Generation af første hjertet felt-lignende hjerte ophav og ventrikel-lignende Cardiomyocytes fra humane pluripotente stamceller

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her beskriver vi en skalerbar metode, ved hjælp af en simpel kombination af Activin A og lentivirus-medieret Id1-overekspression, til at generere første hjertet felt-lignende hjerte ophav og ventrikel-lignende cardiomyocytes fra humane pluripotente stamceller.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Yu, M. S., Spiering, S., Colas, A. R. Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells. J. Vis. Exp. (136), e57688, doi:10.3791/57688 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Generation af store mængder af funktionelle humane pluripotente stamceller-afledt hjerte ophav og cardiomyocytes af definerede hjerte felt oprindelse er en forudsætning for celle-baserede hjerte behandlinger og sygdom modellering. Vi har for nylig vist, at Id gener er både nødvendigt og tilstrækkeligt at angive første hjertet felt stamfaderen under hvirveldyr udvikling. Denne differentiering protokol udnytter disse resultater og bruger Id1 overekspression i kombination med Activin A som potent angive stikord til at producere første hjertet felt-lignende (FHF-L) ophav. Vigtigere, differentiere resulterende stamfaderen effektivt (~ 70-90%) i ventrikel-lignende cardiomyocytes. Her beskriver vi en detaljeret metode 1) generere Id1-overekspression hPSCs og 2) differentiere skalerbare mængder af cryopreservable FHF-L ophav og ventrikel-lignende cardiomyocytes.

Introduction

Storstilet produktion af humane pluripotente stamceller (hPSCs)-afledte hjerte ophav og cardiomyocytes er en forudsætning for stamcelle-baseret terapier1, sygdom modellering2,3 og hurtig karakterisering af Roman veje regulere hjertets differentiering4,5,6 og fysiologi7,8. Selv om en række af undersøgelser9,10,11,12,13,14har,15 tidligere beskrevet højeffektive hjerte differentiering protokoller fra hPSCs, ingen har rettet hjerte felt oprindelsen af resulterende cardiomyocytes, til trods for identifikation af væsentlige molekylære forskelle mellem venstre (første hjertet field) og højre (andet hjerte felt) ventrikulær cardiomyocytes16 og eksistensen af hjertet field-specifikke medfødte hjertesygdomme; dvs., hypoplastisk venstre hjerte syndrom17 eller arrhythmogenic højre ventrikel dysplasi18. Således, generation af cardiac ophav og cardiomyocytes af definerede hjerte felt oprindelse fra hPSCs bliver en nødvendighed for at øge deres relevans som terapeutisk og sygdom modelleringsværktøjer.

Denne protokol er baseret på den konstituerende overekspression af Id1, en nyligt identificerede5 første hjertet angivelse af feltet Stikord at i kombination med Activin A, er både nødvendig og tilstrækkelig til at indlede cardiogenesis i hPSCs. Navnlig Cunningham et al. (2017) 5 vis at Id1-induceret stamfaderen specifikt express første hjertet felt (HCN4, TBX5) men ikke andet hjerte felt markører (SIX2, ISL1) som de undergår hjerte differentiering. Derudover også vise forfatterne at Transgene mus embryoner mangler den hele Id familie af gener (Id1-4), udvikle uden at danne første hjertet felt hjerte progenitorceller, mens flere mediale og posterior hjerte stamfaderen ( andet hjerte felt) kan stadig danne, hvilket antyder, at Id proteiner er vigtigt at indlede første hjertet felt cardiogenesis i vivo. Bekvemt, Id1-induceret stamfaderen kan være cryopreserved og spontant differentiere i cardiomyocytes viser ventrikulær-lignende egenskaber, herunder ventrikulær-specifikke markører (IRX4, MYL2) udtryk og ventrikulær-lignende handling potentialer.

Her beskriver vi en enkel og skalerbar metode til at generere første hjertet felt-lignende (FHF-L) hjerte ophav og ventrikel-lignende cardiomyocytes fra Id1 overekspression hPSCs. Et vigtigt element i denne protokol er muligheden for at koble hjerte stamfader generation fra efterfølgende cardiomyocyte produktion ved hjælp af en bekvem kryopræservering trin. Sammenfattende denne protokol beskriver de nødvendige skridt til at (1) generere Id1-overekspression hPSCs, (2) generere FHF-L hjerte ophav fra hPSCs, (3) cryopreserve resulterende ophav og (4) genoptage FHF-L hjerte stamfader differentiering og generere højt beriget (> 70-90%) slå ventrikulær-lignende cardiomyocytes.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Id1 Virus forberedelse og infektion

  1. Generere Id1 overekspression lentivirus af co transfecting pCMVDR8.74, pMD2.G og pCDH-EF1-Id1-PGK-PuroR (Addgene: plasmid #107735) i HEK293T celler. Indsamle viruspartikler, filtratet, rense fra supernatanten og opbevares ved-80 ° C som Kitamura et al. (2003) 19. Alternativt kan producere Id1 lentivirus kommercielt ved at sende pCDH-EF1-Id1-PGK-PuroR til en lentivirus-producerende leverandør.
    Forsigtig: Følg lentiviral sikkerhedsbestemmelser og standarddrift protokoller.
    Bemærk: Vigtigt: Optimal virus titer bør være mindst 108 109 Transducing enheder/mL (TU/mL).
  2. Før infektionen, pels et godt af en 96 godt plade med 50 µl belægning reagens, typisk en gelatinøse protein blanding udskilles af Engelbreth-Holm-sværm mus sarkom celler (Se Tabel af materialer).
  3. Adskille et godt af pluripotente stamceller dyrkes i en 6 godt plade ved tilsætning af 1 mL PBS uden Ca2 + og Mg2 + og med 0,5 mM EDTA.
    Bemærk: Dissociation tid varierer fra 3-10 min. Når mere end 80% af cellerne er løsrevet fra bunden af pladen, Fortsæt til næste trin.
  4. Indsamle cellesuspension med steril pipette i 15 mL plastik centrifugerør.
  5. Neutralisere dissociation reagens med 5 mL PBS-holdige Ca2 + og Mg2 +.
  6. Pellet celler ved centrifugering (200 x g i 3 min).
  7. Fjern supernatanten og forsigtigt svirp røret for at løsne pelleten.
  8. Genopslæmmes celler i 1 mL af stamceller medier.
  9. Tælle celler ved hjælp af en automatiseret celle tæller efter kreditor instruktioner.
  10. Plade 20.000 levedygtige celler pr. belagt nå (96-brønd plade) i 50 µL af stamceller media suppleret med 2 µM RHO/ROCK pathway inhibitor (Se tabel 1 og 2).
  11. Efter 24 h, overvåge for celle vedhæftet fil og erstatte medier med 100 µl stamcelle medier suppleret med 2 µM RHO/ROCK pathway inhibitor og 6 ng/mL hexadimethrine bromid (Se tabel 1 og 2), en h før lentiviral infektion.
    Bemærk: Celler skal være solidt fastgjort til bunden af pladen.
  12. Tø Id1-lentivirus på is.
  13. Tilføje 3 µL af renset lentivirus pr. brønd (virus titer bør være mellem 108 109 TU/mL), og derefter overføre pladen tilbage til celle kultur inkubator (37 ° C, 5% CO2, 20% O2).
  14. 24 timer efter virusinfektion, tilføje 100 µL af frisk stamcelle medier til inficerede celler.
  15. 48 timer efter lentiviral infektion, Erstat virus der indeholder medier med 200 µL af frisk stamcelle media suppleret med 1 µg/mL puromycin.
  16. Opdater medier dagligt med 200 µL af stamceller media suppleret med 1 µg/mL puromycin.
  17. Når kulturer nå 80% confluency, adskille celler ved hjælp af 200 µL af PBS uden Ca2 + og Mg2 + + 0,5 mM EDTA (for et godt af en 96-brønd plade).
  18. Indsamle cellesuspension til et centrifugeglas.
  19. Neutralisere dissociation reagens med 5 mL PBS-holdige Ca2 + og Mg2 +.
  20. Pellet celler ved centrifugering (200 x g i 3 min).
  21. Fjern supernatanten og forsigtigt svirp røret for at løsne pelleten.
  22. Genopslæmmes celler i 1 mL af stamceller media suppleret med 2 µM RHO/ROCK pathway inhibitor.
  23. Overføre alle celler (1 mL) til en coated godt af en 12-godt plade.
  24. Efter 24 h, skærm for celle tilknytning til brønden og erstat medierne med 1 mL af stamceller media suppleret med 2 µM RHO/ROCK pathway inhibitor og 6 ng/mL hexadimethrine bromid, én h før transduktion.
  25. Tø Id1-lentivirus på is.
  26. Tilsæt 5 µL af renset virus pr. brønd (12-godt plade).
  27. 24 timer efter lentiviral infektion, Erstat virus der indeholder medier med 1 mL frisk stamcelle media suppleret med 3 µg/mL puromycin.
  28. 48 timer efter lentiviral infektion, erstatte virus der indeholder medier med 1 mL frisk stamcelle media suppleret med 6 µg/mL puromycin.
  29. Når kulturer nå 80% confluency, adskille celler ved hjælp af 500 µL af PBS uden Ca2 + og Mg2 + og med 0,5 mM EDTA (for et godt af en 12-godt plade).
  30. Overføre halvdelen (250 µL) af cellesuspension til et godt en belægning reagens belagt 6-godt plade med 2 mL af stamceller media suppleret med 2 µM RHO/ROCK pathway inhibitor.
  31. Brug anden halvdelen (250 µL) stikprøven for RNA udvinding og qRT-PCR for at bestemme lentiviral-medieret Id1 udtryk niveauer, som i Cola et al. (2012) 4.
    Bemærk: Vigtigt: Hvis Id1 mRNA udtryk niveauer er lavere end 0,005 fold af GAPDH udtryk niveauer (Se tabel 3 for qRT-PCR primere), Gentag infektion proces som beskrevet ovenfor indtil Id1 udtryk niveauerne overstiger den tærskel.

2. hPSCsId1 vedligeholdelse

  1. Kultur hPSCsId1 i coated 6 well-plader og vokse i 3 mL pr. brønd af stamceller media suppleret med 6 µg/mL puromycin.
  2. Når hPSCsId1 nå 80% confluency, passage celler som aggregater (1:6 delingsforholdet) ved hjælp af enzym-fri dissociation reagens efter kreditor retningslinjer og vokse i 3 mL pr. brønd af stamceller media suppleret med 6 µg/mL puromycin.

3. forberedelse af hPSCsId1 differentiering

  1. Coat en 12-godt plade med 500 µL pr. brønd belægning reagens.
  2. Når hPSCsId1 nå 90% confluency adskille celler ved tilsætning af 1 mL PBS uden Ca2 + og Mg2 + og med 0,5 mM EDTA pr. brønd i 5-10 min. Tjek dissociation processen hvert minut, og når 80% af cellerne, der dissocieres fra pladen , videre til næste trin.
  3. Indsamle cellesuspension til et centrifugeglas.
  4. Neutralisere dissociation reagens med 5 mL PBS-holdige Ca2 + og Mg2 +.
  5. Pellet celler ved centrifugering (200 x g i 3 min).
  6. Fjern supernatanten og forsigtigt svirp røret for at løsne pelleten.
  7. Genopslæmmes celler i 2 mL af stamceller media suppleret med 2 µM RHO/ROCK pathway inhibitor.
  8. Tælle celler ved hjælp af en automatiseret celle counter.
  9. Plade 300.000 celler pr. brønd i 1 mL af stamceller media suppleret med 2 µM RHO/ROCK pathway inhibitor og 6 µg/mL puromycin og overførsel plade i vævskultur inkubator.
  10. Opdater medier dagligt med 2 mL af stamceller media suppleret med 6 µg/mL puromycin indtil kulturer nå 90% confluency. På dette tidspunkt indlede hjerte differentiering (næste trin).

4. differentiering af hPSCsId1 første hjertet felt-lignende hjerte stamfaderen (FHF-L CPs)

  1. For 12-godt plade format, indlede differentiering (dag 0) ved at erstatte stamcelle medier med 1,5 mL af induktion medier (tabel 1) suppleret med Activin en (100 ng/mL) (Se tabel 2 for anbefalede mængder og Activin A-koncentrationer forskellige plade formater).
  2. Dag 1 (24 h efter differentiering initieres), skal du erstatte medier med 2 mL af induktion medier uden Activin A (pr. brønd af et 12-godt plade).
  3. På dag 3, erstatte medier med 2 mL af induktion medier uden Activin A (pr. brønd af et 12-godt plade).
  4. På dag 5, indsamle FHF-L CPs for kryopræservering (næste trin).
    Bemærk: Vigtigt: kryopræservering er foretrukne på dette punkt, da det giver mulighed for at koble hjerte stamfader generation fra efterfølgende cardiomyocyte produktion og biobank store partier af celler. Bemærk at alternativt dag 5 FHF-L CPs kan overføres til en frisk belagt plade at fortsætte differentiering, henvises til trinene 5.1-5,5 til passFHF-L CPs og derefter fortsætte til trin 6.5 for differentiering.

5. kryopræservering af FHF-L CPs

  1. Opsug alle medier fra brønde indeholdende dag 5 FHF-L CPs og hurtigt tilsættes 1 mL varm (37 ° C) 1 x enzym-holdige dissociation reagens (Se Tabel af materialer). Læg pladen i vævskultur inkubator.
  2. Efter 1 min, ryste plade side til side i rugemaskinen.
  3. Efter 2 min. (total tid), fjerne pladen fra rugemaskinen og tilsættes 1 mL 10% FBS medier.
  4. Forsigtigt afpipetteres celler op og ned med en 5 mL pipette til lette celle løsrivelse fra pladen.
  5. Indsamle cellesuspension til cellerne en centrifuge tube og pellet ved centrifugering ved 200 x g i 3 min
  6. Genopslæmmes celle pellet i 2 mL af kryopræservering reagens.
  7. Tælle celler ved hjælp af en automatiseret celle counter.
  8. Tilføje kryopræservering reagens (Se Tabel af materialer) på et tilstrækkeligt volumen til cryopreserve celler på ønskede koncentration (typisk 5-10 x 106 celler/mL).
  9. Overfør celler til kryopræservering hætteglas og placere hætteglas i afkøling enhed (1 ° C/min.) og placere afkøling enhed i-80 ° C fryser natten over.
  10. Efter 24 timer, skal du overføre frosne hætteglas til flydende kvælstof til langtidsopbevaring.
    Bemærk: Protokollen kan pause her.

6. FHF-L CP differentiering af ventrikulær-lignende Cardiomyocytes

  1. Overføre dag 5 FHF-L CPs frosne hætteglas fra flydende kvælstof opbevaring i tøris beholder.
  2. Placer hætteglas i 37 ° C vandbad i 2-3 min, indtil cellesuspension er optøet helt.
    Bemærk: Vigtigt: optøningen er tid-følsomme. Udsætter celler til kryopræservering medie til en stor mængde af tid (dvs. 10 min) vil nedsætte cellers levedygtighed.
  3. Overfør celler til 15 eller 50 mL centrifugeglas, afhængigt af antallet af optøede hætteglas.
  4. Dispensere dråbevis (5 dråber hvert 30 sekund) pre varmede (37 ° C) kardiogent medier (tabel 1) til celle løsning. Fortsæt denne proces indtil en 1:3 kryopræservering medier: kardiogent media ratio er nået. På dette punkt, øge kardiogent media tilsætning sats indtil en 1:10 kryopræservering medier: kardiogent media ratio er nået.
    Bemærk: Vigtigt: hurtig osmolaritet ændringer vil øge celledød under optøningen; Derfor, dråbevis tilsætning af kardiogent medier som beskrevet ovenfor er stærkt anbefales.
  5. Der centrifugeres celle suspension og pellet celler ved centrifugering (200 x g i 3 min).
  6. Fjern supernatanten og forsigtigt svirp centrifugeglasset at løsne celle pellet.
  7. Genopslæmmes celler med kardiogent media suppleret med 2 µM RHO/ROCK pathway inhibitor.
    Bemærk: Cellernes levedygtighed kan variere fra tø at tø, og generelt, > 65% levedygtighed forudsiger godt plating effektivitet.
  8. Fortyndet koncentreret cellesuspension med kardiogent media suppleret med 2 µM RHO/ROCK pathway inhibitor at opnå den ønskede celle koncentration for plating (Se tabel 2 for forskellige plade formater).
    Bemærk: Vigtigt: Bemærk at kardiale differentiering effektivitet kan falde hvis cellerne udsås for tyndt.
  9. Frø celler på plade.
  10. Holde plade i vævskultur hood i 20 min. før du overfører det til vævskultur inkubator.
  11. Dag 6 om differentiering, overvåge celle vedhæftet fil.
    Bemærk: Hjerte ophav er befrugtede på dag 5 af differentiering. 24 timer efter optøning af celler ville være på dag 6 i differentiering.
    Bemærk: Tilstedeværelsen af flydende (døde) celler er fælles.
  12. På dag 7, Aspirér 50% af medierne og erstatte med en lige mængde frisk kardiogent medier.
    Bemærk: Tilsætning af RHO/ROCK pathway hæmmer til kardiogent medierne er ikke nødvendigt efter dette punkt.
  13. Erstatte 50% af medierne med kardiogent medierne hver anden dag.
  14. Bemærk spontan slå der vises mellem dag 11 og 13.
  15. På dag 15, kvantificere hjerte differentiering effektivitet ved immunfluorescens ved hjælp af DAPI (nucleus pletten) og ACTC1 (pan-hjerte markør).

7. bestået og vedligeholdelse af ventrikulær-lignende Cardiomyocytes

Bemærk: Dag 14 – 16, en éncellelag af spontant kontraherende ventrikulær-lignende cardiomyocytes skal indhentes. På dette tidspunkt, er det foreslået at løsrive og re plade cardiomyocytes for at homogenisere kultur og forhindre celler fra afmontering fra pladen.

  1. Opsug alle medier fra brønde og hurtigt tilsættes 1 mL af pre varmede (37 ° C) 1 x enzym-holdige dissociation reagens.
    Bemærk: 1 x enzym-holdige dissociation reagens mængder varierer afhængigt af plade format, men skal helt dække bunden af nå overfladen.
  2. Overføre plade i en vævskultur inkubator.
  3. Ryst forsigtigt plade side til side hver 2 min. inde i inkubator at fremskynde detachement.
  4. Efter 5-15 min, når 80-100% af cellerne er løsrevet fra bunden af pladen, fjerne pladen fra rugemaskinen og hæmme 1 x enzym-holdige dissociation reagens aktivitet ved at tilføje et lige saa stort volumen af 10% FBS medier.
    Bemærk: Inkubationstiden med 1 x enzym-holdige dissociation for denne proces vil variere fra batch til batch.
  5. Indsamle cellesuspension til et centrifugeglas.
  6. Bland cellesuspension med pipette og tælle celler ved hjælp af en automatiseret celle counter.
  7. Fortyndet cellesuspension til ønskede celle koncentration (Se tabel 2 for forskellige plade formater) med vedligeholdelse media suppleret med 2 µM RHO/ROCK pathway inhibitor.
  8. Efter såning cardiomyocytes på pladen, distribuere cellerne jævnt og giver mulighed for cellerne til at vedhæfte i 10 – 20 min før du overfører plade til vævskultur inkubator.
  9. 24 timer efter re forkromning, overvåge celle udlæg og nyttiggørelse.
    Bemærk: Tilstedeværelsen af flydende (døde) celler er fælles. 48-72 timer efter re plating, cardiomyocyte bør genoptage spontan sammentrækning.
  10. For at opretholde cardiomyocyte kultur, erstatte 50% af medierne med vedligeholdelse medierne hver anden dag indtil brugen af ventrikulær-lignende cardiomyocytes for efterfølgende forsøg.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Generation af hPSCs Id1 linjer
hPSCs er inficeret med en lentivirus mægle Id1 overekspression (fig. 1A). Når hPSCId1 genereres, kvantificeres transgen udtryk af qRT-PCR (figur 1B). Kun hPSCId1 linjer udtrykker Id1 mRNA på niveauer større end 0,005 fold af af GAPDH bør anvendes til differentiering.

hPSCs Id1 Vedligeholdelse og forberedelse til D ifferentiation
Optimal dyrkningsbetingelserne er nødvendig og afgørende for vellykket første hjerte felt-lignende hjerte stamfader differentiering (fig. 2A). hPSCId1 kulturer bør overvåges dagligt for stilk morfologi vedligeholdelse og kontinuerlig spredning. Differentiering bør iværksættes når tætpakkede stamcelle kolonier > 90% confluency (figur 2B). Hvis differentiering er indledt før optimale confluency, celledød er forbedret og differentiering effektivitet kan afslå (figur 2C). På samme måde, tilgroede kulturer vil udføre dårligt (figur 2D).

Generation af første hjertet felt-lignende hjerte stamfaderen (FHF-L CPs) fra hPSCs Id1
Dag 1 (24 h post differentiering indledning), bør celler overvåges for at observere tab af stilken morfologi (celler vises fladere og mørkere end stamceller). Bemærk, at celledød er fælles i løbet af den første dag af differentiering, men celle sammenløbet bør opretholdes på > 75% (figur 2E). Hvis efter 24t af differentiering, 50% eller mere af det dækkede areal er tabt, skal celler kasseres.

På dag 3, differentiering celler bør forblive grupperet og har fyldt huller skabt under den indledende 24 h tidsperiode (figur 2F). Flade celler vokser uafhængigt er vejledende for suboptimal differentiering betingelser.

Dag 4, bør optimal differentiering vise fortsatte ekspansion og dækning af pladen.

På dag 5, er celler høstet og befrugtede. Optimal differentieringer bør resultere i tæt forbundne celle klynger med homogene morfologi udseende (fig. 2G). Bemærk at lavdensitet klynger af flade celler markeres en suboptimal differentiering resultatet. Se tabel 2 for det gennemsnitlige udbytte af dagen 5 hjerte stamfaderen pr. brønd i forskellige kultur formater.

Generation af ventrikulær-lignende Cardiomyocytes fra FHF-L CPs
Dag 5 FHF-L CPs er optøet på plade format-afhængige tætheder beskrevet i tabel 2, for at maksimere deres hjerte differentiering potentielle (fig. 3A og tabel 2). Levedygtighed efter optøning skal overvåges. Generelt, levedygtighed spænder fra 70-80%. Hvis levedygtighed er under 60%, ville udbytte af cardiomyocytes blive berørt.

Dag 6 (24 h efter genoptage differentiering), FHF-L CPs bør dække > 90% af det tilgængelige areal og vises som en homogen enkelt lag af celler (fig. 3B). Lav sammenløbet på dag 6 vil reducere FHF-L CPs differentiering i cardiomyocytes.

Resulterende cardiomyocytes begynde at slå af dag 11-13 af differentiering (figur 3C og film 1). I dag 14 – 16 replating processen, se tabel 2 for det gennemsnitlige udbytte af cardiomyocytes pr. brønd i forskellige kultur formater. Differentiering effektivitet vurderes typisk ved immunfluorescens for hjertestop (ACTC1), fibroblast (TAGLN) og vaskulære endotel markører (CDH5) og nukleare (DAPI) markører. Lineage kvantificering udføres ved hjælp af automatiseret billedbehandling og fluorescens kvantificering, som i Cunningham et al. (2017) 5 (figur 3D-E). Undertype karakterisering af resulterende cardiomyocytes er udført af qRT-PCR (figur 3F) og aktionspotentialet forbigående analyse ved hjælp af kinetic imaging og spænding sensing sonder (figur 3G og Movie 2). Fluorescens kvantificering for spænding sonde og deraf følgende aktionspotentialet trace analyse (figur 3H) udføres som beskrevet i McKeithan et al. (2017) 7.

Figure 1
Figur 1: Generation af hPSCId1 linjer. (A) skematisk repræsentation af hPSCsId1 generation protokol. (B) eksempler på qRT-PCR resultater viser repræsentative Id1 mRNA niveauer genereres af lentiviral-medieret udtryk fra forskellige linjer af hPSCId1 herunder én menneskelige stamceller linje og to linjer af hPSC linjer. Stiplet linje repræsenterer Id1 udtryk tærskel, under hvilken hPSCId1 linjer skal gennemgå en supplerende cyklus af Id1-lentivirus infektion. "p" angiver passage. Tallet i parentes angiver antallet af runder af Id1-lentiviral infektion. Fejllinjer udgør standardafvigelsen af eksperimenter udført i tre eksemplarer. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: Generation af første hjerte Field-Like hjerte stamfaderen (FHF-L CPs) differentiering fra hPSCId1. (A) skematisk gengivelse af FHF-L CP generation protokol. Repræsentative lysfelt billeder af hPSCId1 (dag 0) på optimal (B), sub sammenflydende (gul pilespidser angive void Regionsudvalget mellem cellerne) (C) og overdreven sammenflydende (D) tætheder. Repræsentative lysfelt billeder af at differentiere hPSCId1 på dag 1, 3 og 5 henholdsvis (E), (F), (G). Skalalinjen = 100 µm. venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: Generation af ventrikulær-lignende Cardiomyocyte fra FHF-L CPs. (A) Skematisk fremstilling af den ventrikulære-lignende cardiomyocyte generation protokol. (B) lysfelt billede af dag 6 differentiering celler (en dag efter optøning). (C) lysfelt billede af en dag 12 slå kultur. (D) repræsentative immunofluorescens billede af day 15 kulturer (384-godt plade format). ACTC1 markerer cardiomyocytes, TAGLN: fibroblaster/glat muskulatur, CDH5: vaskulære endotel celler og DAPI: kerner (vist i indsatsen). (E) Lineage kvantificering i dag 15 kulturer. (F) qRT-PCR data gang kursus udtryk fra dag 5 dag 25 af ventrikulær-specifikke markører (IRX4 og MYL2) og pan-hjerte markør (MYL7). (G) repræsentative aktionspotentialet spor fra ventrikulær-lignende cardiomyocytes på dag 25 af differentiering. (H) aktionspotentialet varighed målinger (APD50 og APD90) af resulterende ventrikulær-lignende cardiomyocytes (n = 12). Fejllinjer udgør standardafvigelsen af eksperimenter udført i fire eksemplarer (medmindre andet er angivet). Skalere barer = 100 µm. RFU, relative fluorescens enhed. Venligst klik her for at se en større version af dette tal.

Medium Base medium Tilsætningsstof
Stem Cell Media mTesR1 Nielsen
Induktion medier RPMI 1640 Medium B-27 serumfrit tillæg uden insulin, 1 x
Induktion medier RPMI 1640 Medium Puromycin, 6 µg/ml
Induktion medier RPMI 1640 Medium Penicillin-Streptomycin, 1 x
Kardiogent medier RPMI 1640 Medium B-27 serumfrit Supplement, 1 x
Kardiogent medier RPMI 1640 Medium Penicillin-Streptomycin, 1 x
Vedligeholdelse medier RPMI 1640 Medium B-27 serumfrit Supplement, 1 x
Vedligeholdelse medier RPMI 1640 Medium KnockOut Serum udskiftning, 2%
Vedligeholdelse medier RPMI 1640 Medium Penicillin-Streptomycin, 1 x

Tabel 1: Medier komponenter (se tabel af materialer til base media og additiver).

384 godt 96 godt 12 godt 6 godt 100 mm 150 mm
Belægning volumen (pr. brønd) 10 ΜL 50 ΜL 500 ΜL 1 mL 5 mL 10 mL
Medium volumen
(pr. brønd)
100 ΜL 300 ΜL 2 mL 5 mL 12 mL 30 mL
Differentiering dag 0 activin koncentration (ng/mL) 100 100 100 300
Hjerte stamfader
dag 5 udbytte
(celler/brønd)
1.0-1.2 x 105 2,5-3,0 x 105 1,0-1,5 x 107 2,0-3,0 x 107
Hjerte stamfader dag 5 replating eller optøning tæthed (celler/brønd) 2.0 x 104 7.5 x 105 4.5 x 106 8.0 x 106 2.2 x 107
Ventrikulær-lignende cardiomyocyte
dag 14 – 16 udbytte
(celler/brønd)
2,0-5,0 x 104 0,8-1,2 x 106 3,5-5,0 x 106 0,8-1,2 x 107 1,8-2,5 x 107
Ventrikulær-lignende cardiomyocyte replating tæthed
(celler/brønd)
2.5 x 104 1,0 x 106 4.5 x 106 1,0 x 107 2.2 x 107

Tabel 2: Skalerbare differentiering parametre (belægning volumen, medium volumen, Activin A koncentration, udbytter, replating tætheder).

Gen navn Genbank tiltrædelse Sekvens
GAPDH NM_001256799 F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
musen Id1 NM_010495 F: CCTAGCTGTTCGCTGAAGGC
R: CTCCGACAGACCAAGTACCAC
IRX4 NM_016358 F: GGCTCCCCAGTTCTTGATGG
R: TAGACCGGGCAGTAGACCG
MYL2 NM_000432 F: TTGGGCGAGTGAACGTGAAAA
R: CCGAACGTAATCAGCCTTCAG
MYL7 NM_021223 F: GCCCAACGTGGTTCTTCCAA
R: CTCCTCCTCTGGGACACTC

Tabel 3: qRT-PCR primer sekvenser.

Movie 1
Movie 1: lysfelt optagelse (100 rammer/s) i dag 15 cardiomyocytes hvor spontane veer kan observeres. Venligst klik her for at se denne video. (Højreklik for at hente.)

Movie 2
Movie 2: Kinetic billeddannelse (100 rammer/s) af spænding-følsomme fluorescerende sonden i dag 25 id1-induceret ventrikulær-lignende cardiomyocytes. Venligst klik her for at se denne video. (Højreklik for at hente.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

For vellykket differentieringer, Sørg for at nøje følge vejledningen ovenfor. Derudover fremhæve her vi nøgleparametre, der kraftigt påvirker differentiering resultater. Før du starter en differentiering, bemærkes følgende tre morfologiske parametre: en stilk morfologi af hPSCsId1, en høj cellulære jordpakning og en høj sammenløbet (> 90%) af kultur på dag 0. I henseende, optimal differentiering betingelser er bedst lavet af plating adskilles hPSCsId1 som enkelt celler og at tillade dem at form stramt grupperet encellelag, der vokser til ~ 90% sammenløbet i løbet af 2 til 3 dage. Omvendt, hvis hPSCId1 kulturer viser dårlig celle og koloni morfologi, lav koloni jordpakning og tilstedeværelsen af store områder af differentiering inden for kultur, vellykket FHF-L CP differentiering er usandsynligt.

Media volumen og Activin A koncentrationerne er kritiske parametre af FHF-L CP differentiering og plade format-afhængige (Se tabel 2). Bemærk også, at optimal Activin A koncentrationer kan variere afhængigt af brugte hPSC linje og kan kræve koncentration optimering.

Id1 mRNA niveau i hPSCs er af afgørende betydning, at effektivt fremme FHF-L CP. Suboptimal Id1 niveauer vil undlade at producere robust FHF-L CP differentiering og massiv celledød af dag 1 af differentiering vil observeres. Relative udtryk forholdet mellem Id1- til -GAPDH skal overstiger 0,005 for at fremme effektiv differentiering. Fortsatte markering med højere doser af puromycin (6-10 µg/mL) anbefales for at opretholde høje niveauer af lentiviral-medieret Id1 udtryk. En evaluering af Id1 mRNA niveauer hver 10 passager anbefales.

Plating tætheder på dag 5 FHF-L CPsis også en afgørende parameter for kardiale differentiering effektivitet. Hvis dag 5 FHF-L CPs er belagt ved lav tætheder, den relative hjerte udbytte vil falde. Optimal plating tætheder er angivet i tabel 2 og er pladen format-afhængige.

Den største begrænsning for denne protokol er brugen af lentiviral-medieret Id1 overekspression til promoteFHF-L CP differentiering, der kan begrænse den terapeutiske anvendelse af resulterende ophav og ventrikel-lignende cardiomyocytes. Også, da lentiviruses kan integrere på websteder at kunne potentielt påvirke hPSC vedligeholdelse og/eller udviklingsmæssige potentiale, stemness af hPSCsId1 kolonier bør overvåges ved at evaluere stem genekspression og observere morfologiske tegn på differentiering. Bemærk at overekspression Id1 ved hjælp af ikke-Integrativ vektorer ville overvinde denne begrænsning og er i øjeblikket ved at blive undersøgt i vores laboratorium.

En praktisk funktion af denne metode er enkelheden af differentiering protokol som det kræver kun en cytokin, Activin A, til at generere FHF-L CPs fra hPSCsId1. I sammenligning, andre protokoller 9,10,11,12,13,14,15 kræver komplekse sekvenser af kombinationer af cytokiner og/eller små molekyler for at fremme og opretholde hjertets differentiering. Derudover beskriver denne protokol entydigt en bekvem kryopræservering trin, som gør det muligt for at koble FHF-L CP generation fra efterfølgende cardiomyocyte produktion. Denne funktion gør det muligt at biobank store partier af FHF-L CPs og til hurtigt at generere cardiomyocytes fra frosne progenitorceller, som hjerte differentiering genoptager fra dag 5 efter optøning. Denne strategi giver mulighed for at få 1 til 2 uger af tid i forhold til start hjerte differentiering fra hPSCs. Desuden, og vigtigst af alt, er denne protokol den første protokol til dato for at generere hjerte stamfaderen til definerede hjerte felt oprindelse, mens andre protokoller9,10,11,12 ,13,14,15 forblive udefineret i denne henseende.

I Resumé, denne protokol skitserer en robust og skalerbar metode til at producere store mængder (> 108– 109) af udviklingshæmmede relevante FHF-L CPs og ventrikel-lignende cardiomyocytes. Til gengæld resulterende celler kan bruges til at identificere nye lovgivningsmæssige veje kontrollerende hjerte differentiering og fysiologi, og for regenerativ og sygdom modelleringsformål.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Vi takke medlemmerne af Cola lab for nyttige diskussioner og kritiske anmeldelser af manuskriptet. Denne undersøgelse blev støttet af NIH/NIEHS R44ES023521-02 og CIRM Disk2-10110 tilskud til Dr. Colas.

Materials

Name Company Catalog Number Comments
ACTC1 antibody Sigma A7811
Activin A Stem Cell Technologies Hu Recom Activin A
Antibiotic Antimycotic (Anti-Anti) Thermo Fisher Scientific 15240062
B27 supplement Thermo Fisher Scientific 17504044
B27 supplement w/o - insulin Thermo Fisher Scientific A1895601
B27 supplement w/o - vitamin A Thermo Fisher Scientific 12587001
CDH5 antibody R&D Systems AF938
CryoStor CS10 Stem Cell Technologies 7930 Cryopreservation reagent
DMEM high Glucose Mediatech 10-013-CV 
DPBS w/ Ca & Mg Corning 21-030-CV
EDTA Thermo Fisher Scientific 15575-038
FBS VWR 89510-186
FluoVolt membrane potential kit   Thermo Fisher Scientific F10488 For optical action potential acquisition, please refer to McKeithan et al. 2017
KnockOut Serum Replacement Gibco 10828010
Matrigel, Growth Factor Reduced Corning 356231 Coating reagent
mTeSR1 media kit Stem Cell Technologies 5850
PBS w/o Ca & Mg Corning 21-040-CV
Penicillin-Streptomycin Gibco
Puromycin  Acros 227422500
ReLeSR Stem Cell Technologies 5872 Enzyme-free dissociation reagent
RPMI 1640 Thermo Fisher Scientific 11875-093
TAGLN antibody Abcam ab14106
Thiazovivin Stem Cell Technologies 72254 RHO/ROCK pathway inhibitor
TrypLE Express Thermo Fisher Scientific 12605 -010 1X enzyme-containing dissociation reagent
Tyrodes solution mix packets   Sigma T2145-10X1L (For optical action potential acquisition, please refer to McKeithan et al. 2017)

DOWNLOAD MATERIALS LIST

References

  1. Chong, J. J., et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature. 510, 273-277 (2014).
  2. Kodo, K., et al. iPSC-derived cardiomyocytes reveal abnormal TGF-beta signalling in left ventricular non-compaction cardiomyopathy. Nature cell biology. 18, 1031-1042 (2016).
  3. Kim, C., et al. Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs. Nature. 494, 105-110 (2013).
  4. Colas, A. R., et al. Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis. Genes & development. 26, 2567-2579 (2012).
  5. Cunningham, T. J., et al. Id genes are essential for early heart formation. Genes & development. (2017).
  6. McKeithan, W. L., Colas, A. R., Bushway, P. J., Ray, S., Mercola, M. Serum-free generation of multipotent mesoderm (Kdr+) progenitor cells in mouse embryonic stem cells for functional genomics screening. Current protocols in stem cell biology. Chapter 1, Unit 1F 13 (2012).
  7. McKeithan, W. L., et al. An automated platform for assessment of congenital and drug-induced arrhythmia with hipsc-derived cardiomyocytes. Frontiers in physiology. 8, 766 (2017).
  8. Sharma, A., et al. High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells. Science translational medicine. 9, (2017).
  9. Burridge, P. W., et al. Chemically defined generation of human cardiomyocytes. Nature methods. 11, 855-860 (2014).
  10. Kattman, S. J., et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell. 8, 228-240 (2011).
  11. Laflamme, M. A., et al. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nature biotechnology. 25, 1015-1024 (2007).
  12. Lian, X., et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America. 109, 1848-1857 (2012).
  13. Willems, E., et al. Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells. Cell stem cell. 11, 242-252 (2012).
  14. Yang, L., et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature. 453, 524-528 (2008).
  15. Palpant, N. J., et al. Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nature protocols. 12, 15-31 (2017).
  16. DeLaughter, D. M., et al. Single-cell resolution of temporal gene expression during heart development. Developmental cell. 39, 480-490 (2016).
  17. Liu, X., et al. The complex genetics of hypoplastic left heart syndrome. Nature genetics. 49, 1152-1159 (2017).
  18. Corrado, D., Link, M. S., Calkins, H. Arrhythmogenic right ventricular cardiomyopathy. New England journal of medicine. 376, 1489-1490 (2017).
  19. Kitamura, T., et al. Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Experimental hematology. 31, 1007-1014 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics