Generation der ersten Herz Bereich-wie kardiale Stammväter und ventrikuläre wie Herzzellen aus menschlicher pluripotenter Stammzellen

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier beschreiben wir eine skalierbare Methode mit einer einfachen Kombination von Activin A und Lentivirus-vermittelten Id1-Überexpression, erste Herz Bereich-wie kardiale Stammväter und ventrikuläre wie Herzzellen aus menschlichen pluripotenten Stammzellen zu generieren.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Yu, M. S., Spiering, S., Colas, A. R. Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells. J. Vis. Exp. (136), e57688, doi:10.3791/57688 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Die Generation der große Mengen von funktionalen menschlicher pluripotenter Stammzellen gewonnen kardiale Stammväter und Herzzellen definierten Herz Bereich Ursprungs ist eine wichtige Voraussetzung für kardiale Zelltherapien und Krankheit Modellierung. Wir haben kürzlich gezeigt, dass Id Gene notwendig und ausreichend, um erste Herz Bereich Vorfahren während der vertebrate Entwicklung angeben. Diese Differenzierung-Protokoll nutzt diese Erkenntnisse und nutzt Id1 Überexpression in Kombination mit Activin A als potente Angabe Hinweise, um erste Herz Bereich-wie (FHF-L) Vorfahren zu produzieren. Wichtig ist, differenzieren resultierende Stammväter ventrikuläre wie Kardiomyozyten effizient (~ 70 – 90 %). Hier beschreiben wir eine detaillierte Methode, um (1) erzeugen Id1-überexprimierenden hPSCs und (2) skalierbare Mengen an cryopreservable FHF-L Stammväter und ventrikuläre wie Kardiomyozyten differenzieren.

Introduction

Produktion in großem Maßstab menschlicher pluripotenter Stammzellen (hPSCs)-abgeleitete kardialen Vorläuferzellen und Herzzellen ist eine wichtige Voraussetzung für stammzellbasierte Therapien1, Modellierung,2,3 und die schnelle Charakterisierung der Krankheit neuartige Wege zur Regulierung kardialen Differenzierung4,5,6 und Physiologie7,8. Obwohl eine Reihe von Studien9,10,11,12,13,14haben,15 zuvor beschriebenen hocheffiziente kardialen Differenzierung Protokolle von hPSCs, hat keiner den Herzen Feld Ursprung des daraus resultierenden Kardiomyozyten, trotz der Identifizierung von molekularen Unterschiede zwischen Links angesprochen (erste Herz-Feld) und rechts (zweites Herz-Feld) ventrikuläre Kardiomyozyten16 und die Existenz von Herzen feldspezifischen angeborene Herzerkrankungen; d. h. hypoplastischen Linksherz-Syndrom17 oder Arrhythmogenic rechtsventrikuläre Dysplasie18. So, die Generation der kardialen Vorläuferzellen und Herzzellen definierten Herz Feld Herkunft aus hPSCs werden immer eine Notwendigkeit, um ihre Relevanz als therapeutische zu erhöhen und Krankheiten Modellierungs-Tools.

Dieses Protokoll setzt auf die konstitutive Überexpression des Id1, ein neu identifizierte5 erste Herz Feld angeben Stichwort, das in Kombination mit Activin A, notwendig und ausreichend, um Cardiogenesis in hPSCs zu initiieren. Vor allem, Cunningham Et al. (2017) 5 zeigen, dass Id1-induzierte Stammväter speziell erste Herz-Feld (HCN4, TBX5) aber keine zweite Herz Feldmarken (SIX2, ISL1) Ausdrücken, wie sie kardialen Differenzierung zu unterziehen. Darüber hinaus zeigen die Autoren auch, dass transgene mausembryonen fehlt die ganze Id -Familie von Genen (Id1-4), zu entwickeln, ohne zu bilden erste Herz Bereich kardiale Stammväter, während mehr medialen und hinteren kardialen Vorläuferzellen ( zweites Herz-Feld) kann noch bilden, was darauf hindeutet, dass Id Proteine wichtig sind, erste Herz Feld Cardiogenesis in Vivozu initiieren. Bequem, Id1-induzierte Stammväter können kryokonserviert und spontan in Kardiomyozyten anzeigen ventrikuläre-ähnliche Merkmale, einschließlich der ventrikulären-spezifische Marker (IRX4, MYL2) Ausdruck zu unterscheiden und ventrikuläre wie Aktionspotentiale.

Hier beschreiben wir eine einfache und skalierbare Methode erste Herz Bereich-wie (FHF-L) kardiale Stammväter und ventrikuläre wie Herzzellen von Id1 überexprimierenden hPSCs zu erzeugen. Ein wichtiges Merkmal dieses Protokolls ist die Möglichkeit zur Erzeugung von kardialen Vorläuferzellen aus nachfolgenden Cardiomyocyte Produktion mit einer bequemen Kryokonservierung Schritt zu entkoppeln. Zusammenfassend lässt sich sagen dieses Protokoll beschreibt die notwendigen Schritte (1) generieren Id1-überexprimierenden hPSCs, (2) generieren FHF-L kardialen Vorläuferzellen aus hPSCs, (3) resultierende Stammväter Tiefgefrieren und (4) wieder aufnehmen FHF-L kardialen Vorläuferzellen Differenzierung und generieren hochangereichertes (> 70 – 90 %) gegen ventrikuläre wie Kardiomyozyten.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

(1) Id1 Virus Vorbereitung und Infektion

  1. Id1 überexprimierenden Lentivirus Co transfecting pCMVDR8.74, pMD2.G und pCDH-EF1-Id1-PGK-PuroR zu generieren (Addgene: Plasmid #107735) in HEK293T Zellen. Viruspartikel zu sammeln, Filtrat aus der Überstand zu reinigen und lagern bei-80 ° C wie Kitamura Et al. (2003) 19. Alternativ produzieren Id1 Lentivirus kommerziell durch pCDH-EF1-Id1-PGK-PuroR an einen Lentivirus produzierenden Lieferanten senden.
    Achtung: Bitte folgen Sie Lentivirale Sicherheitsvorschriften und Standardbetrieb Protokolle.
    Hinweis: Wichtig: optimale Virustiter sollte mindestens 108 109 Transducing Einheiten/mL (TU/mL).
  2. Vor der Infektion Mantel einen Brunnen von einer 96-well-Platte mit 50 µl Reagenz Beschichtung, in der Regel eine gallertartige Proteinmischung sezerniert Engelbreth-Holm-Schwarm Sarkom Mauszellen (siehe Tabelle der Materialien).
  3. Einen Brunnen von pluripotenten Stammzellen gewachsen in einem 6-well-Platte durch Zugabe von 1 mL PBS ohne Ca2 + und Mg2 + und mit 0,5 mM EDTA zu distanzieren.
    Hinweis: Dissoziation Zeit variiert von 3 – 10 Minuten. Wenn Sie mehr als 80 % der Zellen von der Unterseite der Platte abgenommen sind, fahren Sie mit nächsten Schritt.
  4. In Kunststoff Zentrifugenröhrchen 15 mL sammeln Sie Zellsuspension mit sterilen pipettieren.
  5. Dissoziation-Reagenz mit 5 mL PBS-haltigen Ca2 + und Mg2 +zu neutralisieren.
  6. Pellet-Zellen durch Zentrifugation (200 X g für 3 min).
  7. Entfernen Sie überstand und streichen Sie sanft das Rohr um die Pellets zu verdrängen.
  8. Wieder aussetzen Sie Zellen in 1 mL der Stammzell-Medien.
  9. Zählen der Zellen mittels eines automatisierten Zelle Zählers Hersteller befolgen.
  10. Platte 20.000 lebensfähige Zellen pro Brunnen (96-Well-Platte) in 50 µL der Stammzelle Medien ergänzt mit 2 µM RHO/ROCK Pathway Inhibitor beschichtet (siehe Tabellen 1 und 2).
  11. Nach 24 Stunden Überwachung für Zellhaftung und Medien mit 100 µl Stammzell-Media ergänzt mit 2 µM RHO/ROCK Pathway Inhibitor und 6 ng/mL Hexadimethrine Bromid zu ersetzen (siehe Tabellen 1 und 2), 1 h vor der Lentivirale Infektion.
    Hinweis: Zellen sollten fest an der Unterseite der Platte angebracht werden.
  12. Id1-Lentivirus auf Eis Auftauen.
  13. Fügen Sie 3 µL des gereinigten Lentivirus pro Bohrloch (Virustiter sollte zwischen 108 bis 109 TU/mL), und übertragen Sie dann die Platte wieder auf Zelle Kultur Inkubator (37 ° C, 5 % CO2, 20 % O2).
  14. 24 h Post-virale Infektion, infizierte Zellen 100 µL der frischen Stammzellen Medien hinzufügen.
  15. 48 h nach dem Lentivirale Infektion, ersetzen Virus mit Medien mit 200 µL der frischen Stammzellen Medien mit 1 µg/mL Puromycin ergänzt.
  16. Aktualisieren Sie die Medien täglich mit 200 µL der Stammzell-Medien mit 1 µg/mL Puromycin ergänzt.
  17. Wenn Kulturen 80 % Konfluenz erreichen, distanzieren Sie Zellen mit 200 µL PBS ohne Ca2 + und Mg2 + + 0,5 mM EDTA (für einen Brunnen einer 96-Well-Platte).
  18. Sammeln Sie Zellsuspension in ein Zentrifugenröhrchen.
  19. Dissoziation-Reagenz mit 5 mL PBS-haltigen Ca2 + und Mg2 +zu neutralisieren.
  20. Pellet-Zellen durch Zentrifugation (200 X g für 3 min).
  21. Entfernen Sie überstand und streichen Sie sanft das Rohr um die Pellets zu verdrängen.
  22. Wieder aussetzen Sie Zellen in 1 mL der Stammzell-Medien mit 2 µM RHO/ROCK Pathway Inhibitor ergänzt.
  23. Übertragen Sie alle Zellen (1 mL) auf eine beschichtete gut von einem 12-Well-Platte.
  24. Nach 24 h Monitor zur Zelle Befestigung an den Brunnen und ersetzen Medien mit 1 mL der Stammzell-Medien mit 2 µM RHO/ROCK Pathway Inhibitor und 6 ng/mL Hexadimethrine Bromid, ein h vor Transduktion ergänzt.
  25. Id1-Lentivirus auf Eis Auftauen.
  26. Fügen Sie 5 µL des gereinigten Virus pro Bohrloch (12-Well-Platte).
  27. 24 h nach dem Lentivirale Infektion, ersetzen Virus mit Medien mit 1 mL frische Stammzellen Medien mit 3 µg/mL Puromycin ergänzt.
  28. 48 h post Lentivirale Infektion, Virus, enthält Medien mit 1 mL frische Stammzellen Medien ergänzt mit 6 µg/mL Puromycin zu ersetzen.
  29. Wenn Kulturen 80 % Konfluenz erreichen, distanzieren Sie Zellen mit 500 µL PBS ohne Ca2 + und Mg2 + und mit 0,5 mM EDTA (für einen Brunnen von einem 12-Well-Platte).
  30. Die Hälfte zu übertragen (250 µL) die Zellsuspension zu einem Brunnen eines Reagenzes Beschichtung beschichtet 6-Well-Platte mit 2 mL der Stammzell-Medien mit 2 µM RHO/ROCK Pathway Inhibitor ergänzt.
  31. Verwenden Sie die andere Hälfte (250 µL) der Probe für die RNA-Extraktion und qRT-PCR um festzustellen, Lentivirale-vermittelten Id1 Ausdruck Niveau wie Colas Et Al. (2012) 4.
    Hinweis: Wichtig: Wenn Id1 mRNA Ausdruck Niveaus niedriger als 0,005 Falte des GAPDH Ausdruck Niveaus (siehe Tabelle 3 qRT-PCR-Primer), wiederholen Sie Infektion wie oben beschrieben, bis Id1 Ausdruck überschreitet die Schwelle.

2. hPSCsId1 -Wartung

  1. Kultur hPSCsId1 in beschichteten 6 Well-Platten und wachsen in 3 mL pro Bohrloch Stammzell-Medien mit 6 µg/mL Puromycin ergänzt.
  2. Wenn hPSCsId1 erreichen 80 % Konfluenz Durchgang Zellen als Zuschlagstoffe (Split im Verhältnis 1:6) mittels enzymfreien Dissoziation Reagenz nach Hersteller-Richtlinien und wachsen in 3 mL pro Bohrloch Stammzell-Medien mit 6 µg/mL Puromycin ergänzt.

3. Vorbereitung des hPSCsId1 zur Differenzierung

  1. Eine 12-Well-Platte mit 500 µL pro Bohrloch Beschichtung Reagenz zu beschichten.
  2. Wenn hPSCsId1 erreichen 90 % Konfluenz Zellen zu trennen, durch Zugabe von 1 mL PBS ohne Ca2 + und Mg2 + und mit 0,5 mM EDTA pro Bohrloch für 5 – 10 min. Dissoziation Prozess überprüfen Sie jede Minute, und einmal 80 % der Zellen sind getrennt von der Platte , mit dem nächsten Schritt fortfahren.
  3. Sammeln Sie Zellsuspension in ein Zentrifugenröhrchen.
  4. Dissoziation-Reagenz mit 5 mL PBS-haltigen Ca2 + und Mg2 +zu neutralisieren.
  5. Pellet-Zellen durch Zentrifugation (200 X g für 3 min).
  6. Entfernen Sie überstand und streichen Sie sanft das Rohr um die Pellets zu verdrängen.
  7. Wieder aussetzen Sie Zellen in 2 mL Stammzell-Medien mit 2 µM RHO/ROCK Pathway Inhibitor ergänzt.
  8. Anzahl Zellen mit einem automatisierten Zelle Zähler.
  9. Platte 300.000 Zellen pro Bohrloch in 1 mL der Stammzell-Medien in Gewebekultur Inkubator mit 2 µM RHO/ROCK Pathway Inhibitor und 6 µg/mL Puromycin und Übergabeplatte ergänzt.
  10. Medien täglich mit 2 mL der Stammzell-Medien mit 6 µg/mL Puromycin ergänzt, bis Kulturen 90 % Konfluenz erreichen zu aktualisieren. Zu diesem Zeitpunkt initiieren kardialen Differenzierung (nächster Schritt).

4. Differenzierung der hPSCsId1 in ersten Herz Bereich-wie kardiale Stammväter (FHF-L CPs)

  1. Für 12-Well-Plattenformat, initiieren Differenzierung (Tag 0) indem Stammzell-Medien mit 1,5 mL Induktion Medien (Tabelle 1) ergänzt mit Activin ein (100 ng/mL) (siehe Tabelle 2 für Empfohlene Mengen und Activin A Konzentrationen für verschiedene Plattenformate).
  2. Am Tag 1 (24 h nach Differenzierung eingeleitet wird) ersetzen Sie Medien mit 2 mL Induktion Medien ohne Activin A (pro Bohrloch einer 12-Well-Platte).
  3. Am 3. Tag erneuern Sie Medien mit 2 mL Induktion Medien ohne Activin A (pro Bohrloch einer 12-Well-Platte).
  4. Am 5. Tag sammeln FHF-L CPs für die Kryokonservierung (nächster Schritt).
    Hinweis: Wichtig: Kryokonservierung wird an dieser Stelle bevorzugt, da es ermöglicht, um kardialen Vorläuferzellen Generation von nachfolgenden Cardiomyocyte Produktion und Biobank große Chargen von Zellen zu entkoppeln. Beachten Sie, dass alternativ 5.Tag FHF-L CPs können an einer frisch beschichtete Platte Differenzierung fortzusetzen, verweisen wir auf die Schritte 5.1-5.5, PassFHF-L CPs und gehen dann zu Schritt 6.5 für Differenzierung übergeben werden.

5. die Kryokonservierung von FHF-L CPs

  1. Aspirieren Sie alle Medien aus Brunnen mit 5.Tag FHF-L CPs und schnell 1 mL Warm (37 ° C) 1 x enzymhaltigen Dissoziation Reagenz (siehe Tabelle der Materialien). Legen Sie die Platte in der Gewebekultur-Inkubator.
  2. Nach 1 min schütteln Sie Platte seitlich im Inkubator.
  3. Entfernen Sie nach 2 min (Gesamtzeit) die Platte aus dem Inkubator und 1 mL 10 % FBS Medien.
  4. Sanft pipettieren Zellen oben und unten mit einer 5 mL pipettieren Zelle Loslösung von der Platte zu erleichtern.
  5. Sammeln Sie Zellsuspension auf eine Zentrifuge Rohr- und Pellet-Zellen durch Zentrifugation bei 200 X g für 3 min
  6. Wieder auszusetzen Sie Zelle Pellet in 2 mL Reagenz Kryokonservierung.
  7. Anzahl Zellen mit einem automatisierten Zelle Zähler.
  8. Kryokonservierung Reagenz hinzufügen (siehe Tabelle der Materialien) in ausreichender Menge zum Tiefgefrieren Zellen bei gewünschten Konzentration (in der Regel 5 – 10 x 106 Zellen/mL).
  9. Zellen zur Kryokonservierung Ampullen und platzieren Sie Fläschchen im Kühlgerät (1 ° C/min) zu und Kühleinrichtung im-80 ° C Gefrierschrank über Nacht.
  10. Nach 24 h transfer gefrorenen Fläschchen zu flüssigem Stickstoff für langfristige Lagerung.
    Hinweis: Das Protokoll kann hier angehalten werden.

6. FHF-L CP Differenzierung in ventrikuläre wie Kardiomyozyten

  1. Übertragen Sie 5.Tag FHF-L CPs eingefroren Fläschchen von flüssigem Stickstoff Lagerung in Trockeneis Behälter.
  2. Legen Sie Fläschchen in 37 ° C Wasserbad für 2-3 min, bis Zellsuspension vollständig aufgetaut ist.
    Hinweis: Wichtig: das Auftauen ist zeitkritisch. Verfügbarmachen von Zellen für die Kryokonservierung Medien für ein Übermaß an Zeit (z.B. 10 min) Zellviabilität zu verringern.
  3. Übertragen Sie Zellen auf 15 oder 50 mL Zentrifugenröhrchen, abhängig von der Anzahl der aufgetauten Fläschchen.
  4. Tropfenweise (5 Tropfen alle 30 Sekunden) vorgewärmt (37 ° C) kardiogenen Medien (Tabelle 1) Zelle Lösung zu verzichten. Wiederholen Sie diesen Vorgang bis zu einer 1:3 Kryokonservierung Medien: kardiogener Medien-Verhältnis erreicht ist. An diesem Punkt erhöhen die kardiogenen Medien zusätzlich Rate bis eine 01:10 Kryokonservierung Medien: kardiogener Medien-Verhältnis erreicht ist.
    Hinweis: Wichtig: schnelle Osmolarität Änderungen erhöht Zelltod während das Auftauen; Daher wird tropfenweise Zugabe von kardiogener Medien wie oben beschrieben dringend empfohlen.
  5. Zentrifugieren Sie Zelle Federung und Pellet Zellen durch Zentrifugation (200 X g für 3 min).
  6. Entfernen Sie überstand und streichen Sie sanft Zentrifugenröhrchen, Zelle Pellet zu verdrängen.
  7. Aussetzen Sie Zellen mit kardiogenen Medien ergänzt mit 2 µM RHO/ROCK Pathway Inhibitor wieder.
    Hinweis: Zellviabilität kann variieren von Tauwetter, Tauwetter und, im Allgemeinen, > 65 % Lebensfähigkeit prognostiziert gute Beschichtung Effizienz.
  8. Verdünnter Zellsuspension konzentriert mit kardiogenem Medien ergänzt mit 2 µM RHO/ROCK Pathway Inhibitor für die gewünschte Zelle Konzentration für Überzug zu erhalten (siehe Tabelle 2 für verschiedene Plattenformate).
    Hinweis: Wichtig: Beachten Sie, dass die kardialen Differenzierung Effizienz zurückgehen kann, wenn Zellen zu dünn gesät sind.
  9. Samenzellen auf Platte.
  10. Halten Sie Teller in der Gewebekultur Haube für 20 min vor der Übertragung auf Gewebekultur Inkubator.
  11. Am 6. Tag der Differenzierung Zellhaftung zu überwachen.
    Hinweis: Cardiac Stammväter sind am 5. Tag der Unterscheidung kryokonserviert. 24 h nach dem Auftauen der Zellen wäre am 6. Tag der Differenzierung.
    Hinweis: Die Anwesenheit von Einzelfeldern (tot) ist üblich.
  12. Am 7. Tag Aspirieren Sie 50 % der Medien und mit einer gleichen Menge von frischen kardiogenen Medien ersetzen.
    Hinweis: Die Zugabe von RHO/ROCK Pathway Inhibitor zu den kardiogenen Medien ist nach diesem Zeitpunkt nicht notwendig.
  13. Ersetzen Sie 50 % der Medien mit kardiogenem Medien jeden zweiten Tag.
  14. Hinweis: spontane schlagen, die zwischen 11 und 13 Tag angezeigt.
  15. Am Tag 15, quantifizieren kardialen Differenzierung Effizienz durch Immunfluoreszenz mit DAPI (Kern Fleck) und ACTC1 (Pan-kardialen Marker).

7. Übergabe und Wartung von ventrikulären-wie Kardiomyozyten

Hinweis: Von Tag 14 – 16, sollte eine Monolage spontan Contracting ventrikuläre wie Kardiomyozyten eingeholt werden. An dieser Stelle wird es vorgeschlagen, distanzieren und neu Platte Kardiomyozyten um die Kultur zu homogenisieren und verhindern, dass Zellen von der Platte lösen.

  1. Aspirieren Sie alle Medien aus Brunnen und schnell 1 mL vorgewärmten (37 ° C) 1 x enzymhaltigen Dissoziation Reagenz.
    Hinweis: 1 x enzymhaltigen Dissoziation Reagenz Bände je Plattenformat, aber sollte vollständig bedecken Sie den Boden der gut Oberfläche.
  2. Übertragen Sie Platte in einer Gewebekultur Inkubator.
  3. Schütteln Sie vorsichtig Platte zur anderen Seite alle 2 min in die brutmaschine zu Ablösung beschleunigen.
  4. Nach 5 – 15 min bei 80 % bis 100 % der Zellen von der Unterseite der Platte gelöst sind, entfernen Sie die Platte aus dem Inkubator und hemmen Sie 1 x enzymhaltigen Dissoziation Reagenz Aktivität zu, indem man ein gleiches Volumen 10 % FBS Medien.
    Hinweis: Inkubationszeit mit 1 X enzymhaltigen Dissoziation für diesen Prozess wird von Charge zu Charge variieren.
  5. Sammeln Sie ein Zentrifugenröhrchen Zellsuspension.
  6. Mischen Sie Zellsuspension mit pipettieren und Anzahl Zellen mit einem automatisierten Zelle Zähler.
  7. Zellsuspension auf die gewünschte Zelle Konzentration zu verdünnen (siehe Tabelle 2 für verschiedene Plattenformate) mit Wartung Medien mit 2 µM RHO/ROCK Pathway Inhibitor ergänzt.
  8. Nach der Aussaat Kardiomyozyten auf den Teller, die Zellen gleichmäßig verteilen und die Zellen, die für 10 – 20 min vor der Übertragung Platte in Gewebekultur Inkubator legen lassen.
  9. 24 h nach neu Plattieren, überwachen Zellhaftung und Erholung.
    Hinweis: Die Anwesenheit von Einzelfeldern (tot) ist üblich. 48-72 h nach neu Plattieren, sollten Cardiomyocyte spontane Kontraktion fortsetzen.
  10. Um Cardiomyocyte Kultur zu pflegen, ersetzen Sie 50 % der Medien durch die Wartung Medien jeden zweiten Tag bis zum Gebrauch der ventrikulären-wie Kardiomyozyten für spätere Experimente.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Generation von hPSCs Id1 Linien
hPSCs sind mit einem Lentivirus Vermittlung Id1 Überexpression (Abb. 1A) infiziert. Sobald hPSCId1 erzeugt werden, wird die Transgene Ausdruck durch qRT-PCR (Abbildung 1B) quantifiziert. Nur hPSCId1 Linien auszudrücken Id1 mRNA Ebene größer als 0,005 Falte des GAPDH sollte zur Differenzierung verwendet werden.

hPSCs Id1 Wartung und Vorbereitung auf D Differenzierung
Optimale Kulturbedingungen sind notwendig und entscheidend für den erfolgreichen ersten Herz-Feld-wie kardialen Vorläuferzellen Differenzierung (Abb. 2A). hPSCId1 Kulturen sollten täglich auf Stamm Morphologie Wartung und kontinuierliche Verbreitung überwacht werden. Differenzierung sollte eingeleitet werden, wenn dicht gepackten Stammzell-Kolonien erreichen > 90 % Konfluenz (Abbildung 2B). Wenn Differenzierung vor optimale Konfluenz initiiert wird, Absterben von Zellen wird verstärkt und Differenzierung Effizienz kann abnehmen (Abbildung 2C). In ähnlicher Weise führt überwucherte Kulturen schlecht (Abbildung 2D).

Generation der ersten Herz Bereich-wie kardiale Stammväter (FHF-L CPs) von hPSCs Id1
Am Tag 1 (24 h Post Differenzierung Einleitung) sollten Zellen überwacht werden, um Verlust der Stamm Morphologie beobachten (Zellen erscheinen flacher und dunkler als Stammzellen). Beachten Sie, dass Zelltod häufig während des ersten Tages der Differenzierung ist, aber Zelle Zusammenfluss beibehalten werden sollte, bei > 75 % (Abb. 2E). Wenn nach 24 Stunden der Differenzierung, 50 % oder mehr der überdachten Fläche verloren geht, sollten die Zellen entsorgt werden.

Am 3. Tag differenzierende Zellen gruppierten bleiben sollte und Lücken während der ersten 24 h Zeitraum (Abbildung 2F) ausgefüllt haben. Flache Zellen wachsen unabhängig sind kennzeichnend für suboptimale Differenzierung Bedingungen.

Am 4. Tag sollte die optimale Differenzierung stetigen Wachstums und Abdeckung der Platte zeigen.

Am Tag 5 Zellen geerntet und kryokonserviert. Optimale Differenzierungen sollte eng verbundenen zellcluster mit homogenen Morphologie auftreten (Abbildung 2G) führen. Beachten Sie, dass niedrige Dichte Trauben von flachen Zellen eine suboptimale Differenzierung Ergebnis markieren. Der durchschnittliche Ertrag an Tag 5 kardialen Stammväter pro Bohrloch in verschiedenen Formaten Kultur finden Sie in Tabelle 2 .

Generation von ventrikulären-wie Herzzellen von FHF-L CPs
Tag 5 FHF-L CPs sind aufgetaut bei Platte Format-abhängige dichten beschrieben in Tabelle 2, um ihre kardialen Differenzierungspotenzial zu maximieren (Abbildung 3A und Tabelle 2). Die Tragfähigkeit nach dem Auftauen muss überwacht werden. Im Allgemeinen reicht die Lebensfähigkeit von 70 – 80 %. Wenn die Lebensfähigkeit unter 60 % liegt, würde die Rendite von Kardiomyozyten betroffen sein.

Am Tag 6 (24 h nach Wiederaufnahme der Differenzierung), FHF-L CPs abdecken sollte > 90 % der zur Verfügung stehenden Fläche und erscheinen als eine homogene Schicht Zellen (Abbildung 3B). Niedrige Mündung am 6. Tag verringert FHF-L CPs Differenzierung in Herzmuskelzellen.

Daraus resultierende Kardiomyozyten beginnen, Tag 11 – 13 der Differenzierung (Abbildung 3C und Film 1) schlagen. Während des Tages 14 – 16 replating Prozesses siehe Tabelle 2 für die durchschnittliche Rendite der Herzmuskelzellen pro Bohrloch in verschiedenen Kultur-Formaten. Differenzierung-Effizienz wird in der Regel durch Immunfluoreszenz für Herz-(ACTC1), Fibroblasten (TAGLN) und vaskulären endothelialen Marker (CDH5) und Kernenergie (DAPI) Marker bewertet. Linie Quantifizierung erfolgt über automatisierte Bildgebung und Fluoreszenz-Quantifizierung, wie Cunningham Et al. (2017) 5 (Abbildung 3-D-E). Subtyp Charakterisierung der daraus resultierenden Kardiomyozyten erfolgt durch qRT-PCR (Abbildung 3F) und Aktionspotential Transiente Analyse mit kinetic Imaging und Spannung sensing Sonden (Abbildung 3G und Movie 2). Fluoreszenz-Quantifizierung für Spannung Sonde und daraus resultierende Aktionspotential Spurenanalytik (Abbildung 3H) erfolgt wie in McKeithan Et Al. beschrieben (2017) 7.

Figure 1
Abbildung 1: Generation der hPSCId1 Linien. (A) schematische Darstellung der hPSCsId1 -Generation-Protokoll. (B) Beispiele für qRT-PCR-Ergebnisse zeigen repräsentative Id1 mRNA-Niveaus durch Lentivirale-vermittelten Expression von klaren Linien der hPSCId1 einschließlich hESC einzeilig und zwei Linien der hPSC Linien erzeugt. Gestrichelte Linie stellt Id1 Ausdruck Schwelle, unterhalb welcher hPSCId1 Linien einen zusätzlichen Kreislauf der Id1-Lentivirus Infektion unterziehen müssen. "p" zeigt die Anzahl der Passagen. Die Zahl in Klammern gibt die Anzahl der runden Id1-Lentivirale Infektion. Fehlerbalken darzustellen Standardabweichung der Experimente in dreifacher Ausfertigung. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Generation der ersten Herz Field-Like Herz Stammväter (FHF-L CPs) Differenzierung von hPSCId1. (A) schematische Darstellung des Protokolls FHF-L CP-Generation. Repräsentative Hellfeld Bilder von hPSCId1 (Tag 0) bei optimalen (B), Sub-Zusammenfluss (gelbe Pfeilspitzen zeigen die leere Bereiche zwischen den Zellen) (C) und übermäßige Zusammenfluss (D) Dichte. Repräsentative Hellfeld Bilder des Unterscheidens hPSCId1 am Tag 1, 3 und 5 bzw. (E), (F), (G). Maßstabsleiste = 100 µm. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: Generation von ventrikulären-wie Cardiomyocyte von FHF-L CPs. (A) Schematische Darstellung des Protokolls ventrikuläre-wie Cardiomyocyte-Generation. (B) Hellfeld Bild der 6.Tag Differenzierung Zellen (einen Tag nach dem Auftauen). (C) Hellfeld Bild einer 12.Tag schlagende Kultur. (D) repräsentative Immunfluoreszenz Bild des Tages 15 Kulturen (384-Well-Plattenformat). ACTC1 markiert Kardiomyozyten, TAGLN: Fibroblasten/glatte Muskulatur, CDH5: vaskuläre Endothelzellen und DAPI: Kerne (gezeigt im Einschub). (E) Linie Quantifizierung der Tag 15 Kulturen. (F) qRT-PCR-Daten Mal Kurs ab Tag 5 Tag 25 der Ausdruck ventrikuläre-spezifische Marker (IRX4 und MYL2) und Pan-kardialen Marker (MYL7). (G) repräsentative Aktionspotential Spur von ventrikulären-wie Kardiomyozyten am Tag 25 der Differenzierung. (H) Aktionspotential Dauer Messungen (APD50 und APD90) der resultierenden ventrikuläre wie Kardiomyozyten (n = 12). Fehlerbalken darzustellen Standardabweichung der Experimente in vervierfacht (sofern nicht anders angegeben). Skalieren von Balken = 100 µm. RFU, relative Fluorescence Units. Bitte klicken Sie hier für eine größere Version dieser Figur.

Medium Basis-medium Additiv
Stammzell-Medien mTesR1 n/a
Induktion-Medien RPMI 1640 Medium B-27 serumfreien Ergänzung ohne Insulin, 1 x
Induktion-Medien RPMI 1640 Medium Puromycin, 6 µg/ml
Induktion-Medien RPMI 1640 Medium Penicillin-Streptomycin, 1 x
Kardiogenen Medien RPMI 1640 Medium B-27 serumfreien Supplement, 1 x
Kardiogenen Medien RPMI 1640 Medium Penicillin-Streptomycin, 1 x
Wartung-Medien RPMI 1640 Medium B-27 serumfreien Supplement, 1 x
Wartung-Medien RPMI 1640 Medium Ko-Serum Ersatz, 2 %
Wartung-Medien RPMI 1640 Medium Penicillin-Streptomycin, 1 x

Tabelle 1: Media-Komponenten (siehe Tabelle der Materialien für base Medien und Zusätze).

384 gut 96 gut 12 gut 6 gut 100 mm 150 mm
Beschichtung Volumen (pro Well) 10 ΜL 50 ΜL 500 ΜL 1 mL 5 mL 10 mL
Mittleres Volumen
(pro Well)
100 ΜL 300 ΜL 2 mL 5 mL 12 mL 30 mL
Differenzierung Tag 0 Activin eine Konzentration (ng/mL) 100 100 100 300
Kardialen Vorläuferzellen
Tag 5 Ertrag
(Zellen/na)
1,0-1,2 x 105 2,5 – 3,0 x 105 1.0-1.5 x 107 2,0 – 3,0 x 107
Kardialen Vorläuferzellen 5.Tag replating oder Auftauen Dichte (Zellen/na) 2.0 x 104 7,5 x 105 4.5 x 106 8.0 x 106 2.2 x 107
Kammerflimmern-wie cardiomyocyte
Tag 14 – 16 Ertrag
(Zellen/na)
2.0 – 5.0 x 104 0,8-1,2 x 106 3,5-5,0 x 106 0,8-1,2 x 107 1,8 – 2,5 x 107
Kammerflimmern-ähnliche Cardiomyocyte replating Dichte
(Zellen/na)
2.5 x 104 1.0 x 106 4.5 x 106 1.0 x 107 2.2 x 107

Tabelle 2: Skalierbare Differenzierung Parameter (Beschichtung Volumen, mittlere Lautstärke, Activin A Konzentration, Erträge, dichten replating).

Gen Namen GenBank-Beitritt Sequenz
GAPDH NM_001256799 F: GGAGCGAGATCCCTCCAAAAT
R: GGCTGTTGTCATACTTCTCATGG
Maus Id1 NM_010495 F: CCTAGCTGTTCGCTGAAGGC
R: CTCCGACAGACCAAGTACCAC
IRX4 NM_016358 F: GGCTCCCCAGTTCTTGATGG
R: TAGACCGGGCAGTAGACCG
MYL2 NM_000432 F: TTGGGCGAGTGAACGTGAAAA
R: CCGAACGTAATCAGCCTTCAG
MYL7 NM_021223 F: GCCCAACGTGGTTCTTCCAA
R: CTCCTCCTCTGGGACACTC

Tabelle 3: qRT-PCR-Primer-Sequenzen.

Movie 1
Movie 1: Hellfeld Aufnahme (100 Bilder/s) der 15. Tag Kardiomyozyten wo spontane Kontraktionen beobachtet werden. Bitte klicken Sie hier, um dieses Video anzusehen. (Rechtsklick zum download)

Movie 2
Movie 2: Kinetic Imaging (100 Bilder/s) der Spannung-empfindlichen fluoreszierende Sonde im Tag 25 id1-induzierte ventrikuläre wie Kardiomyozyten. Bitte klicken Sie hier, um dieses Video anzusehen. (Rechtsklick zum download)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Achten Sie für erfolgreiche Differenzierungen darauf, eng oben aufgelisteten Anweisungen folgen. Darüber hinaus stellen wir hier wichtige Parameter, die Differenzierung Ergebnisse stark beeinflussen. Bevor Sie beginnen eine Differenzierung, die folgenden drei morphologische Parameter beachtet werden: ein Stamm Morphologie der hPSCsId1, eine hohe Verdichtung der zellulären und eine hohe Confluence (> 90 %) der Kultur an Tag 0. In dieser Hinsicht optimale Differenzierung Bedingungen entstehen am besten durch Beschichtung getrennt hPSCsId1 als Einzelzellen und so dass sie fest zu bilden Monolayer, die wachsen bis ca. 90 % Zusammenfluss im Laufe von 2 bis 3 Tagen gruppiert. Umgekehrt, wenn hPSCId1 Kulturen Arme Zelle und Kolonie Morphologie, niedrige Kolonie Verdichtung und das Vorhandensein von großen Flächen der Differenzierung innerhalb der Kultur zeigen, erfolgreiche FHF-L CP Differenzierung sind unwahrscheinlich.

Medienlautstärke und Activin A-Konzentrationen sind wichtige Parameter der FHF-L CP Differenzierung und Platte Format-abhängig (siehe Tabelle 2). Beachten Sie auch, dass optimale Activin A-Konzentrationen nach verwendeten hPSC Linie je können und erfordern Konzentration Optimierung.

Id1 -mRNA-Niveaus im hPSCs sind entscheidende Förderung effizient FHF-L vgl. suboptimale Id1 Ebenen fehl, robuste FHF-L CP Differenzierung zu produzieren, und massive Zelltod von Tag 1 der Differenzierung zu beobachten. Das Verhältnis der relativen Ausdruck von Id1- zu -GAPDH darf 0,005 effiziente Differenzierung zu fördern. Weitere Auswahl mit höheren Dosen von Puromycin (6 – 10 µg/mL) wird empfohlen, um hohe Niveaus der Lentivirale vermittelte Id1 Ausdruck zu erhalten. Eine Bewertung der Id1 mRNA-Niveaus jeder 10 Passagen wird empfohlen.

Dichten von Tag 5 Beschichtung FHF-L CPsis auch ein kritischer Parameter für kardialen Differenzierung Effizienz. Wenn Tag 5 FHF-L CPs sind bei niedrigen dichten beschichtet, die relative kardiale Rendite sinkt. Optimale Beschichtung dichten sind in Tabelle 2 aufgeführt und Platte Format abhängig sind.

Die wichtigste Einschränkung für dieses Protokoll ist die Verwendung von Lentivirale-vermittelten Id1 Überexpression zu PromoteFHF-L CP Differenzierung, die die therapeutische Verwendung der daraus resultierenden Stammväter und ventrikuläre wie Kardiomyozyten einschränken können. Auch, da Lentiviren an Standorten integrieren können, dass potenziell beeinflussen hPSC Wartungs- und/oder Entwicklungspotential, Stemness hPSCsId1 Kolonien durch die Auswertung sollten überwacht werden könnte Stammzellen Sie Genexpression und morphologische Zeichen der Beobachtung Differenzierung. Beachten Sie, dass überexprimierenden Id1-integrative Vektoren diese Einschränkung überwinden würde und wird derzeit in unserem Labor untersucht.

Eine bequeme Eigenschaft dieser Methode ist die Einfachheit des Protokolls Differenzierung bedarf es nur ein Zytokin, Activin A, FHF-L CPs aus hPSCsId1zu generieren. Zum Vergleich: andere Protokolle 9,10,11,12,13,14,15 erfordern komplexe Sequenzen von Kombinationen von Zytokinen und/oder kleine Moleküle zur Förderung und Erhaltung der kardialen Differenzierung. Dieses Protokoll beschreibt darüber hinaus eindeutig einen bequeme Kryokonservierung Schritt ermöglicht um FHF-L CP-Generation von nachfolgenden Cardiomyocyte Produktion zu entkoppeln. Mit dieser Funktion können zu Biobank Großserien von FHF-L CPs und schnell Herzzellen aus gefrorenen Stammväter generieren als kardialen Differenzierung wird fortgesetzt, ab Tag 5 nach Auftauen. Diese Strategie erlaubt, um 1 bis 2 Wochen nach der Zeit im Vergleich zu hPSCs kardialen Differenzierung ab zu gewinnen. Darüber hinaus, und vor allem, ist dieses Protokoll dem ersten Protokoll Datum, kardiale Stammväter definierten Herz Bereich Ursprungs, während andere Protokolle9,10,11,12 zu generieren ,13,14,15 bleiben in dieser Hinsicht nicht definiert.

Zusammenfassend lässt sich sagen, dieses Protokoll beschreibt eine robuste und skalierbare Methode, um große Mengen zu produzieren (> 108– 109) von entwicklungspolitisch relevanten FHF-L CPs und ventrikuläre wie Kardiomyozyten. Wiederum resultierende Zellen können verwendet werden, um neuartige rechtliche Wege Steuerung der kardialen Differenzierung und Physiologie, zu identifizieren und für regenerative und Krankheit modellierungszwecken.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Wir danken Mitglieder des Colas Lab für hilfreiche Diskussionen und Kritiken des Manuskripts. Diese Studie wurde unterstützt durch NIH/NIEHS R44ES023521-02 und CIRM DISC2-10110 räumt Dr. Colas.

Materials

Name Company Catalog Number Comments
ACTC1 antibody Sigma A7811
Activin A Stem Cell Technologies Hu Recom Activin A
Antibiotic Antimycotic (Anti-Anti) Thermo Fisher Scientific 15240062
B27 supplement Thermo Fisher Scientific 17504044
B27 supplement w/o - insulin Thermo Fisher Scientific A1895601
B27 supplement w/o - vitamin A Thermo Fisher Scientific 12587001
CDH5 antibody R&D Systems AF938
CryoStor CS10 Stem Cell Technologies 7930 Cryopreservation reagent
DMEM high Glucose Mediatech 10-013-CV 
DPBS w/ Ca & Mg Corning 21-030-CV
EDTA Thermo Fisher Scientific 15575-038
FBS VWR 89510-186
FluoVolt membrane potential kit   Thermo Fisher Scientific F10488 For optical action potential acquisition, please refer to McKeithan et al. 2017
KnockOut Serum Replacement Gibco 10828010
Matrigel, Growth Factor Reduced Corning 356231 Coating reagent
mTeSR1 media kit Stem Cell Technologies 5850
PBS w/o Ca & Mg Corning 21-040-CV
Penicillin-Streptomycin Gibco
Puromycin  Acros 227422500
ReLeSR Stem Cell Technologies 5872 Enzyme-free dissociation reagent
RPMI 1640 Thermo Fisher Scientific 11875-093
TAGLN antibody Abcam ab14106
Thiazovivin Stem Cell Technologies 72254 RHO/ROCK pathway inhibitor
TrypLE Express Thermo Fisher Scientific 12605 -010 1X enzyme-containing dissociation reagent
Tyrodes solution mix packets   Sigma T2145-10X1L (For optical action potential acquisition, please refer to McKeithan et al. 2017)

DOWNLOAD MATERIALS LIST

References

  1. Chong, J. J., et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature. 510, 273-277 (2014).
  2. Kodo, K., et al. iPSC-derived cardiomyocytes reveal abnormal TGF-beta signalling in left ventricular non-compaction cardiomyopathy. Nature cell biology. 18, 1031-1042 (2016).
  3. Kim, C., et al. Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs. Nature. 494, 105-110 (2013).
  4. Colas, A. R., et al. Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis. Genes & development. 26, 2567-2579 (2012).
  5. Cunningham, T. J., et al. Id genes are essential for early heart formation. Genes & development. (2017).
  6. McKeithan, W. L., Colas, A. R., Bushway, P. J., Ray, S., Mercola, M. Serum-free generation of multipotent mesoderm (Kdr+) progenitor cells in mouse embryonic stem cells for functional genomics screening. Current protocols in stem cell biology. Chapter 1, Unit 1F 13 (2012).
  7. McKeithan, W. L., et al. An automated platform for assessment of congenital and drug-induced arrhythmia with hipsc-derived cardiomyocytes. Frontiers in physiology. 8, 766 (2017).
  8. Sharma, A., et al. High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells. Science translational medicine. 9, (2017).
  9. Burridge, P. W., et al. Chemically defined generation of human cardiomyocytes. Nature methods. 11, 855-860 (2014).
  10. Kattman, S. J., et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell. 8, 228-240 (2011).
  11. Laflamme, M. A., et al. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nature biotechnology. 25, 1015-1024 (2007).
  12. Lian, X., et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America. 109, 1848-1857 (2012).
  13. Willems, E., et al. Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells. Cell stem cell. 11, 242-252 (2012).
  14. Yang, L., et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature. 453, 524-528 (2008).
  15. Palpant, N. J., et al. Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nature protocols. 12, 15-31 (2017).
  16. DeLaughter, D. M., et al. Single-cell resolution of temporal gene expression during heart development. Developmental cell. 39, 480-490 (2016).
  17. Liu, X., et al. The complex genetics of hypoplastic left heart syndrome. Nature genetics. 49, 1152-1159 (2017).
  18. Corrado, D., Link, M. S., Calkins, H. Arrhythmogenic right ventricular cardiomyopathy. New England journal of medicine. 376, 1489-1490 (2017).
  19. Kitamura, T., et al. Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Experimental hematology. 31, 1007-1014 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics