Эффективная стратегия для генерации двоичного транскрипции ткани конкретных систем у дрозофилы путем изменения генома

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Здесь мы представляем метод для генерации двоичного транскрипции ткани конкретных систем у дрозофилы , заменив первый кодирования экзона генов с драйверами транскрипции. Метод на основе ТРИФОСФАТЫ/Cas9 места transactivator последовательность под эндогенного регулирования сменил гена и следовательно облегчает transctivator выражение исключительно в пространственно-временных структур ген специфического.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Du, L., Zhou, A., Sohr, A., Roy, S. An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing. J. Vis. Exp. (139), e58268, doi:10.3791/58268 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Системы Бинарные транскрипции являются мощные генетических инструменты широко используются для визуализации и обработки клеток судьба и ген выражение в конкретных группах клеток или тканей в модельных организмов. Эти системы содержат два компонента как отдельный трансгенных линий. Линии драйвер выражает transcriptional активатор под контролем ткани конкретных промоутеров/усилители и гаваней линии репортер/эффектор, целевого гена размещены ниже по течению на сайт связывания активатор транскрипции. Животные, укрывательство обоих компонентов побудить transactivation ткани конкретного целевого выражения гена. Точное пространственно-временных выражение гена в целевых тканях имеет решающее значение для объективное освещение деятельности клеток/ген. Таким образом разработка метода для создания эксклюзивных клеток/тканей конкретных драйверов линии имеет важное значение. Здесь мы представляем метод для создания системы весьма ткани конкретных целевых выражение, используя «кластерный регулярно Interspaced короткие палиндром Repeat/ТРИФОСФАТЫ связанные» (ТРИФОСФАТЫ/Cas)-основанные геном редактирования технику. В этом методе эндонуклеазы, которую Cas9 является объектом двух химерных руководство РНК (gRNA) на определенных сайтах в первом кодирования экзона гена в геном дрозофилы для создания двухнитевые разрывы (DSB). Впоследствии с помощью внешних доноров плазмида, содержащий последовательность transactivator, клетки автономного ремонт техники позволяет гомологии направленных ремонт (HDR) ОРС, в результате точного удаления и замены экзона с transactivator последовательности. Постучал в transactivator выражается исключительно в клетках где СНГ-регулирующие элементы заменены гена являются функциональными. Подробные пошаговые протокола, представленные здесь для генерации двоичного транскрипционный анализ драйверов, выраженные в ФБП дрозофилы/внеофисного-производящ клетки эпителия/нейронов может быть принят для любого выражения конкретных генов или ткани.

Introduction

Генетических элементов для экспрессии целевых генов был хорошо развита у дрозофилы, что делает его одним из лучших систем модель для изучения функции генов, вовлеченных в самых разнообразных клеточных процессов. Двоичные выражения систем, таких как дрожжи Gal4/Уан (вверх по течению активации последовательности), впервые был принят для ткани конкретных усилитель треппинга и Джин которое в дрозофилы генетических модель1 (рис. 1). Эта система способствовала развитию большое количество методов, таких как пространственно-временных правил гиперэкспрессия генов, которое, нокаут в отдельных групп клеток, также как и абляции клеток, клеток маркировки, Живая трассировка клеточной и молекулярной процессы в эмбриона и тканей, линии трассировки и мозаика анализов во время разработки. Количество двоичных транскрипции системы, такие как бактериальный LexA/LexAОП системы (рис. 1) и Нейроспора Q-системы, являются мощными инструментами генетических, которые сейчас широко используются в дрозофилы, в дополнение к Оригинальный Gal4/Уан система для целевых генов выражение1,2,3.

Здесь мы представляем метод для создания высоконадежных ткани конкретных двоичные выражения системы, используя метод изменения генома. Последние достижения в технологии редактирования генома ТРИФОСФАТЫ/Cas9 позволили беспрецедентные возможности для изменения направлены генома в широком диапазоне организмов. По сравнению с других методов редактирования доступны генома, ТРИФОСФАТЫ/Cas9 система является эффективной, недорогой и надежный. Эта технология использует компоненты бактериальных адаптивной иммунной системы: Cas9 эндонуклеазы Streptococcus pyogenes , который создает двухручьевой перерыв (DSB) и химерных руководство РНК (gRNA), которая направляет на конкретной генома сайт для Cas9 целевые DSB4. Ячейки содержат машины для ремонта DSB, используя различные пути. Non гомологичных конец присоединения (NHEJ) приводит к небольшой вставки или удаления нарушить функции гена, в то время как ориентированные на гомологии ремонт (HDR) вводит определенные направлены/желательно геномной в/стучите нокаут с помощью внешних доноров HDR как шаблон. Стратегии на основе HDR замена эффективно могут быть использованы для создания высоконадежных ткани конкретных двоичные выражения системы, которая может преодолеть все ограничения методов ловушку традиционной усилитель. Мы описываем пошаговые процедуры для использования на основе ТРИФОСФАТЫ/Cas9 HDR ремонта в генерации двоичного транскрипции драйвер линии, которая выражается под контролем эндогенного транскрипционный анализ и post-transcriptional регулирования дрозофила гена. В этом протоколе, мы демонстрируем поколения специфических для драйвера линии внеофисного гена (bnl) кодирования ФБП семьи протеина, который регулирует ветвления морфогенез эпителия трахеи сократимость5. В этом примере первый кодирования экзона гена bnl был заменен последовательность бактериальной Лекса transactivator последовательность без изменения любых эндогенных СНГ-регулирования последовательностей гена bnl . Мы покажем, что стратегия создается линия драйвер Bnl Лекса , spatiotemporally управляет экспрессии гена репортера, размещенных ниже по течению от LexAoperator (LexAop или LexO) исключительно в bnl- выражая эпителиальных/мезенхимальных/нейрональных клеток.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Проектирование и строительство gRNA выражение вектор

  1. Чтобы точно заменить долго определенную область экзона, используйте двойной gRNA подход6, в котором каждый gRNA можно конкретно два конца выбранной области интереса. Чтобы получить точное выражение пространственно-временных ген специфического драйвера, выберите два gRNA целевых сайтов в пределах первого кодирования экзона гена.
  2. Для Drosophila melanogasterвыберите gRNA целевых сайтов, используя средство оптимального целевого поиска flyCRISPR (http://tools.flycrispr.molbio.wisc.edu/targetFinder/). Другие доступные ТРИФОСФАТЫ дизайн инструменты могут использоваться также, включая средство оптимизированный дизайн ТРИФОСФАТЫ (http://crispr.mit.edu), FlyCas9 (https://shigen.nig.ac.jp/fly/nigfly/cas9) и E-Крисп (www.e-crisp.org/E-CRISP).
    Примечание: Следующие протоколы gRNA дизайн и клонирования был принят от методов описано6,7.
    1. Скопируйте фактическая последовательность в соответствующее поле в онлайн-инструмент. Выберите наиболее недавно выпустила Drosophila melanogaster генома аннотации версии, «r_6,» в раскрывающемся меню для «Выберите геном.» В поле «выберите руководство Длина (nt),» input «20.» Выберите «Все ТРИФОСФАТЫ цели» и нажмите «Найти ТРИФОСФАТЫ цели».
    2. Оцените все цели gRNA кандидата, установив «Максимум» для «Жесткости» и «NGG только» для «Пэм». Попробуйте выбрать gRNA сайтов без каких-либо потенциальных от целей или минимальное количество возможных-целей. Использование веб инструмент описано в Doench et al. 2014 8 , чтобы выбрать оформления с потенциальным оценка «хорошо» активности.
    3. Одновременно убедитесь, что есть нет полиморфизм в gRNA целей в геноме родительского летать линии, выбранных для инъекций (Например, нос Cas9 на Х-хромосоме, BL # 54591). Следуйте Протоколу описанные в Грец et al. 20157 для извлечения геномной ДНК из родительского летать линии. PCR усиливает, приблизительно, 500 – 1000 nt регионов с помощью грунтовки, которые обрамляют последовательность интереса и ДНК-полимеразы высокой верности; последовательность проверьте продукты PCR усиливается.
  3. Для создания вектора выражения gRNA тандем, следуйте перевязка независимые клонирования протокол6 представить две последовательности protospacer в pCFD4 РНК выражение вектор. Обратите внимание, что вектор Улучшенный мульти gRNA выражение (pCFD5) теперь доступна, где оба sgRNAs выражаются сильным U6:3 промоутеров9 (https://www.crisprflydesign.org). Используйте метод ДНК Ассамблеи клонировать оформления в pCFD4 вектор.
    1. Дизайн и заказать прямого и обратного Праймеры для введения двух последовательностей protospacer в pCFD4 вектора выражения РНК (Таблица 1а). Как описано выше6вперед Грунтовка содержит первый protospacer последовательность, обрамленная регионов, соответствующих U6-1 промоутер и gRNA ядра в pCFD4; Обратный Грунтовка содержит последовательность обратного дополнением второго protospacer, обрамленная регионов, соответствующее ядро gRNA и промоутер U6-3 в pCDF4.
    2. Ресуспензируйте грунтовки до 100 мкм с дистиллированной водой DNase и свободной РНКазы двойной (ddH2O). Сделайте 10 мкм Рабочая концентрация праймера. Использование pCFD4 плазмиды как шаблон и Настройка реакции PCR с помощью полимеразы высокой точности и рекомендованные параметры для реакции PCR6.
    3. Чтобы клонировать усиливается продукта в pCFD4, дайджест pCFD4 плазмиду с BbsI фермента, создав следующие реакции: 2 – 5 мкг pCFD4 плазмиды, 5 мкл 10 x буфер пищеварение, 1 мкл BbsI фермента и ddH2O довести окончательный объем до 50 мкл. Перемешайте содержимое реакции нежно касания трубку и собирая все отдельные капельки от стенки трубки на дно, краткий спина. Инкубируйте смесь реакции при 37 ° C на 2 ч.
    4. Запуск продукта ПЦР из шага 2 и переваривается продукт из шага 3 на геле агарозы 1%. Провести электрофорез для достаточно времени, чтобы полностью отделить ДНК полос. Вырезать правильного размера ДНК банды под УФ транс осветитель до очистки ожидаемых продуктов с использованием геля элюции столбца после инструкции производителя (см. Таблицу материалы). ПЦР продукта должно быть 600 bp и плазмиды линеаризованного pCFD4 должно быть ~6.4 КБ 6.
    5. Настройка реакции Ассамблеи ДНК в ПЦР-пробирку, в инструкции производителя (см. Таблицу материалы).
    6. Превратить 2 мкл Ассамблея продукта в компетентных бактерий (DH5α или аналогичные штаммы с ΔrecA1, ΔendA1), тарелка на ампициллин (100 мкг/мл) содержащий плиты агара ФУНТ (LB/Amp) и инкубировать при 37 ° C на ночь. Обратите внимание, что ДНК смесь Ассамблеи могут быть токсичными для некоторых штаммов бактерий, но разбавления смеси Ассамблея может снизить токсичность.
    7. Выберите 3 – 4 ампициллин устойчивостью колоний от пластины инкубируют на ночь, прививок колонии в 3 мл LB, содержащие 100 мкг/мл Ампициллин и расти привитых бактерий в шейкере 37 ° C ночь. Экстракт плазмиды от ночлега культивированный бактерий с помощью комплекта мини-prep плазмида после инструкции производителя (см. Таблицу материалы).
    8. Последовательность плазмид универсальным грунтом T3 экран для правильного клоны, содержащий вставки gRNA тандем. Создание глицерин запас бактерий преобразована с проверки последовательности pCFD4-gRNA в 20% глицерина и хранить в морозильной камере-80 ° C для использования в будущем.

2. Проектирование и строительство HDR доноров

  1. Для геномной стук в Gal4 или LexA последовательности дизайн двунитевая HDR доноров, содержащий последовательность transactivator, в окружении двух гомологии оружия.
    1. Использование > 1,5 КБ оставил и правый гомологии оружия фланговые gRNA таргетинга сайта. Расширенные гомологии оружия увеличить эффективность HDR во время процесса ремонта 10.
    2. PCR усиливает гомологии оружия от геномной ДНК (геномная ДНК), извлеченные из родительского летать линии, выбранных для инъекций (Например, нос Cas9 (на Х-хромосоме), BL # 54591). Используйте корректорские начало Taq-ДНК полимераза фермент подходит для долго ПЦР расширение (см. Таблицу материалы). Последовательность проверьте.
  2. Чтобы избежать переориентацию gRNA к инженерии локус, Дизайн замена доноров таким образом, что признание сайты gRNA разрушаются экзогенных последовательности представил.
    Примечание: чтобы избежать изменения предполагаемого СНГ регуляторные элементы, всегда выберите gRNA признание сайтов в регионе кодирования экзона.
  3. Для генерации Замена кассеты, планировать стратегию ДНК Ассамблеи объединиться четырех сегментов: 5' и 3' гомологии оружия, последовательности ДНК среднего экзогенных transactivator и линеаризованное клонирования вектор позвоночника (например, pUC19 или других часто используемые клонирования векторов). После производителя ориентиром для Ассамблеи ДНК (см. таблицу материалы), дизайн подходит Праймеры для амплификации PCR и Ассамблеи каждого сегмента. Ресуспензируйте грунтовки до 100 мкм с ddH2O. Make 10 мкм Рабочая концентрация праймера. Используйте высококачественный полимеразы для всех реакций PCR. Выполните следующий протокол:
    1. PCR усиливает Gal4 или LexA выражение кассеты из доступных вектора (например, nls-LexA:p65; идеальное выражение плазмид Gal4/LexA/QF2 могут быть найдены и получены из общих ресурсов, таких как Addgene) с помощью Грунты, перечисленные в таблице 1В.
      1. Чтобы сохранить все оригинальные транскрипционный анализ и post-transcriptional правил заменил экзона на выражение последовательности ДНК transactivator, Дизайн кассету таким образом, что отредактированный геномной аллеля выскажет химерных мРНК из transactivator и ген. Сохраните 5' и 3' концу целевых экзона сохранить любой сплайсинга сигнал.
      2. Включать T2A самостоятельно расщепления пептидов последовательность между остаточной 5' кодирования экзона и transactivator последовательность для предотвращения перевода на химерных белка. Добавьте перевод стоп кодоном после экзогенных transactivator последовательности (рис. 5).
    2. PCR усиливает гомологии оружия от геномной ДНК (геномная ДНК), извлеченные из родительского летать линии, выбранных для инъекций (Например, нос Cas9 (на Х-хромосоме), BL # 54591) используя праймеры, перечисленные в таблице 1В. Используйте высококачественный полимеразы для всех реакций ПЦР, с использованием систем следующим: 5 мкл 5 x буфер реакции, 0.5 мкл 10 мм дНТФ, 1,25 мкл 10 мкм вперед грунт, 1,25 мкл 10 мкм вспять грунт, 0.5 мкл шаблон ДНК, 0,25 мкл высокой верности ДНК-полимераза , 16.25 мкл ddH2O.
    3. Использование линеаризованного клонирования вектор, например pUC19. Ряд доноров векторов теперь доступны. Посмотреть полный список на следующих веб-сайт http://flycrispr.molbio.wisc.edu.
    4. Запуск продуктов ПЦР на геле агарозы 1%. Провести электрофорез для достаточно времени, чтобы обеспечить четкое разделение нужный диапазон от нежелательных неспецифичных (если таковые имеются). Гель очищайте ожидаемых фрагментов ДНК. Измерьте концентрацию каждого очищенная ДНК фрагмента с помощью спектрофотометра.
    5. Настройка реакции Ассамблеи ДНК после инструкции производителя. Смешать линеаризованного клонирования вектор и целевых фрагментов из шаг 3 и шаг 4 в следующей реакции: 1 мкл линейных клонирования вектор (50 нг/мкл), 2 – 3 раза избыток каждого целевого фрагмента, 10 мкл 2 x ДНК Ассамблеи мастер перемешивают, доводят объем окончательной реакции до 20 мкл с ddH < C21 > 2O. инкубировать реакция смеси на 1 час при температуре 50 ° C.
    6. Трансформировать 2 мкл Ассамблея продукта в компетентных бактерий, плиты на плиты агара LB/Amp, содержащий ампициллина 100 мкг/мл. Кроме того добавьте X-Гал + IPTG на пластину для скрининга синий/белый.
    7. Выберите 3-4 белых колоний от пластины инкубируют на ночь, прививок колонии в 3 мл LB, содержащий ампициллина 100 мкг/мл и расти при 37 ° C ночь в шейкере. Экстракт плазмиды от ночлега культивированный бактерий с помощью комплекта мини-prep плазмида после производитель вручную (см. Таблицу материалы).
    8. Экран положительных колонии PCR или ограничение пищеварение.
    9. Последовательность проверки HDR доноров региона окончательного плазмиды. Сохраните бактериальные запас преобразована с правильным клонов в 20% глицерина в-80 ° C для будущих прививка.

3. эмбриона инъекции, летать генетики и отбора для изменения генома

  1. Подготовьте высокой чистоты свободных эндотоксина gRNA выражение вектор, а также HDR доноров плазмида с помощью плазмида maxiprep комплекта (см. Таблицу материалы).
  2. Совместное придать микрофлорой Нос Cas9 эмбрионы6gRNA выражение плазмида (100 нг/мкл) и замена доноров (500 нг/мкл). Примечание: мы используем коммерческой службы для инъекций, но эта процедура может быть выполнена в лаборатории также.
  3. Летите, генетика и скрининга (рис. 2 и рис. 3):
    1. Когда эмбрионы вводят развиваются во взрослых, крест каждый одного G0 летит балансировки мух. Выберите подходящие балансировки для хромосомы, содержащий целевых аллеля.
    2. Анестезировать F1 потомство от каждого G0 крест на площадку CO2 и случайным образом выбрать 10-20 мужчин под стереомикроскопом. Пересекать их индивидуально для балансировки женщин как показано на рисунке 3.
    3. Когда личинки Люк F2, выбрать один отец F1 от каждого Креста и извлечь геномная ДНК, используя один летать геномной ДНК подготовки протокола:
      1. Подготовить геномная ДНК извлечения буфер: 10 мм трис-Cl рН 8,2, 1 мм ЭДТА, 25 мм NaCl, хранить при комнатной температуре. Подготовка 20 мг/мл протеиназы K Стоковый раствор и хранить в холодильнике.
      2. Положите каждый летать в микро пластиковых пробирок 1.5 мл и этикетке трубки. Храните в морозильной камере-80 ° C на ночь.
      3. Подготовьте свежий Рабочий объем геномная ДНК извлечения буфер, содержащий 200 мкг/мл конечная концентрация K. протеиназы
        Примечание: Не используйте старый буфер для этого шага.
      4. Хлюпать каждый летать на 10 – 15 s с кончика пипетки, содержащие 50 мкл squishing буфера без дозирования жидкости. Распределить оставшиеся буфера в трубку и хорошо перемешать. Инкубируйте при 37 ° C для 20-30 мин.
      5. Положите труб в блоке 95 ° C тепла для 1 – 2 мин для инактивации K. протеиназы
      6. Уменьшается на 5 мин на 10000 x g. Храните подготовку на 4 ° C для дальнейшего анализа ПЦР.
  4. Используйте тот же метод для подготовки геномная ДНК от Нос Cas9 Муха, который служит в качестве отрицательного контроля. Выполните три шага ПЦР на основе экранов для определения правильного «концы,» использование HDR (рис. 2, рис. 5) геномная ДНК каждого мужчины F1 как шаблон5. Использовать 1 мкл ДНК prep в системе следующие реакции PCR: 10 мкл 2 x ПЦР Мастер микс с красителем, 1 мкл каждого праймера (10 мкм), 1 мкл шаблона дна и 7 мкл ddH2O.
  5. Как показано на рисунке 5А, выполните PCR используя праймеры fwd1 и rev1 экран для существования вставки или замены; Выполните ПЦР с помощью fwd2 и rev2 Праймеры для проверки вставки или замены из 3' региона; Выполняйте PCR используя праймеры M13F и rev3 проверить «заканчивается в» HDR (Таблица 1 c).
  6. Держите летать линии с подтвержденным HDR концы out и установить сбалансированные запасов от поколения F2. Подмес балансировки мух снова, чтобы удалить любые непреднамеренные мутации на другие хромосомы.
  7. Подготовить высококачественные геномная ДНК из установленных запасов для усиления длинные ПЦР (> 800 – 1000 nt) ампликон последовательность полимеразы Taq высокой точности и полностью проверить ампликонами, полученной геномной инженерии регионов. Кроме того, использовать экстракт сырой геномная ДНК как описано ранее для того чтобы усилить короче (< 800 nt), перекрытия продуктов ПЦР для проверки последовательности отредактированный генома. Чтобы подготовить хорошее качество дрозофилы геномной ДНК используйте следующий протокол:
    1. Положите около 25 взрослых мух в пробки microcentrifuge 1,5 мл и заморозить в морозильной камере-20 ° C или ° C-80 для по крайней мере 1 час.
    2. Добавить 250 мкл раствора A (рН 9,0 Tris-HCl 0,1 М, ЭДТА 0,1 М, SDS 1%).
    3. Однородный мух с помощью гомогенизации бабы в microcentrifuge трубы и положил трубку на льду.
    4. Инкубируйте на 70 ° C за 30 мин.
    5. Добавить 35 мкл KOAc (5 М), дрожание и перемешать хорошо, но делать не вихря.
    6. Инкубируйте на льду за 30 мин.
    7. Спина на 12000 g x 15 мин.
    8. С 1 мл микропипеткой тщательно передавать только ясно супернатант новой трубки, оставляя обратно любой преципитат или межфазное.
    9. Добавьте 150 мкл изопропанола супернатант. Аккуратно перемешать путем инверсии.
    10. Спина на 10000 x g за 5 мин.
    11. Тщательно удалить супернатант и оставить гранулы в трубку.
    12. Помыть лепешка с 1 мл 70% EtOH.
    13. Спина на 12000 x g за 5 мин.
    14. Удалите супернатант. Воздух сухой Пелле за 15-20 мин. Не более сухие гранулы.
    15. Растворяют гранулы в 100 мкл ddH2O.
    16. Используйте высококачественный ДНК-полимеразы, подходит для длительного ампликон (> 800 bp) для того чтобы усилить полный отредактированный региона. В идеале принять двух праймеров вне вставленной кассета для того чтобы усилить геномной региона. Гель очистить продукт PCR, и как было описано ранее, последовательность проверки продукт с нескольких перекрывающихся грунтовки.
  8. Проверьте правильное выражение пространственно-временных моделей из расчлененных тканей/эмбрионы инженерии летать линии:
    1. Выполните RT-PCR от всего РНК для проверки экспрессии мРНК гибридного продукта (Таблица 1 d).
    2. Выполните в situ гибридизация продукта mRNA интереса в личиночной тканей/эмбриона для проверки выражения.
    3. Экран для точное выражение ткани конкретных пространственно-временных структур среди проверить последовательность заканчивается вне линии, крест, каждая из строк редактируемого полученные двоичные выражения драйвера с LexO- GFP или LexO- RFP (для Лекса драйвер) линии (доступно из Блумингтон биржевых центров) и наблюдать за Лекса или Gal4 инициативе экспрессии гена репортера в эмбрион, личинок и взрослых тканях под флуоресцентным микроскопом.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Этот протокол был успешно использован для создания конкретного целевого двоичного выражения системы репортер на bnl , выражая клетки5. СНГ-регуляторных элементов (КРЕС), которые контролируют сложных пространственно-временных bnl выражение не отличаются. Таким образом для достижения пространственно-временных выражение под контролем регулирующих последовательности эндогенного bnl , только первый кодирования экзона bnl был призван заменить последовательность бактериальной Лекса transactivator. Улучшенная nls-LexA::p65 кассеты, известный для обеспечения оптимальной выражение в дрозофилы был выбран.

Стратегия замены, направленных для создания химерных nls-LexA:p65-bnl мРНК под эндогенного транскрипционный анализ и post-transcriptional контролем. Этот химерных мРНК содержится нетронутыми bnl 5' УТР, частью конце 5' и 3' концу отредактированный bnl кодирования экзона (первый экзона) и полный течению bnl интронов и экзонов. Для сохранения сплайсинга bnl РНК конкретных сменил экзона, были сохранены небольшие 5' и 3' концы сменил кодирования экзона. Однако, чтобы предотвратить синтез белка химерных Bnl сливается с nls -LexA: p65, T2A самостоятельно расщепления пептидов последовательность была включена между остаточной 5' bnl кодирования региона и ГПТ из nls-LexA:p65. Кроме того, остановка кодоном перевод был добавлен после nls-LexA:p65 последовательность, чтобы избежать совместного перевода усеченного белка Bnl5 (рис. 4 и Рисунок 5A).

Была использована замена доноров, содержащий все эти особенности, который имел T2A-nls-LexA:p65 последовательность и 2 КБ 5' - и 1,8 kb 3' - гомологии оружия. Длинные гомологии оружия были использованы для эффективного HDR и вставки большого фрагмента ДНК на месте ремонта (T2A-nls-LexA:p65 1.8 КБ) (Рисунок 5A).

Два оформления были использованы для создания DSBs в определенных позициях, чтобы удалить большую часть первого кодирования экзона bnl. Два оформления, которые соответствуют всем критериям, описанные в разделе 1.3 (Пэм последовательность подчеркнул) были:
gRNA1: TGTATCTGCGATGCCCCTCATGG
gRNA2: ATCCTTCAGATATTGCGGGATGG

В замене донор обоих сайтов признание gRNA были сорваны экзогенных T2A-nls-LexA:p65 последовательность, которая является самым простым способом избежать переориентацию оформления для инженерии Локус. Нарушена gRNA признание в последовательности замены доноров (экзогенных последовательностей, которые сорвали gRNA признание сайтов курсивом) были:
gRNA1: TGTATCTGCG -GGCTCCGGCGAAGGAC...
gRNA2:... AAAAACTCGTTTAGA- CGGGATGG

Вектор выражения gRNA pCFD4, содержащие эти оформления, а также замена доноров, был совместно вводят в микрофлорой Нос Cas9 эмбрионов. Протокол, описанные здесь был впоследствии экран для предполагаемой замены (Рисунок 5B, C). Около 67% вводят G0 животных были плодородные. И 56% из плодородной G0s были учредителей, вызвавших HDR-положительных потомства. Среди потомства F1 проверил около 23% были положительными для успешного HDR, и 73% положительных HDR были «концы out» (Таблица 2). С момента первого кодирования экзона bnl был «нокаут», были найдены все линии HDR быть гомозиготных смертельной и запасы были сохранены на балансиры.

Поколение химерных LexA-bnl мРНК в клетках был подтвержден ПЦР-анализы (рис. 5 d). Чтобы проверить, если полученные bnl-Лекса линии были выражены в шаблоне выражения эндогенного bnl , каждая линия «концы out» HDR был пересечен LexO-mCherryCAAX трансгенных мух5и выражению репортер был изучен в потомстве эмбрионов и личинки. 42 гостям из 46 линий показали точные пространственно-временных выражение, в соответствии с ранее сообщалось bnl узоры5 (рис. 6). Четыре линии показал либо шаблоны слабых или неспецифических выражений. Мы прогнозируем, что эти линии могут накопили мутации, которые мы должны проверить с тщательной последовательности анализа. Вместе эти результаты подтвердили, что стратегия замены HDR-опосредованной экзона успешно могут быть использованы для создания системы целевого двоичного выражения гена. Инструмент можно успешно использовать для выражения репортер или внематочная генов в пространственно-временных структур bnl гена.

Figure 1
Рисунок 1: схема системы Бинарные транскрипции для экспрессии целевых генов. Transactivator (GAL4 или LexA), выразил под контролем СНГ-регуляторных элементов (КРЕС) гена, диски эффекторных трансген, размещенных ниже по течению от конкретных транскрипции сайтов связывания (UAS для Gal4 или LexAop для LexA). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: обзор рабочего процесса для редактирования для создания системы Бинарные транскрипции генома, ТРИФОСФАТЫ/Cas9-опосредованной. Приблизительное время продолжительности, необходимой для каждого шага отображается. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: Иллюстрация ТРИФОСФАТЫ скрининга и генетических кросс-схемы для создания генома редактировать летать линии. В генетических кресты R означает отредактированный аллеля, который находится в 3-й хромосоме. MKRS (Миссис Tp (3; 3), M (3) 76а ry кар [1] [1] [2] Sb [1]), является маркером 3й хромосомы; TM6B (В TM6B (3LR), Antp [Ху] e [1] Tb[1]) является 3й хромосомы балансировки. Геном редактировать летать запасов проверяются методом ПЦР, усиливая целевых регионах интереса от геномной ДНК, извлеченные из F2 или F3 поколения мух и последовательность определения продуктов PCR. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4: поколение Замена кассеты Ассамблеей ДНК. Схематический рисунок с изображением амплификации PCR и монтаж различных продуктов ПЦР (a, b и c) в (d) с помощью метода ДНК Ассамблеи вектор доноров. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5: Поколение Bnl Лекса ТРИФОСФАТЫ/Cas9-опосредованной экзона замены. (A) схема, рисунок, изображающий стратегии ТРИФОСФАТЫ/Cas9 при посредничестве HDR для замены экзона в локусе bnl . Коробка - экзона; линия Интрон; были продемонстрированы замена доноров (pDonor -bnl:LexA) и два возможных результатов HDR. PDonor -bnl:LexA имеет следующие особенности: (1)T2A-nls-LexA:p65 (~1.8kb) последовательности окружении 2 КБ и 1.8 kb долго гомологии оружия (пунктирные линии), (2) самостоятельно расщепления пептид T2A между остаточной экзона терминала bnl N и NLS-LexA:p65и (3) кодон остановить перевод (красный *) после nls-LexA:p65 последовательности. HDR продукт сохраняет все транскрипционный анализ и post-transcriptional контроль bnlи LexA: p65 белка, как ожидается, будет производиться в той же схеме, как эндогенных Bnl. Малые черные стрелки показывают относительной привязки сайтов (не в шкала) используется для 3-шаг проверки или проверки RT-PCR праймеры PCR (Таблица 1). (B) геля агарозы фотографии показаны результаты скрининга PCR 3-шаг. Продукты PCR, усиливается от геномной ДНК четыре успешных концы из HDR линий отображаются; отрицательный контроль, геномной ДНК нос-Cas9 родительские строки; положительный контроль, pDonor -bnl:LexA плазмиды; M, маркер (SL2K ДНК лестница). (C) пример гель скрининга, показаны ожидаемые ПЦР продукта с помощью грунтовки M13F и rev3 концы линий; M8-7 и M9-6 являются два концы линий; негативные и позитивные элементы, так же, как и B; M, маркер (NEB 1 kb ДНК лестница). (D) ПЦР-анализ всего РНК от Bnl Лекса и Нос Cas9 управления мухи. Вперед грунтовка привязывается к конкретному региону LexA , обратный грунтовка привязывается к течению bnl экзона региона; ~ 440 полоса усиления bp (base пара) (*) было обнаружено от-ПЦР на Bnl Лекса мРНК, но не от элемента управления РНК. M, 100 bp маркер (нос). Адаптировано из цифры 2 и S1 в Du и др. 20175. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 6
Рисунок 6: Проверка Bnl Лекса ткане- и условного выражения в различных тканях. Выражение bnl (A-D) (красный) в различных тканях личинок, btl , выражая клетки показано зеленым цветом. (A, A') Крыло диск bnl источник опережает рост воздушного мешка зачаток (ASP). (B, C) BNL выражение в поперечных соединительных TR5 (TC) (B) и TR2 спинной ветви (DB) (C). (D) bnl выражение в половых диски. (E-J) Динамических bnl выражение (красный) во время структурирования эмбриональных трахеи филиал (зеленый); Небольшие стрелки, пять источников bnl , окружающих трахеи плакоды на этапе 10. Генотипы: A-J; BTL-Gal4, бас- CD8GFP / +; Чемпионат Италии по теннису Лекса, LexO- CherryCAAX /+. (K-L») Гипоксияиндуцированных Bnl Лекса выражение профиль крыла дисков и связанные TR2 трахеи metamere (TC, DB, спинной ствола DT). Генотип: Bnl Лекса, LexO -CherryCAAX / +. (K) управления диски от ex vivo культивированный органов без CoCl2. Крыло диски (L-L») (L, L') и трахеи (DT, (L'')) от искусственного ex vivo органов с CoCl2 индуцированной гипоксии. Звезда, внематочная выражение, вызванных гипоксией. Масштаб баров = 30 мкм; 50 мкм (K-L»). Адаптировано из рис в Du и др. 20175. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

A. gRNA клонирование и секвенирование
Чемпионат Италии по теннису Лекса gRNA передний TATATAGGAAAGATATCCGGGTGAACTTCg TGTATCTGCGAT
GCCCCTCAGTTTTAGAGCTAGAAATAGCAAG
Чемпионат Италии по теннису Лекса gRNA rev ATTTTAACTTGCTATTTCTAGCTCTAAAAC TCCCGCAATATCTGAAGG
ВcGACGTTAAATTGAAAATAGGTC
T3 грунтовка используется для виртуализации CAATTA ACCCTCACTAAAGG-3'
Примечание: нуклеотидов подчеркнул отжига U6 промоутер или gRNA ядро на вектор pCFD4, строчная g/c был добавлен для помощи U6 промоутер зависимых транскрипции
B. HDR доноров строительство
BNL N-F_pUC19 AATTCGAGCTCGGTACtgtggtctttgaggctggaac
Чемпионат Италии по теннису Лекса N-R tCCGcaagtCagtAGgctgccgcgtccttcgccggaGCC CGCAGATACAAGGCCC
C
lexA-F CTactGacttgCGGaGAtGTcGAaGAGAACCCtGGCCCt ATGCCACCCAA
GAAGAAGC
lexA-R CTAAACGAGTTTTTAAGCAAACTCACTC
Fwd BNL lexA-C TAAAAACTCGTTTAGACGGGATGGCGTTGTCAAC
Чемпионат Италии по теннису C-R_pUC19 GCCAAGCTTGCATGCCtcgcataattgccgcctgg
Примечание: нуклеотидов в капитала совпадения с pUC19 вектор для Ассамблеи Гибсон, нуклеотиды подчеркнул были последовательности навеса для добавления T2A пептида.
C. HDR скрининг и последовательности
Чемпионат Италии по теннису Лекса scr fwd1 GTGGCGCACGCCCAATAAAC
Чемпионат Италии по теннису Лекса scr rev1 GATCCCAGCCAATCTCCGTTG
Чемпионат Италии по теннису Лекса scr fwd2 CAACGGAGATTGGCTGGGATC
Чемпионат Италии по теннису Лекса scr rev2 CTGGCCAACTGTAGGGAAGTC
проверка заканчивается в rev3 GCAATGTTATGCAATGCGTTGAC
Чемпионат Италии по теннису Лекса seq fwd3 CACTTGTCGCCCATATTGATACAATTG
Примечание: Эти грунты были использованы для PCR скрининг и последовательности, приблизительное расположение сайтов связывания праймера показаны на рисунке 5А как fwd1-2 и Rev. 1-3.
D. ПЦР-анализа
RT-f GATATGGATTTCTCCGCTTTGCTG
RT-r CCATGCAGAGATACAGGCAAGTG

Таблица 1: Праймеры используются в настоящем исследовании. (A) Праймеры для клонирования gRNA выражение вектор и последовательности. (B) Праймеры для клонирования HDR доноров шаблон. (C) грунты для скрининга и последовательности продуктов HDR. Грунтовки (D) используется для проверки RT-PCR химерных LexA-bnl мРНК продукта.

генотип HDR передачи ставка % (# HDR-уступая G0 / # плодородные G0) # Общая F1 F1 / # HDR-положительных проверил (%) # «концы out» HDR / # всего HDR (%)
Чемпионат Италии по теннису Лекса 56 (15/27) 23 (60/259) 73 (46/60)

Таблица 2: эффективность ТРИФОСФАТЫ/Cas9-опосредованной HDR. Скорость передачи HDR рассчитывается как # HDR-уступая G0 / # всего плодородные G0. Успешное HDR % рассчитывается как # HDR-положительных F1 / # всего F1 экранированные. «Концы out» % рассчитывается как # «концы out» HDR / # общего позитивного HDR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Традиционно Drosophila enhancer ловушки были получены двумя различными способами. Один из способов включает случайные вставки водителя (например., Gal4) последовательность в геноме, транспонирования (например., P-элемент транспонирования)1 . Кроме того водитель последовательности могут находиться под контролем транскрипционный анализ предполагаемого усилитель/промоутер региона в конструкцию плазмиды, которые затем будут интегрированы в внематочная сайт генома3,11. Хотя эти методы породили большой бассейн Gal4 или LexA усилитель ловушки для дрозофилы, они имеют некоторые ограничения. P-элемент опосредованной случайные вставки в геноме может нарушить нормотворческая деятельность критических СНГ-регулирования последовательности. Из-за случайного транспонирования в геноме transactivator выражение может сообщать шаблоны нескольких соседних генов. С другой стороны предварительное знание СНГ регуляторные последовательности гена необходим для enhancer ловушка плазмидные конструкции. Существует также ограничение на длину последовательности, которые могут быть клонированы и испытаны в конструкцию плазмиды. Изоляция и клонирования лишь частичное фрагмент ДНК из эндогенных геномной контекста может не воспроизводить полное выражение ген специфического шаблонов. Например линии bnl-Gal4 (NP2211), которая была порождена P-элемент вставки усилитель ловушки Gal4 элемент просто впереди bnl гена, не полностью воспроизвести ген специфического выражение закономерности в эмбрион5 . Таким образом в таких контекстах, повторное использование методов, таких как взломать (гомологии помощь ТРИФОСФАТЫ забивные), что можно преобразовать существующие Gal4 линий в другой Лекса или Q-системы на базе драйвера линия12 может оказаться весьма полезным. Здесь, чтобы преодолеть эти ограничения, мы описали эффективным и альтернативный метод для генерации двоичного выражения систем путем изменения генома. В этом методе, первый кодирования экзона гена поменялись местами с transactivator (например., Лекса или Gal4) последовательность таким образом, чтобы выражение транскрипции драйвера исключительно имитирует пространственно-временных закономерности экспрессии генов. Хотя стратегии и протоколы, описанные здесь были оптимизированы для bnl -выражения, метод может быть легко принят для других генов.

Определение вставки сайт в регионе целевых генов является наиболее важным этапом в осуществлении этой экспериментальной стратегии. Метод, который мы представили был разработан для сохранения всех транскрипционный анализ, а также post-transcriptional правил bnl гена5оригинала. Таким образом мы планировали удалить большую часть первого кодирования экзона гена bnl и заменить его с LexA кассеты. Замена была запланирована таким образом, что отредактированный аллеля выражает гибрид LexA-bnl mRNA от эндогенных транскрипции и трансляции начать сайт bnl сохраняя все в intronic регионах. Однако гибрид, мРНК был спроектирован, чтобы производить только LexA белка, но не Bnl. Мы показали, что эта стратегия успешно сформированных bnl LexA /LexO-на основе системы транскрипции и что система может точно сообщить динамический, пространственно-временных bnl выражение шаблоны (рис. 5)5 . Ограничение этого процесса является гомозиготных летальность в линии дрозофилы , если целевые ген имеет важное значение для выживания. Кроме того использование двойного gRNA стратегии может увеличить вероятность пробить редактирования. Чтобы избежать этих проблем может использоваться альтернативная стратегия. В этой стратегии Лекса или Gal4 кассеты могут быть размещены право на ГПТ стартовый сайт сменил гена и T2A самостоятельно расщепления пептидов последовательности могут быть размещены между LexA/Gal4 кассету и началом нетронутыми кодирования экзона о целевого гена. Ожидается, что эта стратегия создания химерных мРНК, которые могут быть переведены на transctivator и функциональных генов продукта. Такая конструкция может возможно уменьшить вероятность гомозиготных летальность. В этой стратегии один gRNA является достаточным для изменения генома. Однако, при наличии двух копий функциональных генов, выражение вариантов трансгенных белка, управляемый водителем Gal4/LexA (например., Bnl Лекса инициативе выражение LexO- Bnl: GFP сплавливания, или Bnl белки с удалений) не будет предоставлять информацию о функциональности вариант белков.

Ограничение изменения генома стратегии является трудоемкий процесс целенаправленного и редактирование одного гена одновременно. Однако простота и эффективность ТРИФОСФАТЫ/Cas9-опосредованной генома редактирования метода революционизировали целевых геномной Стук стук заезда и замена технологии, которая легко может быть принят в любой стандартный лаборатории созданы. В последние несколько лет дрозофила исследователи разработали удобный инструментарий для изменения генома, которые могут быть использованы для расширения генетических наборы инструментов, необходимых для понимания основных биологических процессов7,13 . Геном редактирования и отбора процессов, описанных здесь относительно быстрее и занимает около двух месяцев по сравнению с любой другой гомологичных на основе рекомбинации замены. Для успешного и эффективного редактирования генома результаты, важно следовать несколько технически критических этапов: 1) каждый gRNA выбирается по максимальной строгости и деятельность без потенциальных мимо; 2 HDR доноров содержит ~1.5 КБ гомологии оружия фланговые gRNA ориентации сайтов. Более гомологии оружия (1.8-2 КБ) используются для повышения эффективности HDR, когда большой экзогенной ДНК фрагмента необходимо вставить; 3 HDR доноров предназначен для быть свободными gRNA признание сайтов, чтобы избежать переориентацию gRNA к инженерии Локус; и 4) надежной разработать план и координации сроков генетических кресты с 3-шаг на основе ПЦР скрининга для выбора линии HDR «концы out».

В отличие от случайного транспонирования или клонированный усилитель конструкции, стратегии и протоколы, мы описали здесь гарантирует поколение исключительно целевой системы Бинарные транскрипции ген специфического. Поскольку выражение водителя заменяет экзона гена родной, ген специфического выражение драйвера также универсален и, как ожидается, имитировать картин выражения гена под все условия развития, метаболические и физиологических5. Клетки/ген специфического выражение является наиболее желательных критериев все линии двоичного драйвера, когда они используются в различных клеток и биологии развития методов. Например ген специфического экспрессии генов репортер водителем транскрипции облегчает анализ надежной линии клеток, выражая целевого гена. Он также позволяет жить imaging и отслеживание пространственно-временных выражение, миграции и реорганизации ячеек во время разработки. Для расследования событий, клеточном и молекулярном во время ткани морфогенеза, Gal4 или LexA инициативе гиперэкспрессия/которое из различных трансгенов и опосредованного системой РНК-интерференции генов нокдаун в определенные наборы ячеек являются необходимыми. Система весьма конкретных целевых выражение предоставляет объективную анализа и интерпретации результатов. Таким образом на основе ТРИФОСФАТЫ/Cas9 ориентации экзона гена и его замена с последовательностью transactivator обеспечивает лучшей альтернативой для генерации системы выражения весьма конкретных целевых генов.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют никаких конфликтов интересов раскрыть.

Acknowledgments

Мы благодарим д-р F. порт, доктор K. о ' Коннор-Джайлс и д-р S. Фэн для обсуждения стратегии ТРИФОСФАТЫ; Д-р т.б. Корнберг и центр фондовой Блумингтон реагентов; UMD изображений основного фонда; и финансирование из низ: R00HL114867 и R35GM124878 в СР.

Materials

Name Company Catalog Number Comments
X-Gal/IPTG Gentrox (Genesee Scientific) 18-218 cloning
LB-Agar BD Difco BD 244520 cloning
Tris-HCl Sigma Aldrich T3253 Molecular Biology
EDTA Sigma Aldrich E1161 Molecular Biology
NaCl Sigma Aldrich S7653 Molecular Biology
UltraPure DNase/RNase-Free Water ThermoFisher Scientific 10977-023 Molecular Biology
10% SDS Sigma Aldrich 71736 Molecular Biology
KOAc Fisher-Scientific P1190 Molecular Biology
EtOH Fisher-Scientific 04-355-451 Molecular Biology
GeneJET Miniprep ThermoFisher Scientific K0503 Miniprep
PureLink HiPure Plasmid Maxipep kits ThermoFisher Scientific K210006 Maxiprep
BbsI NEB R0539S Restriction enzyme
Primers IDT-DNA PCR
pCFD4 Kornberg Lab DNA template and vector for gRNA
KAPA HiFi Hot Start- (Kapa Biosystems) Kapa biosystems KK2601 PCR
Q5-high fidelity Taq NEB NEB #M0491 PCR
Gibson Assembly Master Mix NEB NEB #E2611 DNA assembly
pBPnlsLexA:p65Uw Addgene DNA template for LexA amplification
Proteinase K ThermoFisher Scientific 25530049 Molecular Biology
2x PCR PreMix, with dye (red) Sydlab MB067-EQ2R Molecular Biology
Gel elution kit Zymo Research (Genesee Scientific) 11-300 Molecular Biology
TRI reagent Sigma-Aldrich Molecular Biology
Direct-zol RNA purification kits Zymo Research (Genesee Scientific) 11-330 Molecular Biology
OneTaq One-Step RT-PCR Kit NEB E5315S Molecular Biology
lexO-CherryCAAX Kornberg Lab Fly line
UAS-CD8:GFP Kornberg lab Fly line
btl-Gal4 Kornberg lab Fly line
MKRS/TB6B Kornberg lab Fly line
Confocal Microscope SP5X Leica Imaging expression pattern
CO2 station Genesee Scientific 59-122WCU fly pushing
Stereo microscope Olympus SZ-61 fly pushing
Microtube homogenizing pestles Fisher-Scientific 03-421-217 genomic DNA isolation
NanoDrop spectrophotometer ThermoFisher Scientific ND-1000 DNA quantification

DOWNLOAD MATERIALS LIST

References

  1. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, (2), 401-415 (1993).
  2. Lai, S. -L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nature Neuroscience. 9, (5), 703-709 (2006).
  3. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141, (3), 536-548 (2010).
  4. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  5. Du, L., Zhou, A., Patel, A., Rao, M., Anderson, K., Roy, S. Generation of a targeted expression system for branchless and characterization of novel cellular expression patterns of the gene in Drosophila. Developmental Biology. 427, (1), 35-48 (2017).
  6. Port, F., Chen, H. -M., Lee, T., Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 111, (29), E2967-E2976 (2014).
  7. Gratz, S. J., Rubinstein, C. D., Harrison, M. M., Wildonger, J., O'Connor-Giles, K. M. CRISPR-Cas9 Genome Editing in Drosophila. Current Protocols in Molecular Biology. 111, (1), 31.2.1-20 (2015).
  8. Doench, J. G., Hartenian, E., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  9. Port, F., Bullock, S. L. Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nature Methods. 13, (10), 852-854 (2016).
  10. Beumer, K. J., Trautman, J. K., Mukherjee, K., Carroll, D. Donor DNA Utilization During Gene Targeting with Zinc-Finger Nucleases. G3. 3, (4), Bethesda, Md. 657-664 (2013).
  11. Pfeiffer, B. D., Ngo, T. -T. B., et al. Refinement of tools for targeted gene expression in Drosophila. Genetics. 186, (2), 735-755 (2010).
  12. Lin, C. -C., Potter, C. J. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 203, (4), 1613-1628 (2016).
  13. Li, W., Köster, J., et al. Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. Genome Biology. 16, (1), 281 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics