En effektiv strategi for å generere vev-spesifikke binære transkripsjon systemer i Drosophila av genomet redigering

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her presenterer vi en metode for å generere vev-spesifikke binære transkripsjon systemer i Drosophila ved å erstatte den første koding ekson av gener med transkripsjon drivere. Metoden CRISPR/Cas9-baserte steder en transactivator sekvens under endogene regulering av et erstattet gen, og dermed muliggjør transctivator uttrykk i genet-spesifikke spatiotemporal mønstre.

Cite this Article

Copy Citation | Download Citations

Du, L., Zhou, A., Sohr, A., Roy, S. An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing. J. Vis. Exp. (139), e58268, doi:10.3791/58268 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Binær transkripsjon systemer er kraftige genetisk verktøy brukte for å visualisere og manipulere celle skjebne og gene uttrykk i bestemte grupper av celler eller vev i modellen organismer. Disse systemene inneholder to komponenter som separate transgene linjer. En driver linje uttrykker en transcriptional aktivator under kontroll av vev-spesifikke arrangører/enhancers og en reporter/effektor linje havner et mål gen plassert nedstrøms til binding området av transkripsjon aktivatoren. Dyr skjule begge komponentene indusere vev-spesifikke transactivation av et mål genuttrykk. Presis spatiotemporal uttrykk av genet målrettet vev er avgjørende for upartiske tolkning av cellen/gen aktivitet. Derfor er det viktig å utvikle en metode for å generere eksklusive cellen/vev-spesifikk driver linjer. Her presenterer vi en metode for å generere svært vev-spesifikk målrettet uttrykk systemet ved hjelp av en "gruppert regelmessig Interspaced kort Palindromic gjenta/CRISPR-forbundet" (CRISPR/Cas)-basert genomet redigering teknikk. I denne metoden endonuclease Cas9 er rettet med to chimeric guide RNAs (gRNA) til bestemte nettsteder i de første koding ekson med et i Drosophila genomet opprette dobbel-strand bryter (DSB). Deretter muliggjør bruker en eksogene donor plasmider som inneholder den transactivator sekvensen, celle autonome reparasjon maskiner homologi-rettet reparasjon (HDR) av DSB, presis sletting og utskifting av ekson med transactivator sekvens. Banket i transactivator er uttrykt i celler der cis-regulatoriske elementer erstattet genet er funksjonelle. Detaljerte trinnvise protokollen presenteres her for å generere en binær transcriptional driver uttrykt i Drosophila fgf/branchless-produserende epithelial/neuronal celler kan brukes for alle gen - eller vev-spesifikke uttrykk.

Introduction

Genetisk verktøykassen for målrettet genuttrykk er godt utviklet i Drosophila, en av de beste modell systemene å undersøke funksjonen i gener involvert i en rekke cellulære prosesser. Binær uttrykk systemer, som gjær Gal4/UAS (oppstrøms aktivisering sekvens), ble først vedtatt for vev-spesifikke enhancer fangst og gene misexpression i Drosophila genetisk modell1 (figur 1). Dette systemet tilrettelagt utviklingen av en rekke teknikker som spatiotemporal regulering av gene overuttrykte, misexpression, knockout i valgte grupper av celler så vel som i cellen ablasjon, celle merking, live sporing av mobilnettet og molekylære prosesser i fosteret og vev, avstamning sporing og mosaikk analyser under utvikling. En rekke binære transkripsjon systemet, for eksempel den bakterielle Meglos/Meglosop systemet (figur 1) og Neurospora Q-system, er kraftig genetisk verktøy som er nå mye brukt i Drosophila, i tillegg til den opprinnelige Gal4/UAS systemet for målrettet gene expression1,2,3.

Her presenterer vi en metode for å generere svært pålitelig vev-spesifikke binære uttrykk systemet ved hjelp av en teknikk som genomet-redigering. Den nylige fremskritt innen CRISPR/Cas9 genomet redigering teknologi har tillatt enestående muligheter til å gjøre regissert genom endringene i et bredt spekter av organismer. Sammenlignet med de andre tilgjengelige genom redigering teknikkene, er CRISPR/Cas9 systemet rimelig, effektiv og pålitelig. Denne teknologien benytter komponenter av bakteriell adaptive immunsystemet: en Cas9 endonuclease Streptococcus pyogenes som skaper en dobbel-strand pause (DSB) og en chimeric guide RNA (gRNA), som leder Cas9 til en bestemt genomet nettsted for målrettet DSB4. Cellene inneholder maskiner for å reparere DSB via ulike veier. Non-homologe slutten med (NHEJ) fører til små innsettinger eller slettinger å forstyrre gen funksjon, mens homologi-rettet reparasjon (HDR) introduserer en definert regissert/ønskelig genomisk knock-i/knock-out ved hjelp av en ytre HDR-giver som en mal. Erstatning for HDR-basert strategi kan effektivt brukes til å generere en pålitelig vev-spesifikke binære uttrykk system, som kan overvinne alle begrensningene av tradisjonelle enhancer felle metoder. Vi beskriver en trinnvis fremgangsmåte for utnyttelse av CRISPR/Cas9-baserte HDR reparasjon generere en binær transkripsjon driveren linje som uttrykkes under kontroll av endogene transcriptional og post-transcriptional regulering av en Drosophila gene. Denne protokollen, vi viser generasjonen av driveren linjen gjelder branchless (bnl) genet koding en FGF familie protein som regulerer branching morphogenesis tracheal airway epitel5. I dette første koding ekson av bnl genet ble erstattet av sekvensen av en bakteriell Meglos transactivator rekkefølge uten å endre alle endogene cis-regulatoriske sekvenser av bnl genet. Vi viser at strategien generert en Bnl-Meglos driveren linje som styrer spatiotemporally uttrykk for en reporter genet plassert nedstrøms LexAoperator (LexAop eller LexO) i bnl- uttrykke epithelial/mesenchymal/neuronal celler.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. design og konstruere gRNA uttrykk vektor

  1. Nettopp erstatning for en lang definerte region i en ekson, bruk en dobbel gRNA tilnærming6, der hver gRNA kan spesifikt mål to endene av den valgte regionen rundt. For å få et nøyaktig gen-spesifikke spatiotemporal uttrykk for driveren, kan du velge to gRNA målområder innen den første koding ekson av genet.
  2. Drosophila melanogaster, Velg gRNA målområdene ved hjelp av verktøyet flyCRISPR Optimal målet Finder (http://tools.flycrispr.molbio.wisc.edu/targetFinder/). Andre tilgjengelige CRISPR verktøy kan brukes også, inkludert optimalisert CRISPR Design verktøyet (http://crispr.mit.edu), FlyCas9 (https://shigen.nig.ac.jp/fly/nigfly/cas9), og E-skarp (www.e-crisp.org/E-CRISP).
    Merk: Følgende protokoller av gRNA design og kloning ble vedtatt metodene beskrevet tidligere6,7.
    1. Kopier den nøyaktige sekvensen til boksen i online verktøyet. Velge den nylig utgitte Drosophila melanogaster genomet merknad versjonen, "r_6," i rullegardinmenyen for "Velg genomet." I "Select guide feltlengden (nt)," input "20." Velg å finne "Alle CRISPR mål" og klikk "Finn CRISPR mål".
    2. Vurdere alle kandidaten gRNA målene ved å angi "Maksimum" for "Stringens" og "NGG bare" for "PAM". Prøv å merke de gRNA nettstedene uten noen potensielle av mål eller et minimum antall av mål mulig. Bruke web-verktøyet beskrevet i Doench et al. 2014 8 for å velge gRNAs med potensielle "gode" aktivitet score.
    3. Samtidig, kontroller at det er ingen single nukleotid polymorfisme i gRNA målene i genomet av overordnede flua linjen valgt for injeksjon (F.eks nos-Cas9 på X-kromosom, BL # 54591). Følg protokollen beskrevet i Gratz et al. 20157 å trekke genomisk DNA fra fly ättlinjen. PCR forsterke, ca, 500-1000 nt regionene bruker primer som flanken sekvensen av interesse og et Hi-Fi-DNA polymerase; sekvens-kontroller PCR forsterket produktene.
  3. For å generere en tandem gRNA uttrykk vektor, kan du følge en ligatur uavhengig kloning protokollen6 å presentere to protospacer sekvenser i en pCFD4 RNA uttrykk vektor. Merk at en forbedret multi-gRNA uttrykk vektor (pCFD5) er nå tilgjengelig hvor begge sgRNAs uttrykkes fra sterke U6:3 arrangører9 (https://www.crisprflydesign.org). Bruke en DNA montering metode for å klone gRNAs inn pCFD4 vektor.
    1. Design og bestille revers primere for presenterer to protospacer sekvenser i RNA uttrykk vektor pCFD4 (tabell 1A). Som tidligere beskrevet6inneholder frem primer den første protospacer sekvensen flankert av regioner tilsvarer U6-1 arrangøren og gRNA kjernen i pCFD4; omvendt primer inneholder omvendt supplement sekvensen av den andre protospacer flankert av regioner tilsvarer gRNA kjernen og U6-3 arrangøren i pCDF4.
    2. Resuspend primere for 100 μM med DNase og RNase-fri dobbel destillert vann (ddH2O). Gjør en 10 μM arbeider konsentrasjon primer. Bruke pCFD4 plasmider som mal og Definer PCR reaksjon bruker en Hi-Fi-utvalg og anbefalte innstillinger for PCR reaksjon6.
    3. For å klone forsterket produktet i pCFD4, fordøye pCFD4 plasmider med BbsI enzym ved å konfigurere følgende reaksjon: 2-5 μg av pCFD4 plasmider, 5 μL 10 x fordøyelsen buffer, 1 μL BbsI enzym og ddH2O å bringe endelige volumet til 50 μL. Bland reaksjon innholdet ved forsiktig å trykke røret og samle alle de spredte dråpene fra veggen av røret til bunnen av et kort spinn. Inkuber reaksjonen blanding ved 37 ° C i 2 timer.
    4. Kjøre PCR produktet fra trinn 2 og fordøyd produktet fra trinn 3 på en 1% agarose gel. Utføre geleelektroforese for nok gang å helt eget DNA-band. Klipp riktig størrelse DNA band under en UV trans-illuminator før rensing forventede produktene bruker gel elueringsrør kolonne etter produsentens instruksjoner (se Tabell for materiale). PCR produktet skal 600 bp og lineær pCFD4 plasmider skal ~6.4 kb 6.
    5. Definere DNA montering reaksjonen i et PCR-rør, per produsentens instruksjoner (se Tabell for materiale).
    6. 2 μL montering produktet forvandle kompetent bakterier (DH5α eller lignende stammer med ΔrecA1, ΔendA1), plate på Ampicillin (100 μg/mL) som inneholder LB (LB/Amp) agar plater og ruge på 37 ° C over natten. Merk at DNA montering blanding kan være giftig for visse bakteriestammer, men fortynne montering blandingen kan redusere toksisitet.
    7. Velg 3-4 ampicillin-resistente kolonier fra overnatting-ruges plate, vaksinere kolonien i 3 mL LB som inneholder 100 μg/mL ampicillin, og vokser inokulerte bakterier i en shaker 37 ° C over natten. Ekstra plasmider fra overnatting-kulturperler bakterier ved hjelp av plasmider mini prep kit følger produsentens instruksjoner (se Tabell for materiale).
    8. Sekvens plasmider med T3 universell primer skjermen for riktig kloner som inneholder tandem gRNA innsetting. Opprette en glyserol lager av bakterier forvandlet en sekvens-verifiserte pCFD4-gRNA i 20% glyserol og oppbevar i en-80 ° C fryseren for fremtidig bruk.

2. designe og lage HDR Donor

  1. For genomisk banke på en Gal4 eller Meglos sekvens, kan du utforme en double-strandet HDR donor som inneholder den transactivator sekvensen flankert av to homologi armer.
    1. Bruk > 1,5 kb venstre og høyre homologi armene flankert gRNA målretting (r). Utvidet homologi armene øke effektiviteten av HDR under reparasjon prosessen 10.
    2. PCR forsterke homologi armene fra genomisk DNA (gDNA) Hentet fra overordnede flua linjen valgt for injeksjon (F.eks nos-Cas9 (på X-kromosomet), BL # 54591). Bruke et proof-leser hot-start Taq-DNA polymerase enzym egnet for lange PCR forlengelsen (se Tabell for materiale). Sekvens-kontroller.
  2. For å unngå retargeting av gRNA til ingeniør locus, utforme erstatning donor slik at webområdene gRNA anerkjennelse avbrutt av eksogene sekvensen introdusert.
    Merk: for å unngå endre antatte cis-regulatoriske elementene, alltid velge webområdene gRNA anerkjennelse i koding ekson regionen.
  3. Genererer en ny kassett, planlegge DNA montering strategien å bli fire segmenter sammen: 5' og 3 homologi armene, midterste eksogene transactivator DNA sekvensen og lineær kloning vektor ryggraden (f.eks pUC19 eller andre vanlig kloning vektorer). Etter produsentens retningslinje for DNA samlingen (se tabell for materiale), designe egnet primerne for PCR forsterkning og montering på hvert segment. Resuspend primere for 100 μM med ddH2O. gjør en 10 μM arbeider konsentrasjon primer. Bruk høy kvalitet utvalg for alle PCR reaksjonene. Følg følgende protokollen:
    1. PCR forsterke kassetteninn Gal4 eller Meglos uttrykk fra en tilgjengelig vektor (f.eks nls-LexA:p65; ideelle Gal4/Meglos/QF2 uttrykk plasmider finnes og innhentet fra felles ressurser som Addgene) bruke den primere i tabellen 1B.
      1. Du beholder alle de opprinnelige transcriptional og post-transcriptional reglene av den erstattet ekson på uttrykk for transactivator DNA sekvensen ved design kassetten slik at det redigerte genomisk allelet ville uttrykke en chimeric mRNA av den transactivator og genet. Bevare 5' og 3 slutten av de målrettede ekson beholde alle skjøting signal.
      2. Innlemme en T2A selv cleaving peptid sekvens mellom gjenværende 5' koding ekson og transactivator sekvensen å hindre oversettelse til et chimeric protein. Legge til en oversettelse stopp codon etter eksogene transactivator sekvensen (figur 5).
    2. PCR forsterke homologi armene fra genomisk DNA (gDNA) Hentet fra overordnede flua linjen valgt for injeksjon (F.eks nos-Cas9 (på X-kromosomet), BL # 54591) bruke primerne oppført i tabell 1B. Bruk høy kvalitet utvalg for alle PCR reaksjonene bruker systemer som følger: 5 μL 5 x reaksjon Buffer, 0,5 μL 10 mM dNTPs, 1,25 μL 10 μM frem Primer, 1,25 μL 10 μM reversere Primer, 0,5 μL mal DNA, 0,25 μL av Hi-Fi-DNA Polymerase , 16,25 μL ddH2O.
    3. Bruk lineær kloning vektor som pUC19. En rekke donor vektorer er nå tilgjengelig. Se en omfattende liste på følgende nettsted-http://flycrispr.molbio.wisc.edu.
    4. Kjøre PCR-produkter på en 1% agarose gel. Utføre geleelektroforese av nok tid til å sikre et klart skille mellom det ønskede båndet fra uønskede uspesifisert bandene (hvis noen). Gel-rense forventet DNA fragmenter. Måle konsentrasjonen av hver renset DNA fragment bruker et spektrofotometer.
    5. Definere DNA samling reaksjon etter produsentens instruksjoner. Bland linearisert kloning vektor og målet fragmenter fra trinn 3 og trinn 4 i følgende reaksjon: 1 μL lineær kloning vektor (50 ng/μL), 2-3 ganger overskudd av hver målet fragment, 10 μL 2 x DNA montering master mix, bringe siste reaksjon volumet til 20 μL med ddH < C21 > 2O. Incubate reaksjonen blanding i 1 time ved 50 ° C.
    6. Forvandle 2 μL montering produktet kompetent bakterier, plate LB/Amp agar plater som inneholder 100 μg/mL ampicillin. Også legge til X-Gal + IPTG på platen i blå/hvit screening.
    7. Velg 3-4 hvit kolonier fra overnatting-ruges platen, vaksinere kolonien i 3 mL LB som inneholder 100 μg/mL ampicillin, og vokse på 37 ° C over natten i en shaker. Ekstra plasmider fra overnatting-kulturperler bakterier ved hjelp av plasmider mini prep kit etter produsenten brukerhåndboken (se Tabell for materiale).
    8. Skjermen positiv kolonien av PCR eller begrensning fordøyelse.
    9. Sekvensen kontroller HDR donor regionen de siste plasmider. Lagre en bakteriell lager forvandlet med riktig kloner i 20% glyserol ved-80 ° C i fremtidige vaksinering.

3. embryo injeksjon, Fly genetikk og Screening for genomet redigering

  1. Forberede høy renhet endotoxin uten gRNA uttrykk vektor samt HDR donor plasmider bruker en plasmider maxiprep kit (se Tabell for materiale).
  2. Co injisere gRNA uttrykk plasmider (100 ng/μL) og erstatning donor (500 ng/μL) i germline nos-Cas9 embryo6. Merk: vi bruker et trykkeri for injeksjon, men denne fremgangsmåten kan utføres i et laboratorium.
  3. Fly genetikk og screening (figur 2 og Figur 3):
    1. Når de injiserte embryoene utvikler til voksne, krysser hver enkelt G flyr0 til belastningsfordeling fluer. Velg passende belastningsfordeling for kromosomet som inneholder de målrettede allelet.
    2. Bedøve F1 avkom fra hver G0 krysse på en CO2 pad og tilfeldig hakke 10-20 menn under en stereomicroscope. Krysse dem individuelt til belastningsfordeling kvinner som vist i Figur 3.
    3. Når F2 Larvene klekkes, plukke enkelt F1 far fra hver kors og pakke ut gDNA ved hjelp av ett fly genomisk DNA forberedelse protokollen:
      1. Forberede gDNA utvinning buffer: 10 mM Tris-Cl pH 8.2, 1 mM EDTA, 25 mM NaCl, lagre ved romtemperatur. Forberede 20 mg/mL proteinasen K lagerløsning og lagre i fryseren.
      2. Hvert fly innlegge en 1,5 mL mikro-sentrifuge rør og Merk røret. Vær-80 ° C fryseren over natten.
      3. Klargjør et nytt volum gDNA utvinning bufferen som inneholder 200 µg/mL siste konsentrasjonen av proteinasen K.
        Merk: Ikke bruk en gammel buffer for dette trinnet.
      4. Squish hvert fly for 10-15 s med en pipette tips med 50 μL av squishing buffer uten dispensing væsken. Dispensere gjenværende bufferen inn i røret og bland godt. Ruge på 37 ° C i 20-30 min.
      5. Sette rør i 95 ° C varme blokk for 1-2 min å deaktivere proteinasen K.
      6. Nedspinning i 5 min på 10 000 x g. Lagre forberedelse på 4 ° C for videre PCR analyse.
  4. Bruke samme metode for å forberede gDNA fra en nos-Cas9 fly, som fungerer som en negativ kontroll. Utføre tretrinns PCR basert skjermer for å identifisere riktig "ender ut" HDR (figur 2, figur 5) bruker gDNA av hver F1 mann som en mal5. Bruke 1 μL det DNA prep i følgende PCR reaksjonssystemet: 10 μL 2 x PCR Master Mix med fargestoff, 1 μL av hver primer (10 μM), 1 μL DNA mal og 7 μL av ddH2O.
  5. Som vist i figur 5A, utføre PCR bruke primere fwd1 og rev1 til skjermen for eksistensen av innsetting eller utskifting; utføre PCR bruker fwd2 og rev2 primere innsetting eller erstatning fra 3 regionen. utføre PCR bruker primere M13F og rev3 å sjekke "ender-i" HDR (tabell 1 c).
  6. Holde fly linjene med bekreftet ender ut HDR og etablere balansert aksjer fra F2 generasjon. Høylytt protest å belastningsfordeling fluene igjen for å fjerne eventuelle utilsiktede mutasjoner på andre kromosomer.
  7. Forberede høykvalitets gDNA fra etablerte aksjer forsterke lang PCR (> 800-1000 nt) amplicon med Hi-Fi-Taq utvalg og fullt rekkefølgen bekrefte amplicons fra utviklet genomisk regionene. Alternativt, bruk råolje gDNA ekstrakt som beskrevet tidligere for å forsterke kortere (< 800 nt), overlappende PCR produkter sekvens-validere redigerte genomet. Bruk følgende protokollen for å forberede gode Drosophila genomisk DNA:
    1. Sett om 25 voksen fluer i en 1,5 mL microcentrifuge rør, og fryse i 20 ° C eller-80 ° C fryseren i minst 1 time.
    2. Legge til 250 μL løsning A (pH 9.0 Tris HCl 0.1 M, EDTA 0.1 M, SDS 1%).
    3. Homogenize fluene bruker homogenisere støtere i microcentrifuge rør, og legge røret på is.
    4. Ruge på 70 ° C i 30 min.
    5. 35 μL KOAc (5 M), shake og bland godt, men gjør ikke vortex.
    6. Ruge på is 30 min.
    7. Spinn på 12.000 x g i 15 min.
    8. 1 mL brønnene, med nøye overføre bare klart nedbryting til en ny tube, forlater tilbake noen utløse eller interphase.
    9. Tilsett 150 μL av isopropanol nedbryting. Bland forsiktig ved inversjon.
    10. Spinn på 10 000 x g i 5 min.
    11. Nøye fjerne nedbryting og la pellet i røret.
    12. Vask pellets med 1 mL 70% EtOH.
    13. Spinn på 12.000 x g i 5 min.
    14. Fjerne nedbryting. Luften tørr pellet i 15-20 min. Ikke tørr pellet over.
    15. Oppløse pellet i 100 μL ddH2O.
    16. Bruke Hi-Fi DNA polymerase egnet for lange amplicon (> 800 bp) å forsterke komplett redigerte regionen. Ideelt ta to primere utenfor innsatt kassett å forsterke genomisk regionen. Gel rense PCR produktet, og som beskrevet tidligere, sekvens kontroller produktet med flere overlappende primere.
  8. Kontrollere riktig spatiotemporal uttrykk mønstre fra dissekert vev/Embryo utvikling fly linjer:
    1. Utføre RT PCR fra den totale RNA å kontrollere uttrykket av hybrid mRNA produktet (tabell 1 d).
    2. Utføre en i situ hybridisering mRNA produktet av renten larver vev/embryoet å validere uttrykket.
    3. Til skjermen for nøyaktig vev-spesifikke spatiotemporal uttrykk mønstrene blant sekvens-verifiserte ender ut linjene krysser hver redigerte linje innhentet for binære uttrykk driveren med LexO- GFP eller LexO- RFP (for Meglos driver) linje (tilgjengelig fra Bloomington lager centers) og observere Meglos eller Gal4 drevet reporter genuttrykk embryo, larver og voksne vev under fluorescens mikroskop.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Denne protokollen ble brukt til å generere en målrettet binære uttrykk reporter systemet bestemt for bnl uttrykke celler5. Cis-regulatoriske elementer (CREs) som styrer komplekse spatiotemporal bnl uttrykk er ikke preget. Derfor, for å oppnå spatiotemporal uttrykk under kontroll av endogene bnl regulatoriske sekvensen, bare den første koding ekson av bnl ble utformet erstattes med en rekke bakterielle Meglos transactivator. En forbedret nls-LexA::p65 kassett kjent for å gi optimal uttrykk i Drosophila ble valgt.

Erstatning strategien rettet til å generere en chimeric nls-LexA:p65-bnl mRNA endogene transcriptional og post-transcriptional kontroll. Denne chimeric mRNA inneholdt en intakt bnl 5' UTR, en del av hele 5' og 3 slutten av den redigerte bnl koding ekson (første ekson), og fullstendig nedstrøms bnl introns og exons. For å bevare bnl RNA-spesifikke skjøting av den erstattet ekson, beholdes liten 5' og 3 endene av den erstattet koding ekson. Imidlertid å hindre syntese av et chimeric Bnl protein smeltet til nls -Meglos: p65, en T2A selv cleaving peptid sekvensen ble innlemmet mellom de resterende 5' bnl koding regionen og ATG av nls-LexA:p65. Også en oversettelse stopp codon ble lagt til etter den nls-LexA:p65 rekkefølge for å unngå co oversettelse av en avkortet Bnl protein5 (Figur 4 og figur 5A).

En erstatning donor som inneholder alle disse funksjonene ble brukt, som hadde T2A-nls-LexA:p65 rekkefølge og 2 kb 5'- og 1,8 kb 3' - homologi armer. Lang homologi armene ble brukt for effektiv HDR og innsetting av et større DNA fragment på stedet av reparasjon (T2A-nls-LexA:p65 1,8 KB) (figur 5A).

To gRNAs ble brukt til å opprette DSBs på definerte posisjonene og slette de fleste av de første koding ekson av bnl. To gRNAs som passet alle vilkårene som er beskrevet i delen 1.3 (PAM sekvens understreket) var:
gRNA1: TGTATCTGCGATGCCCCTCATGG
gRNA2: ATCCTTCAGATATTGCGGGATGG

Begge gRNA anerkjennelse områdene ble avbrutt i erstatning donor av den ytre T2A-nls-LexA:p65 -rekkefølge, som er den enkleste måten å unngå retargeting av gRNAs til ingeniør locus. Forstyrret gRNA anerkjennelse sekvenser i erstatning donor (de ytre sekvensene som forstyrret gRNA anerkjennelse områder i kursiv) var:
gRNA1: TGTATCTGCG -GGCTCCGGCGAAGGAC...
gRNA2:... AAAAACTCGTTTAGA- CGGGATGG

PCFD4 gRNA uttrykk vektoren som inneholder disse gRNAs, samt utskifting donor, var co injisert i germline av nos-Cas9 embryo. Deretter protokollen beskrevet her ble fulgt til skjermen for den tiltenkte erstatningen (figur 5B, C). Omtrent 67% av injisert G0 dyr var fruktbare. Og 56% av den fruktbare G0s var gründerne, som ga opphav til HDR-positive avkom. Blant F1 avkommet sjekket, ca 23% var positivt for vellykkede HDR, og 73% av positiv HDR var "ender-out" (tabell 2). Siden første koding ekson av bnl ble "slått ut", alle HDR linjene ble funnet for å være homozygous dødelige, og aksjene ble opprettholdt over balancers.

Generering av en chimeric Meglos-bnl mRNA i cellene var godkjent av RT PCR analyser (figur 5 d). Å bekrefte hvis innhentet bnl-Meglos linjer ble uttrykt i endogene bnl uttrykksmønster, hver "ender ut" HDR linje ble krysset til LexO-mCherryCAAX transgene fluer5og reporter uttrykk mønsteret ble undersøkt i avkom befruktede egg og larver. 42 av 46 linjer viste nøyaktig spatiotemporal uttrykk samsvarer med tidligere rapportert bnl mønstre5 (figur 6). Fire linjer viste enten svak eller ikke-spesifikk mønstre. Vi spår at disse linjene kan akkumulert mutasjoner, som skal bekreftes med grundig sekvensering analyser. Sammen bekrefter disse resultatene at HDR-mediert ekson erstatning strategien kan lykkes brukes til å generere en målrettet binære uttrykk system for et gen. Verktøyet kan med hell brukes å uttrykke reporter eller ektopisk gener i spatiotemporal mønstre av bnl genet.

Figure 1
Figur 1: sammenhengen en binær transkripsjon system for målrettet genuttrykk. En transactivator (GAL4 eller Meglos), uttrykt under kontroll av cis-regulatoriske elementer (CREs) med et kjører en effektor transgene plassert nedstrøms bestemt transkripsjon bindende områder (UAS for Gal4 eller LexAop for Meglos). Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: en oversikt over arbeidsflyten for CRISPR/Cas9-mediert genomet redigering for å generere en binær transkripsjon system. Den omtrentlige tid varigheten kreves for hvert trinn er angitt. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: en illustrasjon av CRISPR sortering og genetisk cross ordningen for å etablere genomet-endret fly linjer. Genetisk kors står R for det redigerte allelet på 3rd kromosomet. MKRS (Tp (3, 3) MRS, M (3) 76A [1] kar [1] ry [2] Sb [1]), er en 3rd kromosom markør; TM6B (I (3LR) TM6B, Antp [Hu] e [1] Tb[1]) er en 3rd kromosom belastningsfordeling. Genomet endret fly aksjer bekreftes av PCR forsterke regionene mål av interesse fra genomisk DNA Hentet fra enten F2 eller F3 generasjon fluer og rekkefølge bestemme PCR produktene. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: generasjon erstatning kassett av DNA montering. En skjematisk tegning som viser PCR forsterkning og montering av ulike PCR-produkter (a, b og c) i donor vektor (d) med en DNA montering metode. Klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: Generering av Bnl-Meglos av CRISPR/Cas9-mediert ekson erstatning. (A) skjematisk tegning som viser strategien for CRISPR/Cas9 mediert HDR ekson erstatning i bnl locus. Box - ekson; linje-intron; erstatning giver (pDonor -bnl:LexA) og to mulige utfall av HDR ble vist. PDonor -bnl:LexA hadde følgende funksjoner: (1)T2A-nls-LexA:p65 (~1.8kb) sekvens flankert av 2 kb og 1,8 kb homologi armene (stiplet linje), (2) en T2A selv cleaving peptid mellom gjenværende N terminal bnl ekson og NLS-LexA:p65, og (3) en oversettelse stopp codon (rød *) etter den nls-LexA:p65 sekvens. HDR produktet beholdt alle transcriptional og post-transcriptional kontroll av bnl,og Meglos: p65 protein forventes å bli produsert i samme mønster som endogene Bnl. liten svart pilene viser de relative bindende områdene (ikke i skalere) i PCR primere (tabell 1) brukes for 3-trinns screening eller RT PCR validering. (B) Agarose gel bilder viser resultatene av 3-trinns PCR screening. PCR produkter forsterket fra genomisk DNA av fire lykkes ender ut HDR linjer vises; negativ kontroll, genomisk DNA av nos-Cas9 foreldrenes linjen. positiv kontroll, pDonor -bnl:LexA plasmider; M, markør (SL2K DNA stiger). (C) et eksempel på screening gel viser forventet PCR produktet bruker primere M13F og rev3 for ender i linjer; M8-7 og M9-6 er to ender i linjer; negative og positive kontroller, som B; M, markør (NB 1 kb DNA stiger). (D) RT PCR analyse på totalt RNA Bnl-Meglos og kontrollen nos-Cas9 fluer. Fremover primer binder til et Meglos bestemt område, omvendt primer bindes til en nedstrøms bnl ekson regionen. ~ 440 bp (base-par) forsterkning band (*) ble oppdaget fra RT PCR på Bnl-Meglos mRNA, men ikke fra kontroll RNA. M, 100 bp markør (NEB). Tilpasset fra tall 2 og S1 i Du et al. 20175. Klikk her for å se en større versjon av dette tallet.

Figure 6
Figur 6: Validering av vev-spesifikke og betinget Bnl-Meglos uttrykk i ulike vev. (A-D) bnl uttrykk (rød) i ulike larver vev, med btl uttrykke celler vises i grønt. (EN, ") Vingen plate bnl kilde foran den voksende air sac primordium (ASP). (B, C) BNL uttrykk i TR5 tverrgående forbinde (TC) (B) og TR2 dorsal gren (DB) (C). (D) bnl uttrykk i genital plater. (E-J) Dynamisk bnl uttrykk (rød) under embryonale tracheal gren (grønn) mønstre; Små pilene, fem bnl kilder rundt det tracheal placode på SS10. Genotyper: A-J; btl-Gal4, UAS- CD8GFP / +; BNL-Meglos, LexO- CherryCAAX /+. (K-L ") Hypoksi-indusert Bnl-Meglos uttrykk profil i fløyen plater og tilknyttede TR2 tracheal metamere (TC, DB, dorsal trunk-DT). Genotype: Bnl-Meglos, LexO -CherryCAAX / +. (K) kontroll plater fra ex vivo kultivert organer uten CoCl2. (L L") fløyen plater (L, L') og luftrør (DT, (L'')) fra kulturperler ex vivo organer med CoCl2 indusert hypoksi. Star, ektopisk uttrykk av hypoksi. Skalere barer = 30 µm; 50 µm (K-L"). Tilpasset fra Figur 3 i Du et al. 20175. Klikk her for å se en større versjon av dette tallet.

A. gRNA Klon og sekvensering
BNL-Meglos gRNA fwd TATATAGGAAAGATATCCGGGTGAACTTCg TGTATCTGCGAT
GCCCCTCAGTTTTAGAGCTAGAAATAGCAAG
BNL-Meglos gRNA rev ATTTTAACTTGCTATTTCTAGCTCTAAAAC TCCCGCAATATCTGAAGG
VEDcGACGTTAAATTGAAAATAGGTC
T3 primer brukes for sekvensering CAATTA ACCCTCACTAAAGG-3 "
Merk: nukleotider understreket anneal U6 arrangøren eller gRNA kjernen på pCFD4 vektor, små g/c ble lagt til hjelpe U6 promoter-avhengige transkripsjon
B. HDR donor konstruksjon
BNL N-F_pUC19 AATTCGAGCTCGGTACtgtggtctttgaggctggaac
BNL-Meglos-N-R tCCGcaagtCagtAGgctgccgcgtccttcgccggaGCC CGCAGATACAAGGCCC
C
Meglos-F CTactGacttgCGGaGAtGTcGAaGAGAACCCtGGCCCt ATGCCACCCAA
GAAGAAGC
Meglos-R CTAAACGAGTTTTTAAGCAAACTCACTC
BNL Meglos-C Fwd TAAAAACTCGTTTAGACGGGATGGCGTTGTCAAC
BNL C-R_pUC19 GCCAAGCTTGCATGCCtcgcataattgccgcctgg
Merk: nukleotider i hovedstaden overlapping med pUC19 vektor for Gibson montering, nukleotider understreket var sekvens henging for T2A peptid tillegg.
C. HDR screening og sekvensering
BNL-Meglos scr fwd1 GTGGCGCACGCCCAATAAAC
BNL-Meglos scr rev1 GATCCCAGCCAATCTCCGTTG
BNL-Meglos scr fwd2 CAACGGAGATTGGCTGGGATC
BNL-Meglos scr rev2 CTGGCCAACTGTAGGGAAGTC
ender i sjekk rev3 GCAATGTTATGCAATGCGTTGAC
BNL-Meglos seq fwd3 CACTTGTCGCCCATATTGATACAATTG
Merk: Disse veiledningene ble brukt for PCR screening og sekvensering, omtrentlig plassering av primer bindende områder er vist i figur 5A som fwd1-2 og rev1-3.
D. RT PCR analyse
RT-f GATATGGATTTCTCCGCTTTGCTG
RT-r CCATGCAGAGATACAGGCAAGTG

Tabell 1: primere brukt i denne studien. (A) primere for Klon gRNA uttrykk vektor og sekvenser. (B) primere for Klon HDR donor mal. (C) primere for screening og sekvensering av HDR produktene. (D) primere brukt for RT PCR bekreftelse av chimeric Meglos-bnl mRNA produktet.

genotype HDR overføring rate % (# HDR gir G0 / # fruktbare G0) # HDR-positiv F1 / # totale F1 sjekket (%) # "ender-out" HDR / # totale HDR (%)
BNL-Meglos 56 (15/27) 23 (60/259) 73 (46/60)

Tabell 2: effektiviteten av CRISPR/Cas9-mediert HDR. Overføringshastigheten HDR beregnes som antall HDR gir G0 / # av totale fruktbare G0. Vellykkede HDR % beregnes som antall HDR-positiv F1/antall totale F1 vist. "Ender ut" % beregnes som antall "ender ut" HDR/antall totale positiv HDR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Tradisjonelt ble Drosophila enhancer feller generert av to ulike metoder. En av måtene inkluderer tilfeldige innsetting av en driver (f.eks., Gal4) rekkefølgen genomet av transponering (f.eks., P-element transponering)1 . Alternativt kan driveren sekvensene plasseres under transcriptional kontroll av antatte enhancer/arrangøren regionen i en plasmider konstruksjonen som vil deretter bli integrert i en ektopisk nettsted genomet3,11. Selv om disse metodene har generert en stor pool av Gal4 eller Meglos enhancer feller for Drosophila, har de flere begrensninger. P-element-mediert tilfeldige innsetting i genomet kan forstyrre regulerende aktiviteten til kritisk cis-regulatoriske sekvenser. På grunn av tilfeldig transposisjon i genomet, kan transactivator uttrykk rapportere mønstre av flere nærliggende gener. På den annen side, er forkunnskaper i cis-regulatoriske sekvenser av et gen nødvendig for en enhancer-felle plasmider konstruksjon. Det er også en grense for lengden på en sekvens som kan bli klonet og testet i en plasmider konstruksjon. Isolere og kloning bare en delvis fragment av DNA i endogene genomisk forbindelse kan ikke reprodusere et komplett gen-spesifikke uttrykk mønstre. For eksempel gjengir linjen bnl-Gal4 (NP2211) ble generert av P-element innsetting av en enhancer felle Gal4 element like foran bnl genet, helt ikke gen-spesifikke uttrykk mønstre i fosteret5 . Derfor under slike sammenhenger, gjenbruk teknikker, som banalisere (homologi assistert CRISPR banke-in), kanskje som kan konvertere den eksisterende Gal4 linjer i en annen Meglos eller Q-systemer basert driver linje12 ikke veldig nyttig. For å overvinne disse begrensningene, her beskrev vi en effektiv og alternativ metode for å generere binære uttrykk systemer av genomet redigering. I denne metoden er den første koding ekson med et byttet med transactivator (f.eks., Meglos eller Gal4) rekkefølge slik at uttrykk for transkripsjon driveren utelukkende etterligner spatiotemporal mønstre av av genuttrykk. Selv om strategi og protokoller beskrevet her var optimalisert for bnluttrykk, kan lett metoden brukes for andre gener.

Avgjøre en innsetting området regionen målrettet genet er det viktigste trinnet i denne eksperimentelle strategien. Metoden vi presentert var laget for å beholde alle original transcriptional og post-transcriptional regelverket bnl gen5. Derfor planlagt vi å fjerne mesteparten av den første koding ekson av bnl genet og erstatte den med Meglos kassetten. Utskifting var planlagt på en slik måte at det redigerte allelet uttrykker en hybrid Meglos-bnl mRNA fra endogene transkripsjon og oversettelse starte område av bnl samtidig beholde alle intronic regioner. Imidlertid hybrid mRNA ble utviklet å produsere bare Meglos protein, men ikke Bnl. Vi viste at strategien hadde ble generert en Bnl-Meglos /LexO-basert transkripsjon system og at systemet kan nøyaktig rapport dynamisk, spatiotemporal bnl uttrykk mønstre (figur 5)5 . En begrensning av denne prosessen er homozygous lethality i Drosophila linjene hvis målrettet genet er avgjørende for overlevelse. Videre kan bruk av en dobbel gRNA strategi øke sjansen for off-målet redigering. En alternativ strategi kan brukes til å unngå disse problemene. I denne strategien, kan kassetteninn Meglos eller Gal4 plasseres rett på ATG startwebstedet erstattet genet og en T2A selv cleaving peptid sekvens kan plasseres mellom Meglos/Gal4 kassetten og starten på den intakte koding ekson av målet genet. Denne strategien er ventet å produsere en chimeric mRNA som kan oversettes til både transctivator og funksjonelle gene produktet. En slik utforming kan muligens redusere sjansen for homozygous dødelighet. I denne strategien er en enkelt gRNA tilstrekkelig for genomet redigering. Men i nærvær av to kopier av funksjonelle gener, uttrykk for varianter av transgene protein drevet av Gal4/Meglos driveren (f.eks., Bnl-Meglos drevet uttrykk for LexO- Bnl: GFP fusjoner eller Bnl proteiner med slettinger) gir informasjon om funksjonaliteten til variant proteiner.

En begrensning av genomet-redigering strategien er møysommelige prosessen av målretting og redigering av ett gen samtidig. Men har enkelhet og effektivitet av CRISPR/Cas9-mediert genomet redigering metoden revolusjonert den målrettede genomisk knock-i/knock-out og teknologi for erstatning som kan lett bli vedtatt i alle standard laboratorium satt opp. I de siste årene, har Drosophila forskere utviklet praktisk verktøy for redigering av genomet som kan brukes til å utvide den genetiske verktøysett avgjørende for å forstå grunnleggende biologiske prosesser7,13 . Genomet redigering og screening prosessene som er beskrevet her er relativt raskere og tar omtrent to måneder i forhold til alle andre homologe rekombinasjon-baserte erstatning. Vellykket og effektiv genomet-redigering resultater, er det viktig å følge flere teknisk avgjørende skritt: 1) hver gRNA velges av maksimal stringens og aktivitet uten potensielle off-målet; 2) HDR donor inneholder ~1.5 kb homologi armene flankert gRNA rettet mot områder. Lengre homologi armene (1,8-2 kb) brukes til å øke effektiviteten i HDR når et stort eksogene DNA fragment må settes; 3) HDR donor er utformet for å være fri for webområdene gRNA anerkjennelse å unngå retargeting av gRNA til ingeniør locus; og 4) en idiotsikker forseggjort plan og koordinering av tidspunktet av genetisk kors med 3-trinns PCR-basert screening Velg en "ender ut" HDR.

I motsetning til tilfeldige transponering eller klonet enhancer konstruksjoner, strategi og protokoller vi beskrevet her sikrer generasjon en utelukkende måldatamaskinen gen-spesifikke binære transkripsjon systemet. Siden uttrykket av driveren erstatter en innfødt genet ekson, gen-spesifikke uttrykk for driveren er også allsidig og ventes å etterligne genet uttrykk mønstre under alle utviklingsmessige, metabolske og fysiologiske forhold5. Gene/celle-spesifikke uttrykk er mest attraktive kriteriene for alle binære driveren linjene når de brukes i ulike celle og utviklingsbiologi metoder. For eksempel muliggjør gen-spesifikke uttrykk for reporter gener av en transkripsjon driver pålitelig avstamning analyser av celler som uttrykker målet genet. Det gjør også live bildebehandling og sporing av spatiotemporal uttrykk, overføringen og omorganisering av celler under utvikling. For å undersøke mobilnettet og molekylære hendelsene under vev morphogenesis, Gal4 eller Meglos drevet overuttrykte/misexpression av er forskjellige effekter av transgener og RNAi-mediert genet sammenleggbare i bestemte sett med celler avgjørende. Svært spesifikke målrettet uttrykk systemet gir en upartisk analyser og tolkning av resultatene. CRISPR/Cas9-baserte målretting av en genet ekson og utskifting en transactivator sekvens gir derfor et bedre alternativ for å generere svært spesifikke målrettet gene expression systemer.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingen konflikter av interesse å avsløre.

Acknowledgments

Vi takker Dr. F. Port, Dr. K. O'Connor-Giles og Dr. S. Feng for diskusjoner om CRISPR strategi; Dr. T.B. Kornberg og Bloomington lager Center for reagenser; UMD tenkelig kjernen fasilitet; og finansiering fra NIH: R00HL114867 og R35GM124878 til SR

Materials

Name Company Catalog Number Comments
X-Gal/IPTG Gentrox (Genesee Scientific) 18-218 cloning
LB-Agar BD Difco BD 244520 cloning
Tris-HCl Sigma Aldrich T3253 Molecular Biology
EDTA Sigma Aldrich E1161 Molecular Biology
NaCl Sigma Aldrich S7653 Molecular Biology
UltraPure DNase/RNase-Free Water ThermoFisher Scientific 10977-023 Molecular Biology
10% SDS Sigma Aldrich 71736 Molecular Biology
KOAc Fisher-Scientific P1190 Molecular Biology
EtOH Fisher-Scientific 04-355-451 Molecular Biology
GeneJET Miniprep ThermoFisher Scientific K0503 Miniprep
PureLink HiPure Plasmid Maxipep kits ThermoFisher Scientific K210006 Maxiprep
BbsI NEB R0539S Restriction enzyme
Primers IDT-DNA PCR
pCFD4 Kornberg Lab DNA template and vector for gRNA
KAPA HiFi Hot Start- (Kapa Biosystems) Kapa biosystems KK2601 PCR
Q5-high fidelity Taq NEB NEB #M0491 PCR
Gibson Assembly Master Mix NEB NEB #E2611 DNA assembly
pBPnlsLexA:p65Uw Addgene DNA template for LexA amplification
Proteinase K ThermoFisher Scientific 25530049 Molecular Biology
2x PCR PreMix, with dye (red) Sydlab MB067-EQ2R Molecular Biology
Gel elution kit Zymo Research (Genesee Scientific) 11-300 Molecular Biology
TRI reagent Sigma-Aldrich Molecular Biology
Direct-zol RNA purification kits Zymo Research (Genesee Scientific) 11-330 Molecular Biology
OneTaq One-Step RT-PCR Kit NEB E5315S Molecular Biology
lexO-CherryCAAX Kornberg Lab Fly line
UAS-CD8:GFP Kornberg lab Fly line
btl-Gal4 Kornberg lab Fly line
MKRS/TB6B Kornberg lab Fly line
Confocal Microscope SP5X Leica Imaging expression pattern
CO2 station Genesee Scientific 59-122WCU fly pushing
Stereo microscope Olympus SZ-61 fly pushing
Microtube homogenizing pestles Fisher-Scientific 03-421-217 genomic DNA isolation
NanoDrop spectrophotometer ThermoFisher Scientific ND-1000 DNA quantification

DOWNLOAD MATERIALS LIST

References

  1. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, (2), 401-415 (1993).
  2. Lai, S. -L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nature Neuroscience. 9, (5), 703-709 (2006).
  3. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141, (3), 536-548 (2010).
  4. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  5. Du, L., Zhou, A., Patel, A., Rao, M., Anderson, K., Roy, S. Generation of a targeted expression system for branchless and characterization of novel cellular expression patterns of the gene in Drosophila. Developmental Biology. 427, (1), 35-48 (2017).
  6. Port, F., Chen, H. -M., Lee, T., Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 111, (29), E2967-E2976 (2014).
  7. Gratz, S. J., Rubinstein, C. D., Harrison, M. M., Wildonger, J., O'Connor-Giles, K. M. CRISPR-Cas9 Genome Editing in Drosophila. Current Protocols in Molecular Biology. 111, (1), 31.2.1-20 (2015).
  8. Doench, J. G., Hartenian, E., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  9. Port, F., Bullock, S. L. Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nature Methods. 13, (10), 852-854 (2016).
  10. Beumer, K. J., Trautman, J. K., Mukherjee, K., Carroll, D. Donor DNA Utilization During Gene Targeting with Zinc-Finger Nucleases. G3. 3, (4), Bethesda, Md. 657-664 (2013).
  11. Pfeiffer, B. D., Ngo, T. -T. B., et al. Refinement of tools for targeted gene expression in Drosophila. Genetics. 186, (2), 735-755 (2010).
  12. Lin, C. -C., Potter, C. J. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 203, (4), 1613-1628 (2016).
  13. Li, W., Köster, J., et al. Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. Genome Biology. 16, (1), 281 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics