게놈을 편집 하 여 초파리 에서 조직 관련 이진 전사 시스템을 생성 하기 위한 효율적인 전략

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

여기, 우리가 첫 번째 코딩 exon 유전자의 전사 드라이버 대체 하 여 초파리 에서 조직 관련 이진 전사 시스템을 생성 하기 위한 방법 제시. CRISPR/Cas9-기반 방법 대체 유전자의 생 규칙에서 transactivator 시퀀스를 장소 따라서 유전자 특정 spatiotemporal 패턴에 독점적으로 transctivator 식을 촉진 한다.

Cite this Article

Copy Citation | Download Citations

Du, L., Zhou, A., Sohr, A., Roy, S. An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing. J. Vis. Exp. (139), e58268, doi:10.3791/58268 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

이진 전송 시스템은 강력한 유전적 도구를 시각화 하 고 조작 하는 셀의 특정 그룹에서 세포 운명과 유전자 식 또는 조직 모형 유기 체에서 널리 이용 되는. 이러한 시스템 별도 유전자 변형 라인으로 두 개의 구성 요소가 포함 되어 있습니다. 드라이버 라인 조직의 특정 발기인/강화, 제어 및 대상 유전자의 녹음 방송 활성 제 바인딩 사이트에 하류 배치 기자/이펙터 라인 항구 transcriptional 활성 제를 표현 합니다. 두 구성 요소를 품고 동물 대상 유전자 발현의 조직-특정 transactivation 유도. 대상된 조직에 유전자의 정확한 spatiotemporal 식 세포/유전자 활동의 편견된 해석에 대 한 중요 하다. 따라서, 독점 세포/조직 관련 드라이버 라인을 생성 하기 위한 방법 개발이 필수적입니다. 여기에 우리가 매우 조직 특정 대상된 식 시스템을 채용 하 여 생성 하는 방법을 제시는 "정기적으로 클러스터 된 Interspaced 짧은 구조 반복/CRISPR-관련 된" (CRISPR/Ca)-게놈 편집 기법을 기반으로. 이 방법에서는, Cas9 공상 두 대상 이다 endonuclease RNAs (gRNA) 더블-스트랜드 나누기 (DSB) 만들려고 초파리 게놈에서 유전자의 첫 번째 코딩 exon에 특정 사이트 안내. 그 후, transactivator 시퀀스를 포함 하는 외 인 기증자 플라스 미드를 사용 하 여 셀 자치 수리 기계 수 있습니다 homology 감독 수리를 (HDR) 정확한 삭제 하 고는 transactivator와는 엑손의 교체 DSB의 시퀀스입니다. 절에서 transactivator 셀에 독점적으로 표현 된다 어디 cis-대체 유전자의 규제 요소가 기능. 여기에 제시 된 초파리 fgf에 표현 하는 이진 transcriptional 드라이버 생성에 대 한 자세한 단계별 프로토콜 /branchless-상피/신경 세포 생산 유전자 또는 조직의 특정 식에 대 한 채택 될 수 있다.

Introduction

타겟된 유전자 발현에 대 한 유전 도구 상자 잘 초파리, 다양 한 세포질 프로세스에서에서 포함 된 유전자의 기능을 조사 하기 위해 최고의 모델 시스템 중 하나에서 개발 되었습니다. 이진 식 시스템, 효 Gal4/UAS (상류 활성화 순서), 초파리 유전자 모델1 (그림 1)에서 조직 관련 증강 트랩 및 유전자 misexpression에 처음 채택 되었다. 이 시스템 기법 유전자 overexpression, misexpression, 선택 된 셀 그룹에 또한 셀 절제, 셀 표시, 세포질이 고 분자의 라이브 추적에서 녹아웃 spatiotemporal 규제 등의 많은 수의 개발을 촉진 배아와 조직, 계보 추적 및 모자이크 분석 개발 하는 동안에 처리 합니다. LexA세균성 같은 이진 전사 시스템의 수 /LexAop 시스템 (그림 1)와 Neurospora Q-시스템, 초파리, 이외에에서 널리 사용 지금 되는 강력한 유전자 도구 타겟된 유전자 식1,2,3에 대 한 원래 Gal4/UAS 체계.

여기, 우리는 게놈 편집 기법을 사용 하 여 신뢰할 수 있는 조직 관련 이진 식 시스템을 생성 하는 방법을 제시. CRISPR/Cas9 게놈 편집 기술에 있는 최근 전진은 전례 없는 기회를 생물의 광범위 한 범위에서 감독된 게놈 변화를 만들 수 있다. 다른 사용 가능한 게놈 편집 기술에 비해, CRISPR/Cas9 시스템은 저렴 한 효율적이 고 신뢰할 수 있는. 이 기술은 이용 한다 세균성 적응 면역 시스템의 구성 요소: Cas9 endonuclease 만드는 두 배 물가 틈 (DSB), 연쇄 상 구 균 pyogenes 및 공상 가이드 RNA (gRNA)는 Cas9에 대 한 특정 게놈 사이트 안내 타겟된 DSB4. 셀은 DSB 다른 경로 사용 하 여 복구 하는 기계를 포함 합니다. 비 동종 끝 결합 (NHEJ) 템플릿으로 exogenous HDR 기증자를 사용 하 여 정의 된 감독/바람직한 게놈 노크에서 / 노크-아웃을 소개 하는 homology 감독 수리 (HDR) 동안 유전자 기능을 방해 작은 삽입 또는 삭제를 리드. HDR-기반 대체 전략 전통적인 증강 트랩 메서드의 모든 한계를 극복할 수 있는 매우 신뢰할 수 있는 조직 관련 이진 식 시스템을 생성 하기 위해 효율적으로 활용할 수 있습니다. 우리 초파리의 내 생 transcriptional 및 post-transcriptional 규정의 제어에서 표현 되는 이진 전사 드라이버 라인 생성에 CRISPR/Cas9 기반 HDR 수리의 활용에 대 한 단계별 절차를 설명 유전자. 이 프로토콜에 대 한 특정 드라이버 라인의 세대 설명 branchless (bnl) 유전자 조절 tracheal 기도 상피5분기 morphogenesis FGF 가족 단백질을 인코딩. 이 예제에서 bnl 유전자의 첫 번째 코딩 exon 어떤 생 ci를 변경 하지 않고 세균 LexA transactivator 시퀀스의 순서에 의해 대체 되었다- bnl 유전자의 규제 시퀀스. 우리는 전략 생성 bnl LexA 드라이버 라인 spatiotemporally 독점적으로에서 bnl- LexAoperator (LexAop 또는 LexO)의 다운스트림 배치 취재 원 유전자의 표현을 제어 하는 표시 상피/엽/신경 세포를 표현합니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. 설계 및 건설 gRNA 표정 벡터

  1. 정확 하 게는 엑손의 긴 정의 된 영역을 대체 하려면 듀얼 gRNA 접근6, 있는 각 gRNA 특별히 선택 된 관심 영역의 두 끝을 타겟팅 할 수 있습니다 사용 합니다. 정확한 유전자 특정 spatiotemporal 표현의 드라이버를 얻으려면 첫 번째 코딩 exon 유전자의 두 gRNA 대상 사이트를 선택 합니다.
  2. 초파리 melanogaster, flyCRISPR 최적의 대상 찾기 도구 (http://tools.flycrispr.molbio.wisc.edu/targetFinder/)를 사용 하 여 gRNA 대상 사이트를 선택 합니다. 다른 사용 가능한 CRISPR 디자인 도구 사용할 수 있습니다 뿐만 아니라, 최적화 CRISPR 디자인 도구 (http://crispr.mit.edu), FlyCas9를 포함 하 여 (https://shigen.nig.ac.jp/fly/nigfly/cas9), 및 E-선명 (www.e-crisp.org/E-CRISP).
    참고: gRNA 디자인 및 복제의 다음과 같은 프로토콜 방법 앞에서 설명한6,7에서 채택 되었다.
    1. 온라인 도구에 제공 된 상자에 실제 시퀀스를 복사 합니다. "선택 게놈"에 대 한 드롭 다운 메뉴에서 가장 최근에 출시 된 초파리 melanogaster 게놈 주석 버전, "r_6,"를 선택 필드 "선택 가이드 길이에서 (nt)," "20." 입력 "모든 CRISPR 대상"을 찾아서 "CRISPR 대상 찾기"를 클릭 하 여 선택 합니다.
    2. "팸"에 대 한 "엄중"와 "NGG만"에 대 한 "최대"를 설정 하 여 모든 후보 gRNA 목표를 평가 합니다. 어떤 잠재적인 오프-대상 또는 대상에서 가능한 최소 수 없이 gRNA 사이트를 선택 하려고 합니다. 웹 도구를 사용 하 여 Doench 그 외 여러분 2014 8 선택 gRNAs 잠재적인 "좋은" 활동 점수를 설명 합니다.
    3. 동시에, 거기는 없습니다 단일 염기 다형성 gRNA 대상에 주입 (예를 들어, nos Cas9 X 염색체, BL # 54591)에 대 한 선택 된 부모 플라이 라인의 게놈에 확인 합니다. Gratz 외. 20157 부모 비행 라인에서 게놈 DNA 추출에 설명 된 프로토콜을 따릅니다. PCR 증폭, 관심과 높은 충실도 DNA 중 합 효소;의 순서 측면 뇌관을 사용 하 여 500-1000 nt 지역 약, 시퀀스를 PCR 증폭 제품 확인 합니다.
  3. 탠덤 gRNA 식 벡터를 생성 한 결 찰 독립적인 복제 프로토콜6 pCFD4 RNA 식 벡터 두 protospacer 시퀀스를 따릅니다. 참고 향상 된 멀티-gRNA 식 벡터 (pCFD5)는 지금 사용할 수 어디에 두는 sgRNAs 강한 U6:3 발기인9 (https://www.crisprflydesign.org)에서 표현 됩니다. PCFD4 벡터에는 gRNAs를 복제 하는 DNA 어셈블리 메서드를 사용 합니다.
    1. 디자인 하 고 RNA 식 벡터 pCFD4에 두 protospacer 시퀀스를 도입에 대 한 정방향 및 역방향 뇌관 순서 (테이블 1A). 앞에서 설명한6, 앞으로 뇌관 U6-1 발기인 및 pCFD4; gRNA 코어에 해당 하는 영역을가지고 있는 첫 번째 protospacer 시퀀스가 포함 되어 있는 반전 뇌관 영역에 해당 하는 gRNA 코어와 pCDF4의 U6-3 발기인에 의해 형벌 두 번째 protospacer의 반전 보수 시퀀스를 포함 되어 있습니다.
    2. DNase과 RNase 무료 이중 증류수 (ddH2O)와 100 μ M에 프라이 머 resuspend 10 μ M 작업 농도 뇌관을 확인 합니다. PCFD4 플라스 미드를 사용 하 여 서식 파일로 하 고 PCR 반응 높은 중 합 효소를 사용 하 여 PCR 반응6에 대 한 설정을 권장 합니다.
    3. PCFD4로 증폭 된 제품을, 다음 반응을 설정 하 여 BbsI 효소로 플라스 미드 pCFD4 소화: pCFD4 플라스 미드의 2-5 μ g, 소화 버퍼 x 10의 5 μ, BbsI 효소 및 ddH2O 50 μ를 최종 볼륨을가지고 1 μ. 부드럽게 튜브를 활용 하 고 간단한 스핀에 의해 바닥에 튜브의 벽에서 흩어져 모든 방울을 수집 하 여 반응 내용을 혼합. 2 h 37 ° C에서 반응 혼합 품 어.
    4. 2 단계와 3 단계에서 소화 제품에서 1 %agarose 젤에 PCR 제품을 실행 합니다. 충분 한 시간을 완전히 DNA 밴드를 분리에 대 한 전기 영동을 수행 합니다. 잘라 올바른 예상된 제품 제조업체의 지시에 따라 젤 차입 열을 사용 하 여 정화 하기 전에 UV 트랜스-조명 아래 DNA 밴드 크기 ( 재료의 표참조). PCR 제품은 600 해야 혈압, 및 선형화 pCFD4 플라스 미드 ~6.4 kb 6이어야 한다.
    5. 제조업체의 지시 당, PCR 튜브에 DNA 어셈블리 반응 설정 ( 재료의 표참조).
    6. 유능한 박테리아 (DH5α 또는 ΔrecA1, ΔendA1와 유사한 긴장) 어셈블리 제품의 2 μ 변환, 암 피 실린에 접시 (100 μ g/mL) 파운드 (LB/앰프) 한 천 배지를 포함 하 고 37 ° C에서 밤새 품 어. DNA 어셈블리 혼합 유의 특정 박테리아 계통에 독성이 있을 수 있지만 어셈블리 혼합을 diluting 독성을 줄일 수 있습니다.
    7. 밤새 incubated 접시에서 3-4 암 피 실린 내성 식민지를 선택 하 고 접종 3 ml 파운드 100 μ g/mL 암 피 실린, 포함 된 식민지 하룻밤 37 ° C 통에 접종된 박테리아를 성장. 제조업체의 지시에 따라 플라스 미드 소형 예비 키트를 사용 하 여 하룻밤 배양 박테리아에서 플라스 미드를 추출 ( 재료의 표참조).
    8. 탠덤 gRNA 삽입을 포함 하는 올바른 클론에 대 한 화면에 보편적인 뇌관 T3 플라스 미드를 시퀀스. 박테리아는 시퀀스 확인 pCFD4-gRNA 20% 글리세롤에서와 나중에 사용-80 ° C 냉동 고에 게 변환의 글리세롤 재고를 설정 합니다.

2. 설계 및 건설 HDR 기증자

  1. 에 대 한 게놈 노크 Gal4 또는 LexA 시퀀스의, 두 상 동 팔에 의해 형벌 transactivator 시퀀스가 포함 된 더블-좌초 HDR 기증자 디자인.
    1. 사용 > 1.5 kb 왼쪽과 오른쪽 상 동 팔 gRNA를 대상으로 측면에 서는 사이트. 확장된 상 동 팔 복구 프로세스 10동안 HDR의 효율성을 증가.
    2. PCR 증폭 주입을 위해 선택 된 부모 비행 라인에서 추출한 게놈 DNA (gDNA)에서 상 동 팔 (예, 개-Cas9 (X 염색체)에 BL # 54591). 긴 PCR 확장에 적합 한 감수 핫 스타트 Taq DNA 중 합 효소 효소를 사용 하 여 ( 재료의 표참조). 시퀀스 확인 합니다.
  2. 설계 현장에 gRNA의 retargeting를 방지 하려면 대체 기증자 gRNA 인식 사이트 소개 exogenous 시퀀스에 의해 혼란 된다 그런 방법으로 디자인.
    참고: 변경 상 상속 시스 규정 요소를 방지 하려면 항상 gRNA 인식 사이트 코딩 exon 지역 내에서 선택 합니다.
  3. 교체 카세트를 생성 하기 위한 4 개의 세그먼트를 함께 가입 DNA 어셈블리 전략 계획: 5'과 3' 상 동 팔, 중간 세 transactivator DNA 시퀀스 및 선형화 복제 벡터 백본 (예: pUC19 또는 기타 통용 된다 클로닝 벡터). DNA 어셈블리에 대 한 제조업체의 지침에 따라 (재료의 표 참조), PCR 확대 및 각 세그먼트에 대 한 적당 한 뇌관 디자인. DdH2O. 확인 10 μ M 작업 농도 뇌관 100 μ M에 프라이 머 resuspend 높은 중 합 효소를 사용 하 여 모든 PCR 반응에 대 한. 다음 프로토콜을 따르십시오.
    1. PCR 증폭에서 사용 가능한 벡터 Gal4 또는 LexA 식 카세트 (예를 들어, nls-LexA:p65; 이상적인 Gal4/LexA/QF2 식 플라스 미드를 찾아내고 Addgene 같은 일반적인 자원에서 얻은 수 있습니다) 사용 하는 표 1B에 나열 한 뇌관
      1. 모든 원래 transcriptional 및 post-transcriptional의 규정 transactivator DNA 시퀀스의 표현에 대체 exon 유지 하려면 편집된 게놈 대립 유전자 공상 mRNA 표현 것 이다 그런 방법으로 카세트 디자인의 transactivator 그리고 유전자입니다. 어떤 접합 신호를 유지 하기 위해 타겟된 exon 5'과 3' 끝을 유지 합니다.
      2. 잔여 5' exon와 공상 단백질으로 번역을 방지 하기 위해 transactivator 시퀀스 코딩 사이 T2A 자체 cleaving 펩 티 드 순서를 통합 합니다. (그림 5) 외 인 transactivator 시퀀스 후 번역 정지 codon를 추가 합니다.
    2. PCR 증폭 주입을 위해 선택 된 부모 비행 라인에서 추출한 게놈 DNA (gDNA)에서 상 동 팔 (예, 개-Cas9 (X 염색체)에 BL # 54591) 표 1B에 나열 된 뇌관을 사용 하 여. 높은 중 합 효소를 사용 하 여 다음과 같은 시스템을 사용 하 여 모든 PCR 반응: 반응 버퍼, 10mm dNTPs의 0.5 μ, 10 μ M의 1.25 μ x 5의 5 μ 앞으로 뇌관, 10 μ M의 1.25 μ 반전 뇌관, 서식 파일 DNA, 0.25 μ 고 충실도 DNA 중 합 효소의의 0.5 μ DdH2오의 16.25 μ
    3. PUC19 같은 선형화 클로닝 벡터를 사용 합니다. 기증자 벡터 수 지금 사용할 수 있습니다. 다음 웹사이트 http://flycrispr.molbio.wisc.edu에서 포괄적인 목록 참조 하십시오.
    4. 1 %agarose 젤에 PCR 제품을 실행 합니다. 원치 않는 일반적인 밴드 (있을 경우)에서 원하는 밴드의 명확한 분리를 보장 하기 위해 충분 한 시간에 대 한 전기 영동을 수행 합니다. 젤-정화 예상된 DNA 파편. 분 광 광도 계를 사용 하 여 각 순화 된 DNA 파편의 농도 측정 합니다.
    5. 제조업체의 지시에 따라 DNA 어셈블리 반응을 설정 합니다. 단계 3에서에서 선형화 클로닝 벡터 및 대상 조각 믹스와 다음 반응에서 4 단계: 선형의 1 μ ddH와 20 μ를 최종 반응 볼륨을가지고 클로닝 벡터 (50 ng/μ), 각 대상 파편의 2-3 배 초과, DNA 어셈블리 마스터 믹스, x 2의 10 μ < c21 > 2오 품 50 ° c.에서 1 시간 동안 반응 혼합
    6. 변환 어셈블리 제품의 2 μ 유능한 박테리아, 접시에 LB/앰프 한 천 배지 100 μ g/mL 암 피 실린 포함. 또한, X-여자 + IPTG 블루/화이트 심사에 대 한 접시에 추가 합니다.
    7. 밤새 incubated 접시에서 3-4 백색 식민지를 선택 하 고 접종 3 ml 파운드 100 μ g/mL 암 피 실린, 포함 된 식민지 통에 하룻밤 37 ° C에서 성장. 제조 업체에 따라 플라스 미드 소형 예비 키트를 사용 하 여 하룻밤 배양 박테리아에서 플라스 미드 추출의 매뉴얼 ( 재료의 표참조).
    8. 긍정적인 식민지 PCR 또는 제한 소화에 의해 화면.
    9. 시퀀스 마지막 플라스 미드의 HDR 기증자 지역을 확인 합니다. 올바른 변형 세균성 주식 저장 미래 접종-80 ° C에서 20% 글리세롤에 복제 합니다.

3. 태아 주입, 플라이 유전학 및 게놈 편집에 대 한 심사

  1. 준비 하는 높은 순수성도 무료 gRNA 식 벡터 뿐만 아니라 HDR 기증자 플라스 미드 플라스 미드 maxiprep를 사용 하 여 키트 ( 재료의 표참조).
  2. Nos-Cas9 배아6의 생식으로 대체 기증자 (500 ng/μ)와 gRNA 식 플라스 미드 (100 ng/μ)을 주사 공동. 참고: 우리는 주입, 상업 서비스를 사용 하지만 또한 실험실에서이 절차를 수행할 수 있습니다.
  3. 유전학 및 검사 (그림 2그림 3) 비행:
    1. 주입 된 배아 개발 성인으로, 각 단일 G 크로스0 파리 분산 파리에. 타겟된 대립 유전자를 포함 하는 염색체에 대 한 적합 한 분산을 선택 합니다.
    2. F 1에서 각 G0 자손 CO2 패드에 교차 하 고는 stereomicroscope에서 10-20 남성을 무작위로 선택 anesthetize 교차 그들 개별적으로 분산 암컷에 그림 3에서 보듯이.
    3. 때 F2 애벌레 해치 각 십자가에서 단일 F1 아버지를 선택 하 고 단일 비행 게놈 DNA 준비 프로토콜을 사용 하 여 gDNA를 추출:
      1. GDNA 추출 버퍼 준비: 10 mM Tris Cl pH 8.2, 1 mM EDTA, 25 mM NaCl, 상 온에서 저장. 20 mg/mL 가수분해 K 재고 솔루션을 준비 하 고 냉장고에 보관.
      2. 1.5 mL 마이크로 원심 관에 각 비행을 넣고 튜브 라벨. -80 ° C 냉장고에 하룻밤 보관.
      3. 가수분해 공화국의 200 µ g/mL 최종 농도 포함 하는 gDNA 추출 버퍼의 신선한 작업 볼륨 준비
        참고:이 단계에 대 한 오래 된 버퍼를 사용 하지 마십시오.
      4. 액체 분배 하지 않고 버퍼를 첨 벙 첨 벙의 50 μ를 포함 하는 피 펫 팁 10-15에 대 한 각 비행을 뭉 개 버려. 나머지 버퍼 튜브에 분배 하 고 잘 섞으십시오. 20-30 분 동안 37 ° C에서 품 어.
      5. 가수분해 K. 비활성화를 1-2 분 동안 95 ° C 열 블록에 튜브를 넣어
      6. 10000 x g에 5 분 동안 아래로 회전 합니다. 저장 추가 PCR 분석을 위해 4 ° C에서 준비 합니다.
  4. Nos-Cas9 파리, 부정적인 컨트롤 역할에서 gDNA를 준비 하는 같은 메서드를 사용 합니다. 3 단계 PCR 기반 화면 사용 하 여 올바른 "끝을" HDR (그림 2, 그림 5) 식별을 수행 gDNA 템플릿5각 F1 남자의. DNA 준비의 1 μ를 사용 하 여 다음 PCR 반응 시스템에서: PCR 주인 혼합 염료, 각 뇌관 (10 μ M), DNA 템플렛의 1 μ 그리고 ddH2오의 7 μ의 1 μ x 2의 10 μ
  5. 그림 5A같이 수행 PCR 뇌관 fwd1 및 rev1 화면을 사용 하 여 삽입 또는 교체;의 존재에 대 한 삽입 또는 3' 영역;에서 교체를 확인 하려면 fwd2 및 rev2 뇌관을 사용 하 여 PCR을 수행 "끝에" HDR (테이블 1C) 확인 M13F와 rev3 프라이 머를 사용 하 여 PCR을 수행 합니다.
  6. 확인된 끝 아웃 HDR와 플라이 라인을 유지 하 고 설정 F2 세대에서 균형 잡힌된 주식. 다시 다른 염색체에 어떤 의도 하지 않은 돌연변이 제거 하려면 분산 파리에 outcross.
  7. 긴 PCR 증폭에 대 한 설립된 주식에서 높은-품질 gDNA를 준비 (> 800-1000 nt) 높은 충실도 Taq 중 합 효소와 완전히 시퀀스 amplicon 확인 조작된 게놈 영역에서 얻은 amplicons. 또는,를 사용 하 여 원유 gDNA 추출 설명한 이전 짧은 증폭 (< 800 nt), 편집 된 게놈 시퀀스 유효성을 PCR 제품을 중복. 다음 프로토콜을 사용 하 여 좋은 품질 초파리 게놈 DNA를 준비.
    1. 1.5 mL microcentrifuge 튜브에서 25 성인 파리에 대 한 넣고 적어도 1 시간 동안-20 ° C 또는-80 ° C 냉동 고에서 얼어.
    2. 추가 솔루션의 250 μ (pH 9.0 Tris HCl 0.1 m M, 0.1 m M, EDTA SDS 1%).
    3. Microcentrifuge 튜브에 균질 화 pestles를 사용 하 여 파리를 균질 하 고 얼음에 튜브를 넣어.
    4. 30 분 동안 70 ° C에서 품 어.
    5. 35 KOAc (5 M)의 μ, 동요, 및 잘, 믹스를 추가 하지만 소용돌이 하지 마십시오.
    6. 30 분 동안 얼음에 품 어.
    7. 12000 x g 15 분 동안에 회전.
    8. 1 mL micropipette 신중 하 게 모든 침전 물은 다시 떠나 새로운 튜브만 분명 상쾌한 전송 또는 interphase.
    9. 소 프로 파 놀의 150 μ는 상쾌한에 추가 합니다. 부드럽게 반전에 의해 혼합.
    10. 5 분 동안 10000 x g 에서 회전 합니다.
    11. 조심 스럽게 제거는 상쾌한 고 튜브에 펠 릿을 두고.
    12. 1 mL 70%와 펠 릿을 세척 EtOH.
    13. 5 분 동안 12000 x g 에서 회전 합니다.
    14. 제거는 상쾌한. 공기 건조는 펠 렛 15 ~ 20 분. 펠 릿 이상 건조 하지 마십시오.
    15. DdH2o.의 100 μ에 펠 릿을 녹
    16. 고 충실도 긴 amplicon 적합 DNA 중 합 효소를 사용 하 여 (> 800 bp) 전체 편집된 영역을 증폭. 이상적으로, 2 개의 뇌관 벗어나게 게놈 영역 증폭 삽입된 카세트. 젤 PCR 제품을 정화 하 고 앞서 설명한 대로 시퀀스 여러 겹치는 뇌관으로 제품 확인.
  8. 해 부 조직/설계 플라이 라인의 배아에서 올바른 spatiotemporal 식 패턴을 확인:
    1. 하이브리드 mRNA 제품 (테이블 1D)의 표현을 확인 하려면 총 RNA에서 RT-PCR을 수행 합니다.
    2. 식의 유효성을 검사 하는 애벌레 조직/배아에 대 한 관심의 mRNA 제품의 제자리에 하이브리드를 수행 합니다.
    3. 시퀀스 확인 끝 아웃 라인 가운데 정확한 조직 관련 spatiotemporal 식 패턴 편집된 라인의 각 교차에 대 한 화면을 LexOGFP 또는 LexO-RFP ( 에 대 한 이진 식 드라이버 획득 LexA 드라이버) (블루밍턴 재고 센터에서 사용 가능) 라인과 LexA 또는 Gal4 형광 현미경 배아, 애벌레, 그리고 성인 조직에 리포터 유전자 발현 제어를 관찰.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

이 프로토콜은 bnl 5표현에 대 한 대상된 이진 식 기자 시스템 특정 생성 하 성공적으로 사용 되었다. Cis-복잡 한 spatiotemporal bnl 식 제어 하는 규제 요소 (CREs) 특징 되지 않습니다. 따라서, spatiotemporal 식 생 bnl 규제 시퀀스의 통제를 달성 하기 위해, bnl 의 첫 번째 코딩 exon만 세균성 LexA transactivator의 순서 교체 하도록 설계 되었습니다. 알려진 초파리 에 최적의 식을 제공 하는 향상 된 nls LexA::p65 카세트 선정 됐다.

대체 전략은 공상을 생성 하기 위한 nls-LexA:p65-bnl 생 transcriptional post-transcriptional 통제 mRNA. 이 공상 mRNA는 그대로 bnl 5' UTR, 5' 끝과 편집된 bnl 코딩 exon의 3' 끝의 일부를 포함 (첫번째 exon), 완전 한 다운스트림 bnl introns 그리고 exons. 대체 exon의 bnl RNA 특정 접합를 유지 하려면 대체 코딩 exon의 작은 5'과 3' 끝은 유지 했다. 그러나, 공상 Bnl 단백질의 합성을 방지 하기 위해 nls-LexA융합: p65, 자체 cleaving 펩 티 드 순서는 잔여 5' bnl 지역과의 ATG 코딩 사이 통합 되었다 T2A nls-LexA:p65. 또한, 번역 정지 codon 후 추가 되었습니다는 nls-LexA:p65 시퀀스는 잘린된 Bnl 단백질5 (그림 4그림 5A)의 공동 번역을 피하기 위해.

이러한 모든 기능을 포함 하는 보충 기증자 사용 되었다 T2A-했다nls-LexA:p65 시퀀스 및 2 kb 5'-및 1.8 kb 3'-상 동 팔. 긴 상 동 팔 효율적인 HDR 및 수리의 사이트에서 큰 DNA 파편의 삽입을 위해 사용 되었다 (T2A-nls-LexA:p65 1.8 k b) (그림 5A).

두 gRNAs는 DSBs bnl의 첫 번째 코딩 exon의 대부분을 삭제 하려면 정의 된 위치에 만드는 데 사용 되었다. 1.3 (팸 시퀀스 밑줄) 섹션에 설명 된 모든 조건과 일치 하는 두 개의 gRNAs 했다:
gRNA1: TGTATCTGCGATGCCCCTCATGG
gRNA2: ATCCTTCAGATATTGCGGGATGG

두 gRNA 인식 사이트 exogenous T2A-에 의해 대체 기증자에 중단 했다nls-LexA:p65 시퀀스, 설계 된 로커 스에 gRNAs의 retargeting 방지 하는 가장 쉬운 방법은 이다. 교란된 gRNA 인식 시퀀스 대체 기증자 (exogenous 시퀀스를 기울임꼴로 gRNA 인식 사이트 중단) 했다:
gRNA1: TGTATCTGCG-GGCTCCGGCGAAGGAC...
gRNA2:... AAAAACTCGTTTAGA-CGGGATGG

대체 기증자 함께 이러한 gRNAs를 포함 하는 pCFD4 gRNA 식 벡터 공동 nos Cas9 배아의 생식에 주입 했다. 그 후, 여기에 설명 된 프로토콜 그 뒤를 이었다 의도 교체 (그림 5B, C)에 대 한 화면으로. 주입 된 G0 동물의 약 67%는 비옥한 이었다. 그리고 비옥한 G0s의 56 %HDR-긍정적인 자손에 상승 했다 창시자. 체크 F1 자손 중 약 23% 성공적인 HDR에 대 한 긍정적인 이었고 긍정적인 HDR의 73%가 "끝-아웃" (표 2). 첫 번째 코딩 이후 bnl 의 exon 했다 "기 절", 모든 HDR 라인 발견 될 homozygous 치명적인, 그리고 주식 분산을 통해 유지 되었다.

셀에 공상 LexA bnl mRNA의 세대 RT-PCR 분석 (그림 5D)에 의해 검증 되었다. 얻은 bnl-LexA 라인 이라면 확인 하려면 생 bnl 식 패턴 표현, 각 "끝-아웃" HDR 라인 LexO mCherryCAAX 유전자 변형 파리5, 그리고 기자 식 패턴을 교차 했다 애벌레와 자손 배아에서 시험 되었다. 42의 46 라인 정확한 spatiotemporal 식 이전에 보고 된 bnl 패턴5 (그림 6)과 일치 했다. 4 개 라인 중 약한 또는 일반적인 식 패턴을 보였다. 우리는이 라인 우리가 철저 한 시퀀싱 분석 확인할 필요가 돌연변이 축적 수 예측. 함께이 결과 HDR 중재 exon 교체 전략은 성공적으로 유전자에 대 한 대상된 이진 식 시스템을 생성 하기 위해 고용 수 확인. 도구는 기자 또는 bnl 유전자 spatiotemporal 패턴에 소성 유전자 표현 하 성공적으로 사용할 수 있습니다.

Figure 1
그림 1: 타겟된 유전자 발현에 대 한 이진 전사 시스템의 계획. Transactivator (GAL4 또는 LexA), cis의 통제 표현-규제 요소 (CREs)는 유전자의 특정 전사 바인딩 사이트 (UAS Gal4 에 대 한 다운스트림 배치 이펙터 transgene 드라이브 또는 LexAop LexA). 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: CRISPR/Cas9-중재 게놈 편집 이진 전사 시스템 생성을 위한 워크플로 개요. 각 단계에 필요한 대략적인 시간 기간 표시 됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: 검사 및 유전자 게놈 편집 플라이 라인을 설정 하기 위한 계획 크로스 CRISPR의 그림. 유전 십자가에서 R 3rd 염색체에 있는 편집 된 대립 유전자에 대 한 의미 합니다. MKRS (Tp (3; 3) 부인, M (3) 76A [1] 위 [1] 리 [2] Sb [1])는 3rd 염색체 마커; TM6B ((3LR) TM6B, Antp [Hu] e [1]에 Tb[1])는 3rd 염색체 분산. 편집 하는 게놈 비행 주식 PCR 증폭 F2 또는 f 3 세대 파리와 PCR 제품을 결정 하는 시퀀스에서 추출 하는 genomic DNA에서 관심 대상 영역에 의해 확인 됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4: DNA 어셈블리에 의해 교체 카세트의. PCR 증폭 및 다른 PCR 제품의 조립 묘사 도식 그리기 (a, b 및 c) (d) DNA 어셈블리 메서드를 사용 하 여 기증자 벡터에. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 5
그림 5: CRISPR/Cas9-중재 exon 교체에 의해 bnl LexA 의 세대. (A) CRISPR/Cas9의 전략을 묘사한 그림 회로도 bnl 로커 스에서 엑손 교체에 대 한 HDR 중재. 상자-exon; 라인-intron; 대체 기증자 (pDonor-bnl:LexA)과 HDR의 두 가지 가능한 결과 표시 했다. PDonor-bnl:LexA 는 다음과 같은 기능을 했다: (1)T2A-nls-LexA:p65 (~1.8kb) 시퀀스 측면 2 kb 및 1.8 kb 긴 상 동 팔 (점선), (2) T2A 자체 cleaving 펩 티 드 사이 잔여 N 터미널 bnl exon는 nls-LexA:p65, 그리고 (3) 번역 정지 codon (레드 *) 후는 nls-LexA:p65 시퀀스. Bnl,그리고는 LexA모든 transcriptional 및 post-transcriptional 제어를 유지 하는 HDR 제품: p65 단백질 생 Bnl. 작은 검은 화살표 표시 상대적 바인딩 사이트 (안에 동일한 패턴에서 생산 될 것으로 예상 된다 확장)의 3 단계 심사 또는 RT-PCR 유효성 검사에 사용 되는 PCR 뇌관 (표 1). ((B)) Agarose 젤 사진 3-단계 PCR 검사의 결과 보여주는. 4 개의 성공적인 끝 아웃 HDR 라인 genomic DNA에서 증폭 PCR 제품 표시 됩니다; 음성 제어, nos의 게놈 DNA-Cas9 부모의 선; 긍정적인 통제, pDonor-bnl:LexA 플라스 미드; M, 마커 (SL2K DNA 사다리)입니다. (C) 예상된 PCR 제품 라인 끝에;에 대 한 M13F와 rev3 뇌관을 사용 하 여 보여주는 심사 젤의 예 M8-7과 M9-6는 두 끝 줄; B;에서 같이 부정적이 고 긍정적인 컨트롤 M, 마커 (코 1 kb DNA 사다리). (D) RT-PCR 분석 bnl LexA nos-Cas9 컨트롤에서 총 RNA에 난다. 앞으로 뇌관 LexA 특정 지역에 바인딩, 역방향 뇌관 바인딩합니다 다운스트림 bnl exon 지역; ~ 440 bp (기본적인 쌍) 증폭 밴드 (*) RT-PCR에서 bnl LexA 에 감지 되었다 mRNA, 제어 RNA에서가 아니라. M, 100 bp 마커 (코)입니다. 뒤 에 그림 2와 s 1에서 적응. 20175. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 6
그림 6: 다른 조직에 조직 및 조건부 bnl LexA 식의 유효성 검사. (A D) bnl 식 (빨간) 다른 애벌레 조직, btl 녹색으로 표시 된 셀을 표현. (A, A') 성장 공기 골목 primordium (ASP) 앞 날개 디스크 bnl 소스. (B, C) bnl 식 TR5 가로 결합 (TC) (B) 및 TR2 지 지점 (DB) (C). (D) bnl 식 성 기 디스크에. (E-J) 배아 tracheal 지점 (녹색) 패터 닝; 하는 동안 동적 bnl 식 (빨간색) 작은 화살표, 단계 10에서 tracheal placode를 둘러싼 5 bnl 소스. Genotypes: A-J; btl-Gal4, UAS- CD8GFP / +; bnl-LexA, LexO- CherryCAAX /+. (K-L ") Hypoxia-유도 날개 디스크에서 bnl LexA 식 프로필 및 TR2 tracheal metamere (TC, DB, 등 트렁크-DT). 유전자 형: bnl-LexA, LexO-CherryCAAX / +. ( Ex vivo에서 K) 제어 디스크 CoCl2없이 장기 배양. (L-L ") 날개 디스크 (L, L') 및 기관 (DT, (L ')) CoCl2 교양 비보 전 기관에서 hypoxia 유발. 저 산소 증에 의해 유도 된 스타, 소성 식입니다. 스케일 바 = 30 µ m; 50 µ m (K-L ") 그림 3 에서 뒤 에 적응. 20175. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

A. gRNA 클로닝 및 시퀀싱
bnl lexA gRNA fwd TATATAGGAAAGATATCCGGGTGAACTTCg TGTATCTGCGAT
GCCCCTCAGTTTTAGAGCTAGAAATAGCAAG
bnl lexA gRNA 레 브 ATTTTAACTTGCTATTTCTAGCTCTAAAAC TCCCGCAATATCTGAAGG
CGACGTTAAATTGAAAATAGGTC 에서
시퀀싱에 사용 되는 T3 뇌관 CAATTA ACCCTCACTAAAGG-3'
참고: 밑줄 뉴클레오티드 U6 발기인 또는 pCFD4 벡터에 gRNA 코어 anneal, 소문자 g/c에 추가 되었습니다 U6 발기인 종속 전사 지원
B. HDR 기증자 건설
bnl N-F_pUC19 AATTCGAGCTCGGTACtgtggtctttgaggctggaac
bnl-lexA-N-R tCCGcaagtCagtAGgctgccgcgtccttcgccggaGCC CGCAGATACAAGGCCC
C
lexA F CTactGacttgCGGaGAtGTcGAaGAGAACCCtGGCCCt ATGCCACCCAA
GAAGAAGC
lexA-R CTAAACGAGTTTTTAAGCAAACTCACTC
bnl lexA C Fwd TAAAAACTCGTTTAGACGGGATGGCGTTGTCAAC
bnl C-R_pUC19 GCCAAGCTTGCATGCCtcgcataattgccgcctgg
참고: 깁슨 어셈블리, 뉴클레오티드 밑줄이 pUC19 벡터와 자본 오버랩에 뉴클레오티드 T2A 펩 티 드 또한 시퀀스 돌출 했다.
C. HDR 심사 및 시퀀싱
bnl lexA scr fwd1 GTGGCGCACGCCCAATAAAC
bnl lexA scr rev1 GATCCCAGCCAATCTCCGTTG
bnl lexA scr fwd2 CAACGGAGATTGGCTGGGATC
bnl lexA scr rev2 CTGGCCAACTGTAGGGAAGTC
끝에 체크 rev3 GCAATGTTATGCAATGCGTTGAC
bnl lexA seq fwd3 CACTTGTCGCCCATATTGATACAATTG
참고: 이러한 뇌관 PCR 검사 및 시퀀싱을 위해 사용 되었다, 뇌관 바인딩 사이트의 대략적인 위치는 fwd1-2와 rev1-3 그림 5A에 표시 됩니다.
D. RT-PCR 분석
RT-f GATATGGATTTCTCCGCTTTGCTG
RT-r CCATGCAGAGATACAGGCAAGTG

표 1:이 연구에 사용 된 뇌관. GRNA 식 벡터 클로닝 및 시퀀싱에 대 한 (A) 뇌관. (B) HDR 기증자 템플릿을 복제를 위한 뇌관. 심사 및 HDR 제품의 연속 (C) 뇌관. RT-PCR 공상 LexA bnl mRNA 제품의 확인에 대 한 사용 한 (D) 뇌관

유전자 형 HDR 전송 속도 % (# HDR 저조한 G0 / # 비옥한 G0) # HDR-긍정적인 F1 / # 총 F1 체크 (%) # "끝-아웃" HDR / # 총 HDR (%)
bnl LexA 56 (15/27) 23 (60/259) 73 (46/60)

표 2: CRISPR/Cas9-중재 HDR의 효율. HDR 전송 속도 HDR 저조한 G0 / # 총 비옥한 G0의 #로 계산 됩니다. 성공적인 HDR % 총 F1 상영의 HDR-긍정적인 F1 / # #로 계산 됩니다. "끝으로" % "끝-아웃" 총 긍정적인 hdr HDR / # #로 계산 됩니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

전통적으로, 초파리 증강 트랩은 두 가지 방법으로 생성 되었다. 방법 중 하나는 드라이버의 임의 삽입 포함 (예., Gal4) 이항에 의해 게놈 시퀀스 (., P 요소 이항)1 . 또는, 게놈3,11의 소성 사이트에 통합 될 것 이라고 하는 플라스 미드 구문에 상 상속 증강/발기인 지역의 transcriptional 통제 드라이버 시퀀스를 배치할 수 있습니다. 이러한 방법은 초파리Gal4 또는 LexA 증강 트랩의 대형 수영장 생성, 비록 그들은 몇 가지 제한이 있다. 게놈에 있는 P 요소 중재 하는 무작위 삽입 중요 한 cis의 규제 활동 중단 될 수 있습니다-규제 시퀀스. 게놈에 있는 임의의 이항 인 transactivator 식 여러 인접 유전자의 패턴을 보고할 수 있습니다. 다른 한편으로, 유전자의 cis 규제 시퀀스의 사전 지식을 증강 트랩 플라스 미드 구조에 필요한입니다. 또한 복제 되 고 플라스 미드 구문에서 테스트 될 수 있는 시퀀스의 길이에 제한이 있다. 분리 하 고 복제 생 게놈 문맥 DNA의 단지 부분적인 조각 완전 한 유전자 특정 식 패턴을 재현 하지 수도 있습니다. 예를 들어, 완전히 증강 트랩 bnl 유전자 앞두고 Gal4 요소 P 요소 삽입 하 여 생성 된, bnl Gal4 (NP2211) 라인5 배아의 유전자 특정 식 패턴을 재현 하지 않습니다. . 따라서, 이러한 컨텍스트를 repurposing 기법 (homology 지원 CRISPR 노크-에서), 해킹 등에서 그 수 다른 LexA 또는 Q-시스템으로 변환 기존 Gal4 라인 기반 드라이버 라인12 않을 수 있습니다 매우 유용. 이러한 한계를 극복 하기 위해 여기, 우리 게놈을 편집 하 여 이진 식 시스템을 생성 하기 위한 효율적 이며 대체 방법을 설명 합니다. 이 방법에서는, 유전자의 첫 번째 코딩 exon는 transactivator로 바꾼는 (예., LexA 또는 Gal4) 시퀀스를 독점적으로 유전자 발현의 spatiotemporal 패턴을 모방 하는 전사 드라이버의 표현. Bnl-표현 전략 및 여기에 설명 된 프로토콜 최적화 했다 비록 메서드를 다른 유전자에 대 한 채택 쉽게 수 있습니다.

타겟된 유전자 영역 내에서 삽입 사이트 결정이 실험적인 전략에서 가장 중요 한 단계입니다. 우리가 제시 하는 방법은 transcriptional bnl 유전자5의 post-transcriptional 규정 뿐만 아니라 모든 원본 유지 하도록 설계 되었습니다. 따라서, 우리는 bnl 유전자의 첫 번째 코딩 exon의 대부분을 삭제 하 고 LexA 카세트를 계획. 교체 편집 된 대립 유전자는 하이브리드 LexA-bnl 표현 하는 방식으로 계획 되었다 생 전사 및 번역에서 mRNA intronic 모든 영역을 유지 하면서 bnl 의 사이트를 시작. 그러나, 하이브리드 mRNA 생산 유일한 LexA 단백질, 하지만 하지 Bnl 설계 되었습니다. 우리는 전략 bnl LexA 생성 성공적으로 했다 나타났다 /LexO-기반 전사 시스템 및 시스템 동적, spatiotemporal bnl 식 패턴 (그림 5)5 보고 정확 하 게 수 . 이 프로세스의 한계가 초파리 라인에서 homozygous 치 경우 대상된 유전자의 생존을 위해 필수적 이다. 또한, 듀얼 gRNA 전략의 사용 대상에서 편집의 기회를 증가할 수 있습니다. 대체 전략은 이러한 문제를 방지 하려면 사용할 수 있습니다. 이 전략에 LexA 또는 Gal4 카세트 놓일 수 있다 오른쪽 대체 유전자와 자기 cleaving 펩 티 드 순서 LexA/Gal4 카세트의 그대로 코딩 exon의 시작 사이 놓일 수 있다 T2A의 ATG 시작 사이트에서 대상 유전자입니다. 이 전략은 transctivator와 기능적 유전자 제품으로 번역 될 수 있다 공상 mRNA 생산 예정 이다. 이러한 디자인 가능성이 homozygous 치의 기회를 줄일 수 있습니다. 이 전략에서는 단일 gRNA 게놈 편집을 위해 충분 하다. 그러나, 기능적 유전자, 유전자 변형 단백질 이체 Gal4/LexA 드라이버에 의해 구동의 표현의 복사본 두 개가 존재 (예., bnl LexA 구동 LexOBnl의 표현: GFP 융해, 또는 Bnl 단백질을 삭제) 변형 단백질의 기능 정보를 제공 하지 않습니다.

게놈 편집 전략의 한계를 대상으로 하 고 한 번에 하나의 유전자의 편집의 힘 드는 과정입니다. 그러나, 단순 및 CRISPR/Cas9-중재 게놈 편집 방법의 효율성은 타겟된 게놈 노크/노크-아웃 및 설정 어떤 표준 실험실에서 쉽게 채택 될 수 있는 대체 기술 혁명 있다. 지난 몇 년 동안, 연구팀은 초파리 게놈 편집에 대 한 근본적인 생물학 처리7,13 이해에 필수적인 유전 도구 확장을 사용할 수 있는 편리한 툴킷 개발 . 게놈 편집과 심사 프로세스 여기에 설명 된 상대적으로 빠르게 하 고 모든 다른 동종 재결합 기반 교체에 비해 약 2 개월 걸립니다. 성공적이 고 효율적인 게놈 편집 결과 여러 기술적으로 중요 한 단계를 수행 하는 것이 중요 하다: 1) 각 gRNA 최대 엄중 대상에서 잠재적인; 없이 활동에 의해 선택 2) HDR 기증자 ~1.5 kb homology 무기 측면에 서는 사이트를 대상으로 하는 gRNA를 포함 합니다. 더 이상 상 동 팔 (1.8-2 kb) 효율성을 증가 하는 HDR의 큰 외 인 DNA 파편; 삽입 될 필요가 있을 때 사용 됩니다. 3) HDR 기증자는 설계 된 로커 스;에 gRNA의 retargeting 피하기 위해 gRNA 인식 사이트의 무료 되도록 설계 그리고 4) "끝-아웃" HDR 라인을 선택 하는 절대 안전한 정교한 계획 및 3 단계 PCR 기반 상영과 함께 유전 십자가의 타이밍의 조정.

달리 무작위 전위 또는 복제 증강 구조, 전략 및 우리는 여기에 설명 된 프로토콜 보장의 세대는 독점적으로 대상 유전자 특정 바이너리 전송 시스템. 드라이버의 표현을 네이티브 유전자 exon 대체, 이후 드라이버의 유전자 특정 식 다목적 이며 또한 모든 발달, 변화, 및 생리 적 조건5에서 유전자 표현 패턴을 모방 하는 것으로 예상 된다. 유전자/세포 특정 식 다양 한 세포와 개발 생물학 방법에서 사용 될 때 모든 바이너리 드라이버 라인의 가장 바람직한 기준 이다. 예를 들어, 전송 드라이버에 의해 기자 유전자의 유전자 특정 표현 대상 유전자를 표현 하는 셀의 신뢰할 수 있는 혈통 분석 용이. 그것은 또한 라이브 이미징 및 spatiotemporal 표현, 마이그레이션, 그리고 개발 하는 동안 셀의 개편의 추적을 수 있습니다. 세포 및 분자 이벤트 조직 morphogenesis, Gal4 또는 LexA overexpression/misexpression의 구동 중 조사를 다양 한 transgenes RNAi 중재 유전자 세포의 특정 집합에 노크 다운은 필수품입니다. 매우 구체적인 타겟된 식 시스템은 편견 분석 및 결과의 해석. 따라서, 유전자 엑손 및 transactivator 순서를 가진 교체 대상으로 CRISPR/Cas9-기반으로 매우 구체적인 타겟된 유전자 표정 시스템 생성에 대 한 더 나은 대안을 제공 합니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 관심의 없습니다 충돌 있다.

Acknowledgments

우리 박사 F. 포트, 감사 닥터 K. 오 코너-자일 스, 닥터 미 Feng CRISPR 전략;에 대 한 토론에 대 한 박사 결핵 콘 버그, 그리고 시 약; 대 한 블루밍턴 재고 센터 UMD 이미징 핵심 시설; NIH에서 자금: R00HL114867 및 R35GM124878 미스터를

Materials

Name Company Catalog Number Comments
X-Gal/IPTG Gentrox (Genesee Scientific) 18-218 cloning
LB-Agar BD Difco BD 244520 cloning
Tris-HCl Sigma Aldrich T3253 Molecular Biology
EDTA Sigma Aldrich E1161 Molecular Biology
NaCl Sigma Aldrich S7653 Molecular Biology
UltraPure DNase/RNase-Free Water ThermoFisher Scientific 10977-023 Molecular Biology
10% SDS Sigma Aldrich 71736 Molecular Biology
KOAc Fisher-Scientific P1190 Molecular Biology
EtOH Fisher-Scientific 04-355-451 Molecular Biology
GeneJET Miniprep ThermoFisher Scientific K0503 Miniprep
PureLink HiPure Plasmid Maxipep kits ThermoFisher Scientific K210006 Maxiprep
BbsI NEB R0539S Restriction enzyme
Primers IDT-DNA PCR
pCFD4 Kornberg Lab DNA template and vector for gRNA
KAPA HiFi Hot Start- (Kapa Biosystems) Kapa biosystems KK2601 PCR
Q5-high fidelity Taq NEB NEB #M0491 PCR
Gibson Assembly Master Mix NEB NEB #E2611 DNA assembly
pBPnlsLexA:p65Uw Addgene DNA template for LexA amplification
Proteinase K ThermoFisher Scientific 25530049 Molecular Biology
2x PCR PreMix, with dye (red) Sydlab MB067-EQ2R Molecular Biology
Gel elution kit Zymo Research (Genesee Scientific) 11-300 Molecular Biology
TRI reagent Sigma-Aldrich Molecular Biology
Direct-zol RNA purification kits Zymo Research (Genesee Scientific) 11-330 Molecular Biology
OneTaq One-Step RT-PCR Kit NEB E5315S Molecular Biology
lexO-CherryCAAX Kornberg Lab Fly line
UAS-CD8:GFP Kornberg lab Fly line
btl-Gal4 Kornberg lab Fly line
MKRS/TB6B Kornberg lab Fly line
Confocal Microscope SP5X Leica Imaging expression pattern
CO2 station Genesee Scientific 59-122WCU fly pushing
Stereo microscope Olympus SZ-61 fly pushing
Microtube homogenizing pestles Fisher-Scientific 03-421-217 genomic DNA isolation
NanoDrop spectrophotometer ThermoFisher Scientific ND-1000 DNA quantification

DOWNLOAD MATERIALS LIST

References

  1. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, (2), 401-415 (1993).
  2. Lai, S. -L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nature Neuroscience. 9, (5), 703-709 (2006).
  3. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141, (3), 536-548 (2010).
  4. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  5. Du, L., Zhou, A., Patel, A., Rao, M., Anderson, K., Roy, S. Generation of a targeted expression system for branchless and characterization of novel cellular expression patterns of the gene in Drosophila. Developmental Biology. 427, (1), 35-48 (2017).
  6. Port, F., Chen, H. -M., Lee, T., Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 111, (29), E2967-E2976 (2014).
  7. Gratz, S. J., Rubinstein, C. D., Harrison, M. M., Wildonger, J., O'Connor-Giles, K. M. CRISPR-Cas9 Genome Editing in Drosophila. Current Protocols in Molecular Biology. 111, (1), 31.2.1-20 (2015).
  8. Doench, J. G., Hartenian, E., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  9. Port, F., Bullock, S. L. Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nature Methods. 13, (10), 852-854 (2016).
  10. Beumer, K. J., Trautman, J. K., Mukherjee, K., Carroll, D. Donor DNA Utilization During Gene Targeting with Zinc-Finger Nucleases. G3. 3, (4), Bethesda, Md. 657-664 (2013).
  11. Pfeiffer, B. D., Ngo, T. -T. B., et al. Refinement of tools for targeted gene expression in Drosophila. Genetics. 186, (2), 735-755 (2010).
  12. Lin, C. -C., Potter, C. J. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 203, (4), 1613-1628 (2016).
  13. Li, W., Köster, J., et al. Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. Genome Biology. 16, (1), 281 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics