av differensiering, men cellen samløpet bør opprettholdes på > 75% (figur 2E). Hvis du etter 24 h av differensiering, 50% eller mer av dekket arealet mister skal celler kasseres.

Dag 3, unike cellene må være gruppert og har fylt hullene som skapes under første 24 h tidsperiode (figur 2F). Flat cellene vokse uavhengig er indikativ av suboptimal differensiering.

På dag 4, skal optimal differensiering vise fortsatt ekspansjon og dekning av platen.

På dag 5, er celler høstet og cryopreserved. Optimale atskillinger skal resultere i tett koblet celle klynger med homogen morfologi utseende (figur 2G). Merk at lav tetthet klynger av flat celler merke en suboptimal differensiering utfall. Se tabell 2 for den gjennomsnittlige avkastningen fra dag 5 cardiac progenitors per brønn i ulike kultur formater.

Generasjon av ventrikkel som Cardiomyocytes fra FHF-L CPs
Dag 5 FHF-L CPs er tint på plate format-avhengige tettheter beskrevet i tabell 2, for å maksimere deres hjerte differensiering potensielle (Figur 3A og tabell 2). Levedyktigheten etter tining må overvåkes. Vanligvis levedyktighet spenner fra 70-80%. Hvis levedyktighet er under 60%, vil avkastningen av cardiomyocytes bli berørt.

På dag 6 (24 h etter gjenopptak differensiering), FHF-L CPs bør dekke > 90% av de tilgjengelige arealet og vises som en homogen enkelt lag av celler (Figur 3B). Lav samløpet på dag 6 vil redusere FHF-L CPs differensiering inn cardiomyocytes.

Resulterende cardiomyocytes starte å slå av dag 11-13 av differensiering (Figur 3C og film 1). Under dag 14-16 replating prosessen, se tabell 2 for den gjennomsnittlige avkastningen fra cardiomyocytes per brønn i ulike kultur-formater. Differensiering effektivitet er vanligvis vurdert av immunofluorescence for hjerte (ACTC1), fibroblast (TAGLN) og vaskulær endotelial markører (CDH5) og kjernefysiske (DAPI)-markører. Avstamning kvantifisering utføres ved hjelp av automatiserte bildebehandling og fluorescens kvantifisering, som Cunningham et al. (2017) 5 (Figur 3D-E). Undertypen karakteristikk av resulterende cardiomyocytes utføres av qRT PCR (Figur 3F) og handling potensial forbigående analyse ved hjelp av kinetisk bildebehandling og spenning sensing sonder (Figur 3G og Movie 2). Fluorescens kvantifisering for spenningsmåleren og resulterende handling potensial spor analyse (Figur 3H) utføres som beskrevet i McKeithan et al. (2017) 7.

Figure 1
Figur 1: generering av hPSCId1 linjer. (A) skjematisk fremstilling av hPSCsId1 generasjon protokollen. (B) eksempler på qRT PCR resultater viser representant Id1 mRNA nivåer generert av lentiviral-mediert uttrykk fra forskjellige linjer med hPSCId1 inkludert en hESC linje og to linjer av hPSC linjer. Stiplet linje representerer Id1 uttrykk terskel, under hvilke hPSCId1 linjer må gjennomgå en ekstra syklus av Id1-lentivirus. "p" angir hvor passasje. Tallet i parentesen angir antall runder av Id1-lentiviral. Feilfelt representerer standardavvik eksperimenter utført i tre eksemplarer. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: Generasjon av første hjertet Field-Like Cardiac Progenitors (FHF-L CPs) differensiering fra hPSCId1. (A) skjematisk fremstilling av FHF-L CP generasjon protokollen. Representant lyse feltet bilder av hPSCId1 (dag 0) på optimal (B), sub confluent (gul pilspisser indikere ugyldige områdene mellom celler) (C) og over confluent (D) tettheter. Representant lyse-feltet bilder av skille hPSCId1 på dag 1, 3 og 5 henholdsvis (E), (F), (G). Skala bar = 100 µm. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: generasjon av ventrikkel som Cardiomyocyte fra FHF-L CPs. (A) Skjematisk fremstilling av ventrikkel-lignende cardiomyocyte generasjon protokollen. (B) lyse feltet bilde celleområde dag 6 differensiering (endag etter tining). (C) lyse feltet bilde av en dag 12 juling kultur. (D) representant immunofluorescence bilde av dagen 15 kulturer (384-vel plate format). ACTC1 markerer cardiomyocytes, TAGLN: fibroblaster/glatt muskel, CDH5: vaskulær endotelial celler og DAPI: kjerner (vises i innfelt). (E) avstamning kvantifisering av dag 15 kulturer. (F) qRT PCR data gang kurs uttrykk fra dag 5 dag 25 ventrikkel-spesifikke indikatorer (IRX4 og MYL2) og pan-hjerte markør (MYL7). (G) representant handling potensial spor fra ventrikkel som cardiomyocytes på dag 25 av differensiering. (H) Action potensial varighet målinger (APD50 og APD90) av resulterende ventrikkel-lignende cardiomyocytes (n = 12). Feilfelt representerer standardavvik eksperimenter utført i quadruplicate (med mindre annet er angitt). Skalere barer = 100 µm. RFU, relativ fluorescens enhet. Klikk her for å se en større versjon av dette tallet.

Middels Base medium Tilsetningsstoff
Stilk cellen Media mTesR1 i/t
Induksjon Media RPMI 1640 Medium B-27 Serum-Free Supplement uten insulin, 1 x
Induksjon Media RPMI 1640 Medium Puromycin, 6 µg/ml
Induksjon Media RPMI 1640 Medium Penicillin-Streptomycin, 1 x
Kardiogent Media RPMI 1640 Medium B-27 Serum-Free Supplement, 1 x
Kardiogent Media RPMI 1640 Medium Penicillin-Streptomycin, 1 x
Vedlikehold Media RPMI 1640 Medium B-27 Serum-Free Supplement, 1 x
Vedlikehold Media RPMI 1640 Medium KnockOut Serum erstatning, 2%
Vedlikehold Media RPMI 1640 Medium Penicillin-Streptomycin, 1 x

Tabell 1: Media komponentene (se tabell for materiale for base media og tilsetningsstoffer).

384 godt 96 godt 12 godt 6 vel 100 mm 150 mm
Belegg volum (per brønn) 10 ΜL 50 ΜL 500 ΜL 1 mL 5 mL 10 mL
Middels volum
(per brønn)
100 ΜL 300 ΜL 2 mL 5 mL 12 mL 30 mL
Differensiering dag 0 activin en konsentrasjonen (ng/mL) 100 100 100 300
CARDIAC stamfar
dag 5 avkastning
(celler/vel)
1.0-1.2 x 105 2,5-3,0 x 105 1.0-1,5 x 107 2.0-3.0 x 107
CARDIAC stamfar dag 5 replating eller tining tetthet (celler/vel) 2.0 x 104 7.5 x 105 4.5 x 106 8.0 x 106 2.2 x 107
Ventrikkel-lignende cardiomyocyte
dag 14-16 avkastning
(celler/vel)
2.0-5.0 x 104 0,8-1.2 x 106 3.5-5.0 x 106 0,8-1.2 x 107 1.8-2.5 x 107
Ventrikkel-lignende cardiomyocyte replating tetthet
(celler/vel)
2.5 x 104 1.0 x 106 4.5 x 106 1.0 x 107 2.2 x 107

Tabell 2: Skalerbare differensiering parametere (belegg volum, middels volum, Activin A konsentrasjon, avkastning, replating tettheter).

Gene navn Dommedagsvelvet tiltredelse Sekvens
GAPDH NM_001256799 F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
musen Id1 NM_010495 F: CCTAGCTGTTCGCTGAAGGC
R: CTCCGACAGACCAAGTACCAC
IRX4 NM_016358 F: GGCTCCCCAGTTCTTGATGG
R: TAGACCGGGCAGTAGACCG
MYL2 NM_000432 F: TTGGGCGAGTGAACGTGAAAA
R: CCGAACGTAATCAGCCTTCAG
MYL7 NM_021223 F: GCCCAACGTGGTTCTTCCAA
R: CTCCTCCTCTGGGACACTC

Tabell 3: qRT PCR primer sekvenser.

Movie 1
Film 1: lyse feltopptak (100 rammer/s) av dag 15 cardiomyocytes hvor spontan sammentrekninger kan observeres. Vennligst klikk her å se denne videoen. (Høyreklikk for å laste ned.)

Movie 2
Movie 2: Kinetic imaging (100 rammer/s) av spenning-sensitive fluorescerende sonde i dag 25 id1-indusert ventrikkel-lignende cardiomyocytes. Vennligst klikk her å se denne videoen. (Høyreklikk for å laste ned.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

For vellykket atskillinger, må du nøye følge instruksjonene ovenfor. I tillegg markere her vi nøkkelparameterne som sterkt påvirker differensiering resultater. Før du starter en differensiering, følgende tre morfologiske parametere bør overholdes: en stilk morfologi av hPSCsId1, en høy mobilnettet komprimering og en høy samløpet (> 90%) av kultur på dag 0. I den forbindelse, optimal differensiering forhold er best laget av plating dissosiert hPSCsId1 som enkeltceller og tillate dem å danne tett klynge monolayers som vokser til ~ 90% samløpet i løpet av 2 til 3 dager. Omvendt, hvis hPSCId1 kulturer viser dårlig cellen og kolonien morfologi, lav kolonien komprimering og tilstedeværelsen av store områder av differensiering i kulturen, vellykket FHF-L CP differensiering er usannsynlig.

Media-volum og Activin A konsentrasjoner er kritiske parametere for FHF-L CP differensiering og plate format-avhengige (se tabell 2). Merk også at optimale Activin A konsentrasjoner kan variere avhengig av brukt hPSC linje og krever konsentrasjon optimalisering.

Id1 mRNA nivåer i hPSCs er avgjørende å effektivt fremme FHF-L CP. Suboptimal Id1 nivåer mislykkes å produsere robust FHF-L CP differensiering og massiv celledød dag 1 av differensiering vil observeres. Relativ uttrykk forholdet mellom Id1- til -GAPDH overstige 0.005 for å fremme effektiv differensiering. Fortsatt utvalg med høyere doser av puromycin (6 – 10 µg/mL) anbefales for å beholde høye nivåer av lentiviral-mediert Id1 uttrykk. En evaluering av Id1 mRNA nivåer hver 10 passasjer anbefales.

Kontaktflate tettheter på dag 5 FHF-L CPsis også en viktig parameter for cardiac differensiering effektivitet. Hvis dag 5 FHF-L CPs er belagt på lav tetthet, relativ cardiac avkastningen reduseres. Optimal plating tettheter vises i tabell 2 og er plate format-avhengige.

Den viktigste begrensningen for denne protokollen er bruken av lentiviral-mediert Id1 overuttrykte til promoteFHF-L CP differensiering som kan begrense terapeutisk bruk av resulterende progenitors og ventrikkel-lignende cardiomyocytes. Også, siden lentiviruses kan integrere på steder som kan potensielt påvirke hPSC vedlikehold og/eller utviklingsmessige potensiale, stemness av hPSCsId1 kolonier bør overvåkes ved å evaluere stamme genuttrykk og observere morfologiske tegn på differensiering. Merk at overexpressing Id1 ved hjelp av ikke-integrerende vektorer ville overvinne denne begrensningen og undersøkes for tiden i vårt laboratorium.

En praktisk funksjon i denne metoden er enkelheten av differensiering protokollen som det bare krever en cytokin, Activin A, generere FHF-L CPs fra hPSCsId1. Sammenligning andre protokoller 9,10,11,12,13,14,15 krever kompleks sekvenser av kombinasjoner av cytokiner og/eller små molekyler for å fremme og opprettholde cardiac differensiering. I tillegg beskriver denne protokollen bare et praktisk kryonisk bevaring skritt som lar uncouple FHF-L CP generasjon fra påfølgende cardiomyocyte produksjon. Denne funksjonen lar biobank store grupper av FHF-L CPs og raskt generere cardiomyocytes fra frosne progenitors som cardiac differensiering reaktiveres fra dag 5 ved tining. Denne strategien kan få 1 til 2 uker i tid i forhold til utgangspunkt hPSCs hjerte differensiering. I tillegg, og viktigst, er denne-protokollen den første datoen for å generere cardiac progenitors av definerte hjertet feltet opprinnelse, mens andre protokoller9,10,11,12 ,13,14,15 forblir i den forbindelse.

I sammendraget, denne protokollen definerer en robust og skalerbar metode for å produsere store mengder (> 108– 109) developmentally relevante FHF-L CPs og ventrikkel-lignende cardiomyocytes. I sin tur resulterende celler kan brukes til å identifisere romanen regulatoriske trasé kontrollere cardiac differensiering og fysiologi, og regenererende og modellering formål.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Vi takker medlemmer av laboratoriet Colas nyttig diskusjoner og kritiske vurderinger av manuskriptet. Denne studien ble støttet av NIH/NIEHS R44ES023521-02 og CIRM DISC2-10110 gir Dr. Colas.

Materials

Name Company Catalog Number Comments
ACTC1 antibody Sigma A7811
Activin A Stem Cell Technologies Hu Recom Activin A
Antibiotic Antimycotic (Anti-Anti) Thermo Fisher Scientific 15240062
B27 supplement Thermo Fisher Scientific 17504044
B27 supplement w/o - insulin Thermo Fisher Scientific A1895601
B27 supplement w/o - vitamin A Thermo Fisher Scientific 12587001
CDH5 antibody R&D Systems AF938
CryoStor CS10 Stem Cell Technologies 7930 Cryopreservation reagent
DMEM high Glucose Mediatech 10-013-CV 
DPBS w/ Ca & Mg Corning 21-030-CV
EDTA Thermo Fisher Scientific 15575-038
FBS VWR 89510-186
FluoVolt membrane potential kit   Thermo Fisher Scientific F10488 For optical action potential acquisition, please refer to McKeithan et al. 2017
KnockOut Serum Replacement Gibco 10828010
Matrigel, Growth Factor Reduced Corning 356231 Coating reagent
mTeSR1 media kit Stem Cell Technologies 5850
PBS w/o Ca & Mg Corning 21-040-CV
Penicillin-Streptomycin Gibco
Puromycin  Acros 227422500
ReLeSR Stem Cell Technologies 5872 Enzyme-free dissociation reagent
RPMI 1640 Thermo Fisher Scientific 11875-093
TAGLN antibody Abcam ab14106
Thiazovivin Stem Cell Technologies 72254 RHO/ROCK pathway inhibitor
TrypLE Express Thermo Fisher Scientific 12605 -010 1X enzyme-containing dissociation reagent
Tyrodes solution mix packets   Sigma T2145-10X1L (For optical action potential acquisition, please refer to McKeithan et al. 2017)

DOWNLOAD MATERIALS LIST

References

  1. Chong, J. J., et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature. 510, 273-277 (2014).
  2. Kodo, K., et al. iPSC-derived cardiomyocytes reveal abnormal TGF-beta signalling in left ventricular non-compaction cardiomyopathy. Nature cell biology. 18, 1031-1042 (2016).
  3. Kim, C., et al. Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs. Nature. 494, 105-110 (2013).
  4. Colas, A. R., et al. Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis. Genes & development. 26, 2567-2579 (2012).
  5. Cunningham, T. J., et al. Id genes are essential for early heart formation. Genes & development. (2017).
  6. McKeithan, W. L., Colas, A. R., Bushway, P. J., Ray, S., Mercola, M. Serum-free generation of multipotent mesoderm (Kdr+) progenitor cells in mouse embryonic stem cells for functional genomics screening. Current protocols in stem cell biology. Chapter 1, Unit 1F 13 (2012).
  7. McKeithan, W. L., et al. An automated platform for assessment of congenital and drug-induced arrhythmia with hipsc-derived cardiomyocytes. Frontiers in physiology. 8, 766 (2017).
  8. Sharma, A., et al. High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells. Science translational medicine. 9, (2017).
  9. Burridge, P. W., et al. Chemically defined generation of human cardiomyocytes. Nature methods. 11, 855-860 (2014).
  10. Kattman, S. J., et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell. 8, 228-240 (2011).
  11. Laflamme, M. A., et al. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nature biotechnology. 25, 1015-1024 (2007).
  12. Lian, X., et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America. 109, 1848-1857 (2012).
  13. Willems, E., et al. Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells. Cell stem cell. 11, 242-252 (2012).
  14. Yang, L., et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature. 453, 524-528 (2008).
  15. Palpant, N. J., et al. Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nature protocols. 12, 15-31 (2017).
  16. DeLaughter, D. M., et al. Single-cell resolution of temporal gene expression during heart development. Developmental cell. 39, 480-490 (2016).
  17. Liu, X., et al. The complex genetics of hypoplastic left heart syndrome. Nature genetics. 49, 1152-1159 (2017).
  18. Corrado, D., Link, M. S., Calkins, H. Arrhythmogenic right ventricular cardiomyopathy. New England journal of medicine. 376, 1489-1490 (2017).
  19. Kitamura, T., et al. Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Experimental hematology. 31, 1007-1014 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics