İlk kalp alan benzeri kardiyak ataları ve ventrikül benzeri Cardiomyocytes insan Pluripotent kök hücrelerden nesil

* These authors contributed equally
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Burada ilk kalp alan benzeri kardiyak ataları ve ventrikül benzeri cardiomyocytes insan pluripotent kök hücre üretmek için aktivin A ve lentivirus-aracılı ID1-overexpression, basit bir birleşimini kullanarak ölçeklenebilir bir yöntem açıklanmaktadır.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Yu, M. S., Spiering, S., Colas, A. R. Generation of First Heart Field-like Cardiac Progenitors and Ventricular-like Cardiomyocytes from Human Pluripotent Stem Cells. J. Vis. Exp. (136), e57688, doi:10.3791/57688 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Üretimi cardiomyocytes tanımlanmış kalp alan kökenli ve fonksiyonel insan pluripotent kök hücreler elde edilen kalp ataları büyük miktarda hücre tabanlı kardiyak terapiler ve hastalık modelleme için önceden gerekli olduğunu. Son zamanlarda kimliği genler gerekli ve omurgalı geliştirme sırasında ilk kalp alan ataları belirtmek yeterli olduğunu göstermiştir. Bu farklılaşma protokolü bu bulgular güçlendirir ve ID1 overexpression beraber aktivin A güçlü belirten cues olarak ilk kalp alan benzeri (FHF-L) ataları üretmek için kullanır. Önemlisi, ortaya çıkan ataları verimli (~ 70-%90) ventrikül benzeri cardiomyocytes ayırt etmek. Burada ayrıntılı bir yöntem 1) oluşturmak ID1-overexpressing hPSCs ve 2) ayırt ölçeklenebilir miktarda cryopreservable FHF-L ataları ve ventrikül benzeri cardiomyocytes açıklayın.

Introduction

Büyük ölçekli üretim insan pluripotent kök hücre (hPSCs)-türetilmiş kardiyak ataları ve cardiomyocytes olan kök hücre tabanlı terapiler1,2,3 ve hızlı karakterizasyonu modelleme hastalığı için önceden gerekli Kardiyak farklılaşma4,5,6 ve Fizyoloji7,8düzenleyen yeni yollar. Her ne kadar bir dizi çalışmalar9,10,11,12,13,14,15 daha önce açıklanan yüksek verimli hPSCs kardiyak farklılaşma kurallarından, hiçbiri sol arasında önemli moleküler farklılıklar tanımlaması rağmen elde edilen cardiomyocytes kalp alan kökeni açıklama (ilk kalp alanı) ve değil (İkinci kalp alanı) ventrikül cardiomyocytes16 ve kalp özel alan konjenital kalp hastalıkları varlığı; Yani, hipoplastik sol kalp sendromu17 veya Aritmojenik Sağ ventrikül displazi18. Böylece, kardiyak ataları nesil ve hPSCs üzerinden tanımlanmış kalp alan kökenli cardiomyocytes tedavi edici olarak kendi alaka artırmak için bir zorunluluk haline gelmektedir ve modelleme araçları hastalığı.

Bu iletişim kuralı ID1, bu aktivin A, birlikte gerekli ve yeterli cardiogenesis hPSCs içinde başlatmak yakın zamanda belirlenen5 ilk kalp alanı belirtmek isteka bünye overexpression kullanır. Özellikle, Cunningham vd. (2017) 5 göstermek onlar kalp farklılaşma geçmesi gibi ID1 kaynaklı ataları özellikle ilk kalp alanı (HCN4, TBX5) ama değil ikinci kalp alan işaretleri (SIX2, ISL1) ifade. Buna ek olarak, yazarlar da genler (ID1-4), tüm kimliği ailesi eksik transgenik fare embriyo geliştirmek ilk kalp alan kardiyak ataları, orta ve posterior kardiyak ataları () daha fazla süre kurma olmadan göster İkinci kalp) hala, böylece kimliği proteinler ilk kalp alan cardiogenesis vivo içindebaşlatmak için gerekli olan düşündüren form alanı. Elverişli bir konuma sahip, ID1 kaynaklı ataları cryopreserved ve kendiliğinden ventrikül benzeri özellikleri ventrikül özgü işaretleri (IRX4, MYL2) ifadesi de dahil olmak üzere, görüntüleme cardiomyocytes ayırt etmek ve ventrikül benzeri Aksiyon potansiyelleri.

Burada ilk kalp alan benzeri (FHF-L) kardiyak ataları ve ventrikül benzeri cardiomyocytes ID1 overexpressing hPSCs oluşturmak için basit ve ölçeklenebilir bir yöntemi açıklanmaktadır. Bu protokol önemli bir özelliği uygun dondurma adım kullanarak sonraki cardiomyocyte üretim kardiyak yaratıcı nesil çözmek için olasılık var. Özetle, bu iletişim kuralını (1) oluşturmak ID1-overexpressing hPSCs, oluşturmak (2) FHF-L kardiyak ataları hPSCs, (3) cryopreserve elde edilen ataları ve (4) FHF-L kardiyak progenitör farklılaşma sürdürmek için gerekli adımları detayları ve oluşturmak yüksek oranda zenginleştirilmiş (> % 70-90) ventrikül benzeri cardiomyocytes yenerek.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. ID1 virüs hazırlık ve enfeksiyon

  1. ID1 overexpressing lentivirus birlikte transfecting pCMVDR8.74, pMD2.G ve pCDH-EF1-ID1-PGK-PuroR oluşturmak (Addgene: plazmid #107735) HEK293T hücreye. Viral parçacıkların toplamak, filtrate, süpernatant arındırmak ve olduğu gibi Kitamura vd. -80 ° C'de depolayın (2003) 19. alternatif olarak, ID1 lentivirus ticari olarak pCDH-EF1-ID1-PGK-PuroR lentivirus üreten bir satıcıya göndererek üretmek.
    Uyarı: Lütfen lentiviral güvenlik düzenlemeleri ve standart operasyon iletişim kuralları izleyin.
    Not: Önemli: en iyi virüs titresi-meli var olmak hiç olmazsa 108 -109 Transducing adet/mL (TU/mL).
  2. Enfeksiyon önce 96 iyi plaka bir şey 50 µl kaplama reaktif, genellikle ( Tablo malzemelerigörmek) Engelbreth-Holm-Swarm fare sarkomu hücreleri tarafından salgılanan bir jelatinimsi protein karışımı ile kat.
  3. Pluripotent kök hücre PBS Ca2 + ve Mg2 + olmadan ve 0,5 mM EDTA ile 1 mL ekleyerek bir 6 iyi tabak içinde yetiştirilen bir şey ayırmak.
    Not: 3 – 10 dk ayrılma süresi değişir. Ne zaman hücreleri % 80'den fazla plaka alttan ayrılır, sonraki adıma geçin.
  4. Hücre süspansiyon ile steril damlalıklı 15 mL plastik santrifüj tüpüne toplamak.
  5. Ayrılma reaktif PBS içeren Ca2 + ve Mg2 +5 mL ile etkisiz hale getirin.
  6. Pelet hücreleri tarafından Santrifüjü (200 x g 3 dakika).
  7. Süpernatant kaldır ve yavaşça tüp Pelet çıkarmak için hafifçe vur.
  8. Hücrelere kök hücre medya 1 mL yeniden askıya alma.
  9. Satıcı yönergeleri izleyerek bir otomatik hücre sayaç kullanarak hücreleri saymak.
  10. Plaka 20.000 hücrelerin başına 50 µL 2 µM RHO/ROCK yolu inhibitörü ile desteklenmiş kök hücre medya iyi (96-şey plaka) kaplı (bkz. Tablo 1 ve 2).
  11. 24 saat sonra hücre eki için izlemek ve 2 µM RHO/ROCK yolu inhibitörü ve 6 ng/mL hexadimethrine bromür ile 100 µl kök hücre medya medya yerine (bkz. Tablo 1 ve 2), bir h lentiviral enfeksiyonu önce.
    Not: Hücreleri sıkıca plaka altına yapıştırılmış.
  12. ID1-lentivirus buz çözme.
  13. Saf lentivirus iyi başına 3 µL eklemek (virüs titresi 10 arasında olması gerektiğini8 -109 TU/mL) ve ardından plaka geri hücre kültür kuluçka için (37 ° C, % 5 CO2, %20 O2) aktarın.
  14. 24 saat sonrası viral enfeksiyon, 100 µL taze kök hücre medya için enfekte hücreleri ekleyin.
  15. 48 saat sonrası lentiviral enfeksiyon, taze kök hücre medya ile 1 µg/mL puromisindir takıma 200 µL ile ortamı içeren Değiştir virüs.
  16. Her gün 200 µL 1 µg/mL puromisindir ile desteklenmiş kök hücre medya ile medya yenileyin.
  17. Kültürler % 80 confluency ulaştığınızda, (96-şey plaka bir de) için PBS 200 µL Ca2 + ve Mg2 + + 0,5 mM EDTA olmadan kullanarak hücreleri ayırmak.
  18. Hücre süspansiyon bir santrifüj tüpüne toplamak.
  19. Ayrılma reaktif PBS içeren Ca2 + ve Mg2 +5 mL ile etkisiz hale getirin.
  20. Pelet hücreleri tarafından Santrifüjü (200 x g 3 dakika).
  21. Süpernatant kaldır ve yavaşça tüp Pelet çıkarmak için hafifçe vur.
  22. 1 mL 2 µM RHO/ROCK yolu inhibitörü ile desteklenmiş kök hücre medya hücrelerde yeniden askıya alma.
  23. Tüm hücreleri (1 mL) için kaplanmış bir de, bir 12-şey plaka aktarın.
  24. 24 saat sonra 2 µM RHO/ROCK yolu inhibitörü ve 6 ng/mL hexadimethrine bromür, iletim önce bir h ile 1 mL ile iyi ve eski yerine koymak medya hücre ekin kök hücre medya monitör takıma.
  25. ID1-lentivirus buz çözme.
  26. Arıtılmış virüs iyi (12-şey plaka) başına 5 µL ekleyin.
  27. 24 saat sonrası lentiviral enfeksiyon, 1 mL taze kök hücre medya 3 µg/mL puromisindir ile takviye ile ortamı içeren Değiştir virüs.
  28. 48 h lentiviral enfeksiyon sonrası, virüs ile 1 mL 6 µg/mL puromisindir ile takıma taze kök hücre medya ortamı içeren değiştirin.
  29. Kültürler % 80 confluency ulaştığınızda, (bir 12-şey plaka bir de) için PBS Ca2 + ve Mg2 + olmadan ve 0,5 mM EDTA ile 500 µL kullanarak hücreleri ayırmak.
  30. Yarısı transfer (250 µL) 6-şey plaka 2 mL 2 µM RHO/ROCK yolu inhibitörü ile desteklenmiş kök hücre medya içeren bir kaplama reaktif bir de hücre süspansiyon kaplı.
  31. Diğer yarısı kullanın (250 µL) RNA çıkarma ve lentiviral-aracılı ID1 ifade düzeyleri, kola vd gibi belirlemede qRT-PCR için örnek (2012) 4.
    Not: Önemli: ID1 mRNA ifade düzeyleri (bkz. Tablo 3 qRT-PCR astar için) GAPDH ifade düzeylerinin 0.005 kat daha düşük ise, enfeksiyon ID1 ifade düzeyleri aşan kadar yukarıda açıklanan adımları tekrarlayın eşik.

2. hPSCsID1 bakım

  1. HPSCsID1 kaplı 6 iyi-tabaklar içinde kültür ve kök hücre medya 6 µg/mL puromisindir ile desteklenmiş kuyu başına 3 mL büyümek.
  2. Ne zaman hPSCsID1% 80 confluency, satıcı yönergeleri izleyerek enzim-Alerjik ayrılma reaktif kullanarak geçiş hücreleri toplamları (1:6 split oranı) olarak ulaşmak ve kök hücre medya 6 µg/mL puromisindir ile desteklenmiş kuyu başına 3 mL büyümek.

3. farklılaşma için hPSCsID1 hazırlanması

  1. 12-şey plaka ile kaplama reaktif kuyu başına 500 µL kat.
  2. Ne zaman PBS Ca2 + ve Mg2 + olmadan ve iyi ücret 0,5 mM EDTA ile 1 mL ekleyerek hücreleriID1 ulaşmak % 90 confluency hPSCs ayırmak için 5-10 dk. ayrılma işlemi her dakika denetleyebilir, ve bir kez hücreleri % 80'i plaka ayrışmış , sonraki adıma geçin.
  3. Hücre süspansiyon bir santrifüj tüpüne toplamak.
  4. Ayrılma reaktif PBS içeren Ca2 + ve Mg2 +5 mL ile etkisiz hale getirin.
  5. Pelet hücreleri tarafından Santrifüjü (200 x g 3 dakika).
  6. Süpernatant kaldır ve yavaşça tüp Pelet çıkarmak için hafifçe vur.
  7. 2 mL 2 µM RHO/ROCK yolu inhibitörü ile desteklenmiş kök hücre medya hücrelerde yeniden askıya alma.
  8. Bir otomatik hücre sayaç kullanarak hücreleri saymak.
  9. Plaka 300.000 hücre, doku kültürü kuluçka 2 µM RHO/ROCK yolu inhibitörü ve 6 µg/mL puromisindir ve transfer plaka ile desteklenmiş kök hücre medya 1 mL kuyuda başına.
  10. Her gün 2 mL % 90 confluency kültürler ulaşana kadar 6 µg/mL puromisindir ile desteklenmiş kök hücre medya ile medya yenileyin. Bu noktada, kardiyak farklılaşma başlatmak (sonraki adım).

4. ilk kalp alan benzeri kardiyak ataları (FHF-L CPs) içine hPSCsID1 farklılaşma

  1. 12-şey plaka biçimi için indüksiyon medya (Tablo 1) 1,5 mL ile kök hücre medya değiştirerek başlatmak farklılaşma (0 gün) aktivin ile desteklenmiş bir (100 ng/mL) ( Tablo 2 için önerilen birim ve aktivin A konsantrasyonları için bkz. farklı plaka oluşum).
  2. Gün 1 (24 saat) farklılaşma başlatıldıktan sonra aktivin A olmadan indüksiyon medya (ücret de 12-şey plaka) 2 mL ile ortamı değiştirin.
  3. 3 günde 2 mL (ücret de 12-şey plaka) aktivin A olmadan indüksiyon medya medya yerine.
  4. 5 günde FHF-L CPs dondurma için toplamak (sonraki adım).
    Not: Önemli: dondurma tercih edilen bu noktada, bu sonraki cardiomyocyte üretim ve biobank büyük toplu işlemleri hücre kardiyak yaratıcı nesil çözmek için kullanmasına olanak tanır. Bu alternatif olarak, Not 5 gün FHF-L CPs farklılaşma devam etmek, passFHF-L CPs 5.1-5,5 adımlarına bakın ve farklılaşma için adım 6.5'devam etmek için taze kaplı bir tabak için geçirilebilir.

5. FHF-L CPs dondurma

  1. Kuyulardan 5 gün içeren tüm medya Aspire FHF-L CPs ve hızlı bir şekilde eklemek sıcak (37 ° C) 1 x ayrılma reaktif enzim içeren 1 mL ( Tablo malzemelerigörmek). Plaka da doku kültürü kuluçka makinesine koyun.
  2. 1 dakika sonra plaka yan yana kuluçka sallamak.
  3. 2 dakika (Toplam süre) sonra plaka kuluçka makinesi kaldırın ve 1 mL % 10 FBS medya ekleyin.
  4. Yavaşça yukarı ve aşağı damlalıklı hücreleri hücre dekolmanı plaka kolaylaştırmak için 5 mL damlalıklı ile.
  5. Santrifüjü 200 x g 3 dk de tarafından bir santrifüj tüpü ve Pelet hücrelere hücre süspansiyon toplamak
  6. Hücre Pelet 2 mL dondurma reaktif yeniden askıya alma.
  7. Bir otomatik hücre sayaç kullanarak hücreleri saymak.
  8. Dondurma reaktif ekleyin ( Tablo malzemelerigörmek) hücreleri istenilen konsantrasyonu (genellikle 5-10 x 106 hücre/mL), cryopreserve için yeterli bir ses seviyesinde.
  9. Hücreleri dondurma şişeleri için transfer ve şişeleri soğutma aygıtının (1 ° C/dak) yerleştirin ve soğutma cihazı gecede-80 ° C dondurucuya yerleştirin.
  10. 24 saat sonra dondurulmuş şişeleri uzun süreli depolama için sıvı azot aktarın.
    Not: Protokol burada duraklatılmış.

6. FHF-L CP farklılaşma gibi ventriküler Cardiomyocytes içine

  1. 5. gün FHF-L donmuş CPs şişeleri sıvı azot depodan Kuru buz kap içine aktarın.
  2. Hücre süspansiyon tamamen çözdürülen kadar 2-3 dk, 37 ° C su banyosunda şişeleri koyun.
    Not: Önemli: zamana duyarlı çözülme sürecidir. Dondurma medya hücrelere bir zaman aşırı miktarda açığa (Yani, 10 dk) hücre canlılığı azalacak.
  3. 15-50 mL santrifüj tüpü, çözdürülen şişeleri sayısına bağlı olarak hücre aktarın.
  4. Dropwise (5 damla 30 saniyede) önceden ısıtılmış (37 ° C) kardiyojenik medyaya (Tablo 1) hücre çözümü dağıtmak. 1:3 dondurma medya kadar bu işleme devam edin: kardiyojenik medya oranı ulaşıldığında. Bu noktada, artış kardiyojenik medya ek oranı 1:10 kadar dondurma medya: kardiyojenik medya oranı ulaşıldığında.
    Not: Önemli: hızlı Osmolarite değişiklikler hücre ölümü Çözdürme işlemi sırasında; artacak Bu nedenle, Kardiyojenik medya dropwise yanı sıra yukarıda açıklandığı gibi önerilir.
  5. Hücre süspansiyon ve Pelet hücreleri tarafından aralıklarla (3 dk 200 x g) santrifüj kapasitesi.
  6. Süpernatant kaldır ve yavaşça hücre Pelet çıkarmak için santrifüj tüpü hafifçe vur.
  7. Hücreler 2 µM RHO/ROCK yolu inhibitörü ile desteklenmiş kardiyojenik medya ile yeniden askıya alma.
    Not: Hücre canlılığı tezcan tezcan ve, genel olarak değişebilir, > %65 canlılık iyi kaplama verimliliği öngörür.
  8. Seyreltik yoğunlaşmış hücre süspansiyon ile kaplama için istenen hücre konsantrasyonu elde etmek için 2 µM RHO/ROCK yolu inhibitörü ile takıma kardiyojenik kitle iletişim araçları (bkz. Tablo 2 farklı plaka biçimleri için).
    Not: Önemli: Eğer hücreler çok seyrek numaralı seribaşı kardiyak farklılaşma verimlilik düşebilir unutmayın.
  9. Plaka üzerinde tohum hücreleri.
  10. Plaka doku kültürü mahalle 20 dk için doku kültürü kuluçka aktarmadan önce tutmak.
  11. Gün 6 farklılaşma, hücre eki izlemek.
    Not: Kalp ataları farklılaşma 5 gün cryopreserved. hücreleri çözdürme sonra 24 h farklılaşma gün 6 olur.
    Not: Kayan (ölü) hücreleri varlığı yaygındır.
  12. Gün 7, medya % 50'si Aspire edin ve eşit miktarda taze kardiyojenik medya ile değiştirin.
    Not: RHO/ROCK yolu inhibitörü kardiyojenik basına ilavesi bu noktadan sonra gerekli değildir.
  13. Medya % 50'si ile kardiyojenik ortamı her gün değiştirin.
  14. Not kendiliğinden dayak gün 11 ve 13 gün arasında görünür.
  15. 15 günde, DAPI (çekirdek leke) ve ACTC1 kullanarak ayirt tarafından kalp farklılaşma verimliliği ölçmek (pan-kardiyak marker).

7. geçen ve bakım gibi ventriküler Cardiomyocytes

Not: gün 14-16 tarafından kendiliğinden ventrikül benzeri cardiomyocytes yakalanma monolayer alınmalıdır. Bu noktada, bu ayırmak ve kültür homojenize ve plaka ayırma hücreleri önlemek için cardiomyocytes yeniden plakası için önerilmektedir.

  1. Tüm medya kuyulardan Aspire edin ve hızlı bir şekilde önceden ısıtılmış (37 ° C) 1 x ayrılma reaktif enzim içeren 1 mL ekleyin.
    Not: 1 x enzim içeren ayrılma reaktif birimler plaka biçimine bağlı olarak değişir ama tamamen iyi yüzey alt karşılar.
  2. Plaka bir doku kültürü kuluçka makinesi aktarın.
  3. Yavaşça plaka her 2 dk dekolmanı sürecini hızlandırmak için kuluçka makinesi içinde yan yana sallayın.
  4. 5-15 dakika sonra hücrelerin % %80 100 plaka alttan ayrılır, plaka kuluçka makinesi kaldır ve % 10 FBS medya eşit bir hacmi ekleyerek 1 x enzim içeren ayrılma reaktif etkinliği inhibe.
    Not: Toplu iş toplu kuluçka süresinin 1 x enzim içeren ayrılma ile bu işlem için değişir.
  5. Hücre süspansiyon bir santrifüj tüpü toplamak.
  6. Hücre süspansiyon bir otomatik hücre sayaç damlalıklı ve sayısı hücreleri ile karıştırın.
  7. İstenen hücre konsantrasyonu hücre süspansiyon seyreltik (bkz. Tablo 2 farklı plaka biçimleri için) 2 µM RHO/ROCK yolu inhibitörü ile desteklenmiş bakım medya ile.
  8. Cardiomyocytes plaka üzerine tohum sonra hücrelerin eşit dağıtmak ve hücre doku kültürü kuluçka için plaka aktarmadan önce 10-20 dk için eklemek izin.
  9. 24 yeniden kaplama sonra s monitör hücre eki ve kurtarma.
    Not: Kayan (ölü) hücreleri varlığı yaygındır. 48-72 saat sonra yeniden kaplama, cardiomyocyte kendiliğinden kasılma devam.
  10. Cardiomyocyte kültürü korumak için medya % 50'si gibi ventriküler cardiomyocytes kullanımı kadar geçen her gün sonraki deneyler için bakım ortamı ile değiştirin.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

HPSCs nesil ID1 satırları
hPSCs ID1 overexpression (Şekil 1A) arabuluculuk bir lentivirus bulaşmış. Bir kez hPSCID1 oluşturulur, transgene ifade qRT-PCR (Şekil 1B) sayılabilir. Yalnızca hPSCID1 satırları ID1 mRNA GAPDH of 0.005 kat büyük seviyelerde ifade farklılaşma için kullanılmalıdır.

hPSCs ID1 Bakım ve D için hazırlık ifferentiation
En iyi kültür koşulların olması gerekli ve kritik için başarılı ilk kalp alan benzeri kardiyak progenitör farklılaşma (Şekil 2A). hPSCID1 kültürler her gün kök morfoloji bakım ve sürekli yayılması için takip edilmelidir. Farklılaşma sıkıca paketlenmiş kök hücre kolonileri ulaştığında başlatılan > % 90 confluency (resim 2B). Farklılaşma en uygun confluency önce başlatılır, hücre ölümü gelişmiş ve farklılaşma verimliliği (Şekil 2C) düşebilir. Benzer şekilde, fazla gelişmiş kültürleri kötü (Şekil 2D) gerçekleştirir.

İlk kalp alan benzeri kardiyak ataları (FHF-L CPs) nesil hPSCs ID1
Gün 1 (24 h mesaj ayırt etme girişimi), hücre kaybı kök morfoloji (hücreler düz ve kök hücreler daha koyu görünür) gözlemlemek için izlenmelidir. Not hücre ölümü ortak farklılaşma ilk gün boyunca, ancak hücre izdiham yönü muhafaza > %75 (Şekil 2E). Farklılaşma 24 saat sonra % 50 veya daha fazla kapalı yüzey alan kaybolursa, hücreleri atılmalıdır.

Günde 3, ayırt hücreleri kümelenmiş kalmalıdır ve ilk 24 saat zaman dilimi (Şekil 2F) sırasında oluşturulan boşlukları doldurdu. Düz hücreler bağımsız olarak büyüyen suboptimal farklılaşma koşulları işaret etmektedir.

4 günde optimum farklılaşma sürekli genişleme ve plaka kapsama göstermelidir.

5 günde, hücre hasat ve cryopreserved. En iyi saptamaları sıkıca bağlı hücre kümeleri homojen morfoloji görünümü (Şekil 2G) ile sonuçlanmalıdır. Düşük yoğunluklu kümeleri düz hücre suboptimal farklılaşma sonucu işaretlemek unutmayın. Tablo 2 formatları çeşitli bir kuyu başına 5 kalp ataları kültür gün ortalama verim için bkz.

Ventrikül benzeri Cardiomyocytes FHF-L CPs gelen nesil
Gün 5 FHF-L CPs onların kalp farklılaşma potansiyel maksimize etmek için Tablo 2' de açıklanan plaka biçimi bağımlı yoğunlukları (Şekil 3vebir Tablo 2) çözdürülen. Çözdürme sonra canlılığı izlenmesi gerekiyor. Genel olarak, canlılığı aralığından % 70-80 '. Canlılığı %60 altında ise, cardiomyocytes verimini etkiler.

Gün 6 farklılaşma çıkıldıktan sonra (24 saat), FHF-L CPs kapsaması gereken > mevcut yüzde 90'ını yüzey alanı ve homojen tek bir katman hücre (Şekil 3B) görünür. Günde 6 düşük izdiham cardiomyocytes içine FHF-L CPs farklılaşma azaltacaktır.

Gün 11-13 tarafından farklılaşma (Şekil 3C ve Film 1) yenmek ortaya çıkan cardiomyocytes başlayın. Gün 14-16 replating işlemi sırasında cardiomyocytes çeşitli kültür biçimleri bir kuyu başına ortalama verim için bkz. Tablo 2 . Farklılaşma verimliliği genellikle kalp (ACTC1), fibroblast (TAGLN) ve vasküler endotel işaretleri (CDH5) ve nükleer (DAPI) işaretleri için ayirt tarafından değerlendirilir. Lineage miktar Cunningham vd gibi otomatik görüntüleme ve floresan miktar kullanılarak gerçekleştirilir (2017) 5 (Şekil 3D-E). Elde edilen cardiomyocytes karakterizasyonu alt türü qRT-PCR (Şekil 3F) ve aksiyon potansiyeli geçici analiz kinetik görüntüleme ve problar (Şekil 3G ve film 2) algılama gerilim tarafından gerçekleştirilir. Floresans miktar gerilim probu ve elde edilen Aksiyon potansiyeli izleme çözümleme (Şekil 3H) McKeithan ve ark. içinde açıklandığı gibi gerçekleştirilir (2017) 7.

Figure 1
Resim 1: hPSC nesilID1 satırları. (A) hPSCsID1 üretimi iletişim kuralını şematik gösterimi. (B) lentiviral-aracılı ifadeden hPSCID1 bir hESC satır dahil olmak üzere farklı satırları ve hPSC satırları iki satırlık tarafından oluşturulan temsilcisi ID1 mRNA düzeylerini gösteren qRT-PCR sonuçları örnekleri. Kesikli çizgi ID1 ifade eşik, hangi hPSCID1 satırların ek çevriminin ID1-lentivirus enfeksiyon geçmesi gerekir temsil eder. "p" geçiş gösterir. Parantez içinde ID1-lentiviral enfeksiyon tur sayısını gösterir. Hata çubukları nüsha gerçekleştirilen deneyler standart sapması temsil eder. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Şekil 2: Üretimi, ilk kalp Field-Like kardiyak ataları (FHF-L CPs) farklılaşma üzerinden hPSCID1. (A) FHF-L CP üretimi iletişim kuralını şematik gösterimi. HPSCID1 (0 gün) en uygun (B), fotoğraflarını temsilcisi parlak alan alt birleşmesi (sarı ok uçları belirtmek hücreler arasında geçersiz bölgeler) (C) ve aşırı birleşmesi (D) yoğunluğu. Gün 1, hPSCID1 ayırt temsilcisi alan parlak resimleri 3 ve 5 sırasıyla (E), (F), (G). Ölçek çubuğu 100 µm. = Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: ventriküler benzeri Cardiomyocyte FHF-L CPs gelen nesil. (A) Ventrikül benzeri cardiomyocyte üretimi iletişim kuralını şematik gösterimi. (B) parlak alan görüntü gün 6 farklılaşma hücre (bir gün sonrası çözdürme). (C) parlak alan görüntü gün 12 dayak kültürünün. (D) temsilcisi ayirt görüntü gün 15 kültürlerin (384-şey plaka biçimi). ACTC1 cardiomyocytes, TAGLN işaretler: fibroblastlar/düz kas, CDH5: vasküler endotel hücreleri ve DAPI: çekirdek (ilave gösterilir). (E) Lineage miktar gün 15 kültürlerin. (F) qRT-PCR veri sahası ifade 5 günden güne 25 ventrikül özgü işaretleri (IRX4 ve MYL2) ve pan-kardiyak marker (MYL7) zaman. (G) temsilcisi Aksiyon potansiyeli izleme gibi ventriküler cardiomyocytes gün 25 farklılaşma. (H) Aksiyon potansiyeli süresini ölçümleri (APD50 ve APD90) elde edilen ventrikül benzeri cardiomyocytes (n = 12). Hata çubukları standart sapma (aksi belirtilmedikçe) quadruplicate içinde gerçekleştirilen deneyler temsil eder. Ölçek çubukları 100 µm. RFU, göreli floresans birimi =. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Orta Temel orta Katkı
Kök hücre medya mTesR1 n/a
İndüksiyon medya RPMI 1640 orta B-27 Serum ücretsiz ek insülin olmadan, 1 x
İndüksiyon medya RPMI 1640 orta Puromisindir, 6 µg/ml
İndüksiyon medya RPMI 1640 orta Penisilin-streptomisin, 1 x
Kardiyojenik medya RPMI 1640 orta B-27 Serum ücretsiz ek, 1 x
Kardiyojenik medya RPMI 1640 orta Penisilin-streptomisin, 1 x
Bakım medya RPMI 1640 orta B-27 Serum ücretsiz ek, 1 x
Bakım medya RPMI 1640 orta Nakavt Serum değiştirilmesi, %2
Bakım medya RPMI 1640 orta Penisilin-streptomisin, 1 x

Tablo 1: Ortam bileşenleri (malzemeler tablo temel medya ve katkı maddeleri için bakınız).

384 iyi 96 iyi 12 iyi 6 iyi 100 mm 150 mm
Kaplama birim (başına de) 10 ΜL 50 ΜL 500 ΜL 1 mL 5 mL 10 mL
Orta ses
(de)
100 ΜL 300 ΜL 2 mL 5 mL 12 mL 30 mL
Farklılaşma gün 0 aktivin bir konsantrasyon (ng/mL) 100 100 100 300
Kardiyak dede
5. gün verim
(hücre/de)
1.0-1.2 10 x5 2.5-3.0 10 x5 1.0-1.5 x 107 2.0-3.0 x 107
Kardiyak yaratıcı 5 gün replating veya yoğunluğu (hücre/de) çözme 2.0 x 104 7.5 x 105 4.5 x 106 8.0 x 106 2.2 x 107
Ventriküler benzeri cardiomyocyte
14-16 gün verim
(hücre/de)
2.0 – 5.0 x 104 0,8-1.2 x 106 3,5-5,0 10 x6 0,8-1.2 x 107 1,8-2,5 x 107
Yoğunluğu replating ventriküler benzeri cardiomyocyte
(hücre/de)
2.5 x 104 1.0 x 106 4.5 x 106 1.0 x 107 2.2 x 107

Tablo 2: Ölçeklenebilir farklılaşma parametreleri (kaplama birim, orta hacim, aktivin A konsantrasyonu, verimleri, yoğunlukları replating).

Gen adı Gen Bankası katılım Sıra
GAPDH NM_001256799 F: GGAGCGAGATCCCTCCAAAAT
BİLGİ: GGCTGTTGTCATACTTCTCATGG
fare ID1 NM_010495 F: CCTAGCTGTTCGCTGAAGGC
BİLGİ: CTCCGACAGACCAAGTACCAC
IRX4 NM_016358 F: GGCTCCCCAGTTCTTGATGG
BİLGİ: TAGACCGGGCAGTAGACCG
MYL2 NM_000432 F: TTGGGCGAGTGAACGTGAAAA
BİLGİ: CCGAACGTAATCAGCCTTCAG
MYL7 NM_021223 F: GCCCAACGTGGTTCTTCCAA
BİLGİ: CTCCTCCTCTGGGACACTC

Tablo 3: qRT-PCR astar dizileri.

Movie 1
Film 1: parlak alan kaydı (100 kare/sn) nerede spontan kasılmalar görülebilir gün 15 cardiomyocytes. Bu videoyu izlemek için lütfen buraya tıklayın. (İndirmek için sağ tıklatın.)

Movie 2
Movie 2: kinetik görüntüleme (100 kare/sn) voltaj duyarlı floresan sondayı içeri gün 25 ID1 indüklenen gibi ventriküler cardiomyocytes. Bu videoyu izlemek için lütfen buraya tıklayın. (İndirmek için sağ tıklatın.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Başarılı saptamaları için yakından yukarıda listelenen yönergeleri izleyin emin olun. Ayrıca, burada biz güçlü etkisi farklılaşma sonuçlar anahtar parametreleri vurgulayın. Bir farklılaşma başlamadan önce aşağıdaki üç morfolojik parametreleri dikkat edilmelidir: hPSCsID1, yüksek hücresel sıkıştırma ve yüksek bir izdiham bir kök morfolojisi (> % 90) gün 0 kültürünün. Bu konuda en iyi farklılaşma koşulları en iyi ayrışmış kaplama hPSCsID1 tek hücreler olarak oluşturulur ve onları sıkıca forma izin büyümek monolayers ~ %90 izdiham için 2-3 gün süresince kümelenmiş. Tersine, hPSCID1 kültürler zavallı hücre ve koloni morfolojisi, düşük koloni sıkıştırma ve farklılaşma kültür içinde geniş alanlar varlığı gösterirsen, başarılı FHF-L CP farklılaşma olası.

Ortam birimi ve aktivin A konsantrasyonları FHF-L CP farklılaşma ve plaka biçimi-bağımlı (bkz. Tablo 2) önemli parametreleridir. Ayrıca en iyi aktivin A konsantrasyonları kullanılan hPSC satır bağlı olarak değişebilir ve konsantrasyon optimizasyon gerekli olabilir unutmayın.

HPSCs ID1 mRNA seviyelerinde çok verimli bir şekilde FHF-L CP. Suboptimal tanıtmak için ID1 düzeyleri sağlam FHF-L CP farklılaşma üretmek başarısız olur ve büyük hücre ölümü gün 1 farklılaşma tarafından tespit edilecektir önemlidir. ID1- için -GAPDH göreli ifade oranı 0.005 verimli farklılaşma tanıtmak için aşması gerekmektedir. Devam eden seçimi daha yüksek doz puromisindir (6-10 µg/mL) kullanarak lentiviral-aracılı ID1 ifade yüksek düzeyde korumak için önerilir. Bir değerlendirme ID1 mRNA düzeylerinin her 10 pasajlar önerilir.

5. gün yoğunlukları kaplama FHF-L CPsis kardiyak farklılaşma verimlilik için de kritik bir parametre. Eğer 5 gün FHF-L CPs düşük yoğunlukları kaplama, göreli kardiyak verim azalacak. En uygun kaplama yoğunlukları Tablo 2 ' de listelenen ve plaka biçimi bağımlı.

Bu iletişim kuralı için ana sınırlama lentiviral-aracılı ID1 overexpression ortaya çıkan ataları ve ventrikül benzeri cardiomyocytes terapötik kullanımı kısıtlamak promoteFHF-L CP farklılaşma için kullanılır. Lentiviruses sitelerinde potansiyel etkiler hPSC bakım ve/veya gelişim potansiyeli, hPSCsID1 koloniler stemness değerlendirerek takip edilmelidir ki entegre olabilir beri Ayrıca, gen ekspresyonu ve morfolojik belirtileri gözlemlemek kaynaklanıyor farklılaşma. ID1 overexpressing bütünleştirici vektörler kullanarak ve bu sınırlamayı aşmak Şu anda bizim laboratuvar olarak araştırılmaktadır unutmayın.

Sadece bir sitokin, aktivin A FHF-L CPs hPSCsID1oluşturmak için gereğine uygun bir özellik bu yöntemin farklılaşma Protokolü basitliğidir. Buna karşılık, diğer iletişim kuralları 9,10,11,12,13,14,15 gerektiren karmaşık dizileri sitokinler kombinasyonları ve/veya küçük moleküller teşvik etmek ve kardiyak farklılaşma korumak için. Ayrıca, bu iletişim kuralı benzersiz olarak sonraki cardiomyocyte üretim FHF-L CP nesilden çözmek için sağlayan bir uygun dondurma adımlar açıklanmaktadır. Bu özellik, biobank büyük toplu işlemleri için sağlar FHF-L CPS ve cardiomyocytes dondurulmuş ataları hızla oluşturmak için kardiyak farklılaşma sürdürür çözdürme üzerine 5 günden. 1-2 hafta ile karşılaştırıldığında kalp farklılaşma hPSCs başlayarak zaman kazanmak için bu strateji sağlar. Buna ek olarak ve en önemlisi, bu ilk diğer iletişim kuralları9,10,11,12 süre tanımlanmış kalp alan kökenli kalp ataları oluşturmak için tarihine protokoldür ,13,14,15 o konuda tanımsız kalır.

Özet olarak, bu iletişim kuralını büyük miktarlarda üretmek için güçlü ve ölçeklenebilir bir yöntem özetlenmektedir (> 108–109) gelişimsel olarak ilgili FHF-L CPs ve ventrikül benzeri cardiomyocytes. Buna karşılık, elde edilen hücreleri kardiyak farklılaşma ve fizyoloji, kontrol roman yasal yolları tanımlamak için kullanılabilir ve rejeneratif ve amaçlar modelleme hastalığı.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Biz yararlı tartışmalar Colas laboratuvar üyeleri ve kritik değerlendirme şekilde alt alta yazılmalıdır teşekkür ederim. Bu çalışmada NIH/NIEHS R44ES023521-02 tarafından desteklenen ve Dr Colas CIRM DISC2-10110 verir.

Materials

Name Company Catalog Number Comments
ACTC1 antibody Sigma A7811
Activin A Stem Cell Technologies Hu Recom Activin A
Antibiotic Antimycotic (Anti-Anti) Thermo Fisher Scientific 15240062
B27 supplement Thermo Fisher Scientific 17504044
B27 supplement w/o - insulin Thermo Fisher Scientific A1895601
B27 supplement w/o - vitamin A Thermo Fisher Scientific 12587001
CDH5 antibody R&D Systems AF938
CryoStor CS10 Stem Cell Technologies 7930 Cryopreservation reagent
DMEM high Glucose Mediatech 10-013-CV 
DPBS w/ Ca & Mg Corning 21-030-CV
EDTA Thermo Fisher Scientific 15575-038
FBS VWR 89510-186
FluoVolt membrane potential kit   Thermo Fisher Scientific F10488 For optical action potential acquisition, please refer to McKeithan et al. 2017
KnockOut Serum Replacement Gibco 10828010
Matrigel, Growth Factor Reduced Corning 356231 Coating reagent
mTeSR1 media kit Stem Cell Technologies 5850
PBS w/o Ca & Mg Corning 21-040-CV
Penicillin-Streptomycin Gibco
Puromycin  Acros 227422500
ReLeSR Stem Cell Technologies 5872 Enzyme-free dissociation reagent
RPMI 1640 Thermo Fisher Scientific 11875-093
TAGLN antibody Abcam ab14106
Thiazovivin Stem Cell Technologies 72254 RHO/ROCK pathway inhibitor
TrypLE Express Thermo Fisher Scientific 12605 -010 1X enzyme-containing dissociation reagent
Tyrodes solution mix packets   Sigma T2145-10X1L (For optical action potential acquisition, please refer to McKeithan et al. 2017)

DOWNLOAD MATERIALS LIST

References

  1. Chong, J. J., et al. Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature. 510, 273-277 (2014).
  2. Kodo, K., et al. iPSC-derived cardiomyocytes reveal abnormal TGF-beta signalling in left ventricular non-compaction cardiomyopathy. Nature cell biology. 18, 1031-1042 (2016).
  3. Kim, C., et al. Studying arrhythmogenic right ventricular dysplasia with patient-specific iPSCs. Nature. 494, 105-110 (2013).
  4. Colas, A. R., et al. Whole-genome microRNA screening identifies let-7 and mir-18 as regulators of germ layer formation during early embryogenesis. Genes & development. 26, 2567-2579 (2012).
  5. Cunningham, T. J., et al. Id genes are essential for early heart formation. Genes & development. (2017).
  6. McKeithan, W. L., Colas, A. R., Bushway, P. J., Ray, S., Mercola, M. Serum-free generation of multipotent mesoderm (Kdr+) progenitor cells in mouse embryonic stem cells for functional genomics screening. Current protocols in stem cell biology. Chapter 1, Unit 1F 13 (2012).
  7. McKeithan, W. L., et al. An automated platform for assessment of congenital and drug-induced arrhythmia with hipsc-derived cardiomyocytes. Frontiers in physiology. 8, 766 (2017).
  8. Sharma, A., et al. High-throughput screening of tyrosine kinase inhibitor cardiotoxicity with human induced pluripotent stem cells. Science translational medicine. 9, (2017).
  9. Burridge, P. W., et al. Chemically defined generation of human cardiomyocytes. Nature methods. 11, 855-860 (2014).
  10. Kattman, S. J., et al. Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines. Cell stem cell. 8, 228-240 (2011).
  11. Laflamme, M. A., et al. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nature biotechnology. 25, 1015-1024 (2007).
  12. Lian, X., et al. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the National Academy of Sciences of the United States of America. 109, 1848-1857 (2012).
  13. Willems, E., et al. Small molecule-mediated TGF-beta type II receptor degradation promotes cardiomyogenesis in embryonic stem cells. Cell stem cell. 11, 242-252 (2012).
  14. Yang, L., et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic-stem-cell-derived population. Nature. 453, 524-528 (2008).
  15. Palpant, N. J., et al. Generating high-purity cardiac and endothelial derivatives from patterned mesoderm using human pluripotent stem cells. Nature protocols. 12, 15-31 (2017).
  16. DeLaughter, D. M., et al. Single-cell resolution of temporal gene expression during heart development. Developmental cell. 39, 480-490 (2016).
  17. Liu, X., et al. The complex genetics of hypoplastic left heart syndrome. Nature genetics. 49, 1152-1159 (2017).
  18. Corrado, D., Link, M. S., Calkins, H. Arrhythmogenic right ventricular cardiomyopathy. New England journal of medicine. 376, 1489-1490 (2017).
  19. Kitamura, T., et al. Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Experimental hematology. 31, 1007-1014 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics