En effektiv strategi för att generera vävnadsspecifika binära transkription system i Drosophila genom gen editering

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Här presenterar vi en metod för att generera vävnadsspecifika binära transkription system i Drosophila genom att ersätta den första kodning exon gener med transkription drivrutiner. Metoden CRISPR/Cas9-baserade förlägger en transactivator sekvens under endogena regleringen av en ersatte gen, och följaktligen underlättar transctivator uttrycket uteslutande i gen-specifika spatiotemporal mönster.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Du, L., Zhou, A., Sohr, A., Roy, S. An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing. J. Vis. Exp. (139), e58268, doi:10.3791/58268 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Binärt transkription system är kraftfulla genetiska verktyg som ofta används för att visualisera och manipulera cell öde och gen uttryck i specifika grupper av celler eller vävnader i modellorganismer. Dessa system innehåller två komponenter som separata transgena linjerna. En drivrutin linje uttrycker en transkriptionell aktivator under kontroll av vävnadsspecifika initiativtagare/smakförstärkare och en reporter/effektor linjen hamnar en målgenen placeras nedströms till bindningsstället för transkription aktivator. Djur som härbärgerat båda komponenterna inducera vävnadsspecifika transkription av en target genuttryck. Exakt spatiotemporal uttryck av genen i riktade vävnader är kritisk för förutsättningslös tolkning av cell/gen aktivitet. Därför är det viktigt att utveckla en metod för radgenerering exklusiva cell/vävnad-specifik drivrutin. Här presenterar vi en metod för att generera mycket vävnadsspecifika riktade uttryck systemet genom att anställa en ”klustrade regelbundet Interspaced kort Palindromic Repeat/CRISPR-associerade” (CRISPR/Cas)-baserat genomet redigering teknik. I denna metod guida den Amiiiiin Cas9 riktas av två chimära RNAs (gärna) till specifika platser i den första kodning exon av en gen i Drosophila genomet att skapa dubbel-strand raster (DSB). Därefter kan med en exogen givare plasmiden som innehåller sekvensen transactivator, cell-autonoma reparera maskinen homologi-regisserad reparation (HDR) av Tvistlösningsorganet, vilket resulterar i exakta borttagning och byte av exon med transactivator sekvens. De knackade-i transactivator uttrycks enbart i celler där cis-reglerande element av utbytta genen är funktionella. Detaljerade stegvisa protokollet presenteras här för att skapa en binär transkriptionell drivrutin uttryckt i Drosophila fgf/Grenlös-epitelial/neuronala celler kan antas för alla gen - eller vävnad-specifika uttryck.

Introduction

Genetiska verktygslådan för riktade genuttryck har utvecklats väl i Drosophila, gör den till en av de bästa modell att undersöka funktionen av gener involverade i en mängd olika cellulära processer. Binärt uttryck system, såsom jäst Gal4/UAS (uppströms aktiveringen sekvens), antogs först för vävnadsspecifika enhancer svällning och gene misexpression i Drosophila genetisk modell1 (figur 1). Detta system underlättat utvecklingen av ett stort antal tekniker såsom spatiotemporal reglering av genen överuttryck, misexpression, knockout i utvalda grupper av celler samt som i cell ablation, cell märkning, levande spårning av cellulära och molekylära processer i embryot och vävnader, lineage tracing och mosaik analyser under utveckling. Ett antal binära transkription systemet, såsom den bakteriella LexA/LexAop system (figur 1) och Neurospora Q-system, är kraftfulla genetiska verktyg som används nu allmänt i Drosophila, utöver det ursprungliga Gal4/UAS systemet för riktade gene expression1,2,3.

Här presenterar vi en metod för att generera mycket tillförlitlig vävnadsspecifika binärt uttryck systemet genom att anställa en editering teknik. De senaste framstegen inom CRISPR/Cas9 genomet redigering teknik gett helt nya möjligheter att göra riktade genomet ändringar i ett brett spektrum av organismer. Systemets CRISPR/Cas9 jämfört med andra tillgängliga genomet redigering tekniker, och är billig, effektiv och pålitlig. Denna teknik använder tredjeparts beståndsdelar i det bakteriella adaptiva immunsystemet: en Cas9 Amiiiiin Streptococcus pyogenes som skapar en dubbel-strand paus (DSB) och en chimär guide RNA (gärna), som vägleder Cas9 till en viss arvsmassa webbplats för riktade DSB4. Cellerna innehåller maskiner för att reparera DSB använder olika vägar. Icke-homolog slutet att gå (NHEJ) leder till små infogningar och borttagningar att störa geners funktion, medan homologi-regisserad reparation (HDR) introducerar en definierad regi/önskvärt genomisk knock-knock-utcheckning med hjälp av en exogen HDR-givare som en mall. HDR-baserat utbyte strategin kan effektivt utnyttjas för att generera en mycket tillförlitlig vävnadsspecifika binärt uttryck systemet, som kan övervinna alla begränsningar av traditionella enhancer fälla metoder. Vi beskriver ett stegvis förfarande för utnyttjande av CRISPR/Cas9-baserade HDR reparation i genererar en linje av binära transkription-drivrutin som uttrycks under kontroll av endogena transkriptionell och post-transcriptional reglering av en Drosophila gen. I detta protokoll, visar vi generationen av en drivrutin linje specifik för Grenlös (bnl) gen som kodar en SARAHS familj protein som reglerar förgrenade morfogenes av luftrör luftvägarna epitel5. I det här exemplet den första kodning exon av bnl genen ersattes av en sekvens av en bakteriell LexA transactivator sekvens utan att ändra några endogena cis-reglerande sekvenser av bnl genen. Vi visar att strategin genererat en bnl-LexA driver linje som spatiotemporally styr uttrycket av en reporter gen placeras nedströms LexAoperator (LexAop eller LexO) uteslutande i bnl- att uttrycka epitelial/mesenkymala/neuronala celler.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. designa och konstruera gärna uttryck vektor

  1. Att just ersätta en lång definierade region i ett exon, Använd en dubbla gärna tillvägagångssätt6, där varje gärna kan specifikt rikta två ändarna av den valda regionen av intresse. För att få ett korrekt gen-specifika spatiotemporal uttryck av drivrutinen, Välj två gärna mål platser inom den första kodning exon av genen.
  2. Drosophila melanogaster, välj gärna mål webbplatser som använder verktyget flyCRISPR optimala målet Finder (http://tools.flycrispr.molbio.wisc.edu/targetFinder/). Andra tillgängliga CRISPR designverktyg kan användas samt, inklusive optimerad CRISPR designverktyget (http://crispr.mit.edu), FlyCas9 (https://shigen.nig.ac.jp/fly/nigfly/cas9), och E-skarp (www.e-crisp.org/E-CRISP).
    Obs: Följande protokoll gärna design och kloning antogs från metoder tidigare beskrivna6,7.
    1. Kopiera den faktiska sekvensen i rutan i online-verktyget. Välj den mest nyligen släppt Drosophila melanogaster genomet annotation versionen, ”r_6”, i den nedrullningsbara menyn för ”Välj genomet”. I fältet ”Välj guide längd (nt)”, ingång ”20”. Välj om du vill hitta ”alla CRISPR mål” och klicka på ”hitta CRISPR mål”.
    2. Utvärdera alla mål i kandidat-gärna genom att ställa ”maximal” för ”stränghet” och ”NGG endast” för ”PAM”. Försök att välja de gärna platserna utan några potentiella off-mål eller ett minsta antal off-mål möjliga. Web-verktyget beskrivs i Doench et al. 2014 8 markerar gRNAs med en potentiell ”bra” aktivitet poäng.
    3. Samtidigt, se till att det finns ingen enda nukleotid polymorfism i gärna målen i genomet hos förälder linan valt injektionsvätska (T.ex. nos-Cas9 på X-kromosomen, BL # 54591). Följa protokollet beskrivs i Gratz et al. 20157 att extrahera genomisk DNA från överordnade linan. PCR förstärker, ca, 500 – 1000 nt regionerna med primers som flankerar sekvensen av intresse och en HiFi-DNA-polymeras; sekvens-kontrollera PCR amplifieras produkterna.
  3. För att generera en tandem gärna uttryck vektor, följa en ligatur-oberoende kloning protokoll6 att införa två protospacer sekvenser i en pCFD4 RNA uttryck vektor. Observera att en förbättrad multi-gärna uttryck vektor (pCFD5) är nu tillgänglig när båda sgRNAs uttrycks från stark U6:3 initiativtagare9 (https://www.crisprflydesign.org). Använd en DNA-församling för att klona gRNAs i den pCFD4 vektorn.
    1. Designa och Beställ framåt och bakåt primers för att införa två protospacer sekvenser i den RNA uttryck vektor pCFD4 (tabell 1A). Som tidigare beskrivits6innehåller forward primer sekvensen för första protospacer flankerad av regioner motsvarar U6-1 arrangören och gärna core i pCFD4; reverse primer innehåller omvänd komplement av de andra protospacer flankerad av regioner motsvarar gärna core och U6-3 arrangören i pCDF4.
    2. Återsuspendera grundfärger till 100 μM med DNAS och RNase-gratis dubbel destillerat vatten (ddH2O). Gör en 10 μM arbetande koncentration primer. Använda pCFD4 plasmid som mall och ställa in PCR-reaktion med en HiFi-polymeras och rekommenderade inställningar för PCR-reaktion6.
    3. För att klona förstärkt produkten in i pCFD4, smälta pCFD4 plasmid med BbsI enzym genom att ställa in följande reaktion: 2 – 5 μg av pCFD4 plasmid, 5 μL 10 x matsmältningen buffert, 1 μL BbsI enzym och ddH2O att få den slutliga volymen till 50 μL. Blanda reaktion innehållet genom att försiktigt knacka röret och samla alla utspridda droppar från väggen i röret till botten av en kort spin. Inkubera reaktion mixen vid 37 ° C i 2 h.
    4. Köra PCR-produkten från steg 2 och smält produkt från steg 3 på en 1% agarosgel. Utföra elektrofores tillräckligt med tid att helt separera banden DNA. Klipp ut rätt storlek DNA band under en UV trans-illuminator innan rening de förvänta produkter använder gel eluering kolumnen enligt tillverkarens anvisning (se Tabell för material). PCR-produkten ska vara 600 bp, och linearized pCFD4 plasmiden bör ~6.4 kb 6.
    5. Ställa in DNA församlingen reaktionen i en PCR-röret, per tillverkarens anvisningar (se Tabell för material).
    6. Omvandla 2 μL av produktens församlingen till behöriga bakterier (DH5α eller liknande stammar med ΔrecA1, ΔendA1), plattan på Ampicillin (100 μg/mL) som innehåller LB (LB/Amp) agarplattor och inkubera vid 37 ° C över natten. Observera att den DNA-församlingen blanda kan vara giftigt för vissa bakteriestammar, men späda församlingen mixen kan minska toxiciteten.
    7. Plocka 3 – 4 ampicillin-resistenta kolonier från övernattning ruvade plattan, Inokulera kolonin i 3 mL LB innehållande 100 μg/mL ampicillin och odla inokulerade bakterier i en shaker i 37 ° C under natten. Extrahera plasmid från övernattning-odlade bakterier med hjälp av plasmid mini prep kit följa tillverkarens instruktioner (se Tabell för material).
    8. Sekvens av plasmider med T3 universal primer till skärmen för de rätta kloner som innehåller tandem gärna insättningspunkten. Upprätta en glycerol lager av bakterier förvandlas med en sekvens-verifierade pCFD4-gärna i 20% glycerol och förvaras i-80 ° C för framtida bruk.

2. designa och konstruera den HDR-givaren

  1. För genomisk inpressning av en Gal4 eller LexA sekvens, design dubbelsträngat HDR givare som innehåller sekvensen transactivator flankerad av två homologi armar.
    1. Användning > 1,5 kb lämnade och högra homologi armar flankerande gärna inriktning byggplatsen. Utökade homologi armar öka effektiviteten i HDR under reparation processen 10.
    2. PCR förstärka homologi armarna från genomisk DNA (gDNA) utvinns från överordnade linan valt injektionsvätska (T.ex. nos-Cas9 (på X-kromosomen), BL # 54591). Använda en korrekturläsning hot-start Taq-DNA polymeras enzym passar långa PCR-förlängning (se Tabell för material). Sekvens-kontrollera.
  2. För att undvika retargeting av gärna till den bakåtkompilerade locus, design ersättare givaren på ett sådant sätt att de gärna erkännande webbplatserna störs av exogena sekvensen infördes.
    Obs: för att undvika att ändra de förmodade cis-reglerande element, alltid Välj de gärna erkännande platserna inom regionen kodande exon.
  3. För att skapa en byte-kassett, planera den DNA-församling strategin att gå samman och fyra segment: 5' och 3' homologi armarna, den mellersta exogena transactivator DNA-sekvensen och linearized kloning vektor ryggraden (t.ex. pUC19 eller andra vanligen används kloning vektorer). Efter tillverkarens riktlinje för DNA-församling (se tabell för material), utforma lämpliga primers för PCR-amplifiering och montering av varje segment. Återsuspendera grundfärger till 100 μM med ddH2O. gör en 10 μM arbetande koncentration primer. Använda HiFi-polymeras för alla PCR-reaktioner. Följ följande protokoll:
    1. PCR förstärka en Gal4 eller LexA uttryck kassett från en tillgänglig vektor (t.ex., nls-LexA:p65; de idealiska Gal4/LexA/QF2 uttryck plasmidsna kan hittas och erhållits från gemensamma resurser såsom Addgene) med den primers som anges i tabell 1B.
      1. Om du vill behålla alla original transkriptionell och post-transcriptional reglementet av de utbytta exon på uttrycket av transactivator DNA-sekvensen, design kassett på ett sådant sätt att den redigerade genomiska allelen skulle uttrycka en chimär mRNA av den transactivator och genen. Bevara 5' och 3' ände den riktade exon att behålla någon skarvning signal.
      2. Införliva en T2A själv proteinspjälkande peptid sekvens mellan återstående 5' kodning exon och transactivator sekvensen att förhindra översättning till en chimär protein. Lägg till en översättning stop kodon efter sekvensen exogena transactivator (figur 5).
    2. PCR förstärka homologi armarna från genomisk DNA (gDNA) utvinns från överordnade linan valt injektionsvätska (T.ex. nos-Cas9 (på X-kromosomen), BL # 54591) använda primers som anges i tabell 1B. Använda HiFi-polymeras för alla PCR reaktioner med systemen som följer: 5 μL av 5 x reaktion buffert, 0,5 μL 10 mM dNTP, 1,25 μL 10 μM fram Primer, 1,25 μL 10 μM Reverse Primer, 0,5 μL av mallen DNA, 0,25 μL av HiFi-DNA-polymeras , 16,25 μL av ddH2O.
    3. Använd linearized kloning vektor såsom pUC19. Det finns nu ett antal givare vektorer. Se en fullständig lista på den följande hemsida-http://flycrispr.molbio.wisc.edu.
    4. Kör de PCR-produkterna på en 1% agarosgel. Utföra elektrofores för tillräckligt med tid att säkerställa en tydlig separation av önskat band från oönskad ospecifika band (om någon). Gel-rena de förväntade DNA-fragment. Mätning av koncentrationen av varje renade DNA-fragment med en spektrofotometer.
    5. Ställa in DNA församlingen reaktionen följa tillverkarens instruktioner. Blanda linearized kloning vektor och målet fragment från steg 3 och steg 4 i följande reaktion: 1 μL av linjära kloning vektor (50 ng/μl), 2 – 3 fold överskott av varje mål fragment, 10 μL av 2 x DNA församlingen master mix, föra den slutliga reaktionsvolym 20 μL med ddH < C21 > 2O. Inkubera reaktion mixen i 1 timme vid 50 ° C.
    6. Omvandla 2 μL av produktens församlingen till behöriga bakterier, platta på LB/Amp agarplattor som innehåller 100 μg/mL ampicillin. Också lägga till X-Gal + IPTG på plattan för blå/vit screening.
    7. Plocka 3 – 4 vita kolonier från övernattning ruvade plattan, Inokulera kolonin i 3 mL LB innehållande 100 μg/mL ampicillin och växa vid 37 ° C över natten i en shaker. Extrakt plasmid från övernattning-odlade bakterier med hjälp av plasmid mini prep kit efter tillverkarens bruksanvisning (se Tabell för material).
    8. Skärmen positiva kolonin av PCR eller begränsning matsmältning.
    9. Sekvens kontrollera HDR givare regionen för slutliga Plasmiden. Spara en bakteriell lager omvandlas med rätt kloner i 20% glycerol vid-80 ° C för framtida inympningen.

3. embryot injektion, flyga genetik och Screening för editering

  1. Förbereda höga renhet endotoxinfria gärna uttryck vektor samt HDR givare plasmiden med hjälp av en plasmid maxiprep kit (se Tabell för material).
  2. Co injicera gärna uttryck plasmiden (100 ng/μl) och byte givare (500 ng/μl) i könsceller av nos-Cas9 embryon6. Obs: vi använder en kommersiell tjänst för injektion, men denna procedur kan utföras i laboratorium samt.
  3. Flyga genetik och screening (figur 2 och figur 3):
    1. När de injiceras embryona utvecklas till vuxna, kors varje enda G flyger0 till balancer flugor. Välj lämplig balansblock för kromosomen som innehåller den rikta allelen.
    2. Söva F1 avkommor från varje G0 kors på en CO2 pad och slumpmässigt välja 10-20 hanar under ett stereomikroskop. Korsa dem individuellt till balancer honorna som visas i figur 3.
    3. När F2 larver hatch, plocka den enda F1 far från varje cross och extrahera gDNA protokollet enda flyga genomisk DNA beredning:
      1. Förbereda gDNA utvinning buffert: 10 mM Tris-Cl pH 8,2, 1 mM EDTA, 25 mM NaCl, förvara i rumstemperatur. Förbereda 20 mg/mL stamlösning av proteinas K och förvara i frysen.
      2. Placera varje fluga i ett 1,5 mL mikro-centrifugrör och etiketten röret. Hålla i-80 ° C frysen över natten.
      3. Förbereda en färsk arbetar volym på gDNA utvinning buffert innehållande 200 µg/mL slutlig koncentration av proteinas K.
        Obs: Använd inte en gammal buffert för det här steget.
      4. Squish varje fluga för 10-15 s med en pipettspetsen innehållande 50 μL av mosa buffert utan dispensering vätskan. Fördela resterande bufferten till röret och blanda väl. Inkubera vid 37 ° C i 20 – 30 min.
      5. Placera rören i 95 ° C värme block för 1 – 2 min till inaktivera den proteinas K.
      6. Snurra ner för 5 min vid 10 000 x g. Lagra preparatet vid 4 ° C för ytterligare PCR-analys.
  4. Använd samma metod för att förbereda gDNA från en nos-Cas9 fluga, som fungerar som en negativ kontroll. Utföra tre steg PCR-baserade skärmar för att identifiera den rätta ”slutar på” HDR (figur 2, figur 5) med gDNA av varje F1 hane som en mall5. Använda 1 μL av DNA prep i följande PCR-reaktion system: 10 μL av 2 x PCR Master Mix med färgämne, 1 μL av varje grundfärg (10 μM), 1 μL av DNA-mall, och 7 μL ddH2O.
  5. Som visas i figur 5A, utföra PCR med primers fwd1 och rev1 till skärmen för förekomsten av infogningen eller ersättning; utföra PCR använder fwd2 och rev2 grundfärger för att verifiera isättning eller byte från 3'-regionen; utför PCR använder primers M13F och rev3 att kontrollera ”slutar-i” HDR (tabell 1 c).
  6. Hålla de flyga linjerna med bekräftade ändar ut HDR och upprätta balanserat bestånd från den F2-generationen. Ropen till balancer flugorna igen för att ta bort eventuella oönskade mutationer på andra kromosomer.
  7. Förbereda högkvalitativa gDNA från de etablerade bestånd för förstärkande lång PCR (> 800 – 1000 nt) amplikon med HiFi-Taq-polymeras och fullt sekvens verifierar den amplikoner som erhållits från de bakåtkompilerade genomiska regionerna. Alternativt använda rå gDNA extrakt som beskrivs tidigare för att förstärka kortare (< 800 nt), överlappande PCR-produkter sekvens-validera redigerade genomet. Använd följande protokoll för att förbereda bra kvalitet Drosophila genomisk DNA:
    1. Sätta om 25 vuxna flugor i ett 1,5 mL mikrocentrifug rör och frysa i-20 ° C eller -80 ° C frys i minst 1 timme.
    2. Tillsätt 250 μL av lösning A (pH 9,0 Tris HCl 0,1 M, EDTA 0,1 M, SDS 1%).
    3. Homogenisera flugor med de homogeniserande mortlar i mikrocentrifugrör, och lägga röret på is.
    4. Inkubera vid 70 ° C i 30 min.
    5. Tillsätt 35 μl av KOAc (5 M), skaka och blanda väl, men gör inte vortex.
    6. Inkubera i isen i 30 min.
    7. Snurra på 12 000 x g i 15 min.
    8. Med en 1 mL mikropipett, noggrant överföra endast klara supernatanten till en ny tub, lämnar tillbaka eventuell fällning eller interphasen.
    9. Tillsätt 150 μL isopropanol supernatanten. Försiktigt blanda genom inversion.
    10. Snurra på 10 000 x g i 5 min.
    11. Försiktigt avlägsna supernatanten och lämna pelleten i röret.
    12. Tvätta pelleten med 1 mL 70% EtOH.
    13. Snurra på 12 000 x g i 5 min.
    14. Ta bort supernatanten. Luften torr pelleten i 15 till 20 min. Torka inte över pelleten.
    15. Lös pelleten i 100 μL av ddH2O.
    16. Använda HiFi DNA-polymeras som är lämplig för lång amplikon (> 800 bp) att förstärka regionen komplett redigerade. Helst ta två primers utanför insatt kassett att förstärka genomisk regionen. Gel rena PCR-produkten, och som tidigare beskrivits, sekvens verifierar produkten med flera överlappande primers.
  8. Verifiera de rätta spatiotemporal uttrycksmönster från dissekerade vävnader och embryon av de konstruerade fluglinor:
    1. Utföra RT-PCR från den total-RNA att kontrollera uttrycket produktens hybrid mRNA (tabell 1 d).
    2. Utföra en i situ -hybridisering av mRNA produkten av intresset för larval vävnader/embryot att validera uttrycket.
    3. Att skärmen för de korrekta vävnadsspecifika spatiotemporal uttryck mönsterna bland sekvens-verifierade ändar ut raderna, korsa redigerade rader erhålls för binärt uttryck föraren med LexO- GFP eller LexO- RFP (för LexA drivrutin) linje (tillgängligt från Bloomington lager centers) och observera den LexA eller Gal4 driven reporter-genuttryck i embryot, larver och vuxna vävnader i fluorescens Mikroskop.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Detta protokoll har framgångsrikt använts för att generera en riktade binärt uttryck reporter systemet specifikt för bnl uttrycker cellerna5. Cis-reglerande element (CREs) som styr komplexa spatiotemporal bnl uttryck kännetecknas inte. Därför, för att uppnå spatiotemporal uttryck under kontroll av endogena bnl reglerande sekvensen, endast den första kodning exon av bnl utformades för att ersättas med sekvens av den bakteriella LexA transactivator. En förbättrad nls-LexA::p65 kassett känd för att ge optimal uttryck i Drosophila valdes.

Ersättning strategin syftar till att generera en chimär nls-LexA:p65-bnl mRNA under endogena transkriptionell och post-transcriptional kontroll. Denna chimär mRNA innehöll en intakt bnl 5' UTR, en del av slutet 5' och 3' ände den redigerade bnl kodning exon (första exon), samt komplett nedströms bnl introner och exoner. För att bevara den bnl RNA-specifika skarvning av de utbytta exon, behölls liten 5' och 3' ände den ersatt kodning exon. Dock att förhindra syntesen av en chimär Bnl protein smält till nls -LexA: p65, en T2A själv proteinspjälkande peptid sekvens inkorporerades mellan de resterande 5' bnl som du kodande regionen och ATG av nls-LexA:p65. Också, en översättning stop kodon lades efter den nls-LexA:p65 sekvens för att undvika samtidig översättning av en stympad Bnl protein5 (figur 4 och figur 5A).

En ersättare givare som innehåller alla dessa funktioner användes, som hade den T2A-nls-LexA:p65 sekvens och 2 kb 5'- och 1.8 kb 3' - homologi armar. Långa homologi vapen användes för effektiv HDR och införandet av en stor DNA-fragment på platsen för reparation (T2A-nls-LexA:p65 är 1,8 kb) (figur 5A).

Två gRNAs används för att skapa DSBs vid definierade positioner ta bort de flesta av de första kodning exon av bnl. Två gRNAs som matchade alla kriterier som beskrivs i avsnitt 1.3 (PAM sekvens understruken) var:
gRNA1: TGTATCTGCGATGCCCCTCATGG
gRNA2: ATCCTTCAGATATTGCGGGATGG

Båda gärna erkännande platser besväras i utbyte givaren av den exogena T2A-nls-LexA:p65 sekvens, vilket är det enklaste sättet att undvika retargeting av gRNAs att de bakåtkompilerade locus. Störd gärna erkännande sekvenser hos byte givare (de exogena sekvenser som stört gärna erkännande platser i kursiv stil) var:
gRNA1: TGTATCTGCG -GGCTCCGGCGAAGGAC...
gRNA2:... AAAAACTCGTTTAGA- CGGGATGG

PCFD4 gärna uttryck vektorn som innehåller dessa gRNAs, tillsammans med utbyte givaren, var samtidig injiceras in i könsceller av nos-Cas9 embryon. Därefter i protokollet som beskrivs här följdes till skärmen för avsedd ersättning (figur 5B, C). Ca 67% av injicerad G0 djur var bördiga. 56% av den bördiga G0s var grundarna, som gav upphov till HDR-positiv avkomma. Cirka 23% var positiva för framgångsrika HDR bland F1 avkomman kontrolleras, och var 73% av positiva HDR ”ändarna-out” (tabell 2). Sedan den första kodning exon av bnl ”slogs ut”, alla HDR rader konstaterades vara homozygot dödliga, och bestånden kvarstod över Balanserare.

Generering av en chimär LexA-bnl mRNA i cellerna validerades av RT-PCR-analyser (figur 5 d). Att kontrollera om den erhållna bnl-LexA linjer var uttryckt i det endogena bnl uttrycket pattern, varje ”ändarna-out” HDR linjen korsades LexO-mCherryCAAX transgena flugor5, och det reporter uttryck pattern undersöktes i den avkomman embryon och yngel. 42 av 46 linjer visade korrekt spatiotemporal uttryck överensstämmer med tidigare rapporterade bnl mönster5 (figur 6). Fyra rader visade antingen svaga eller icke-specifika uttrycksmönster. Vi förutspår att dessa rader kanske har ackumulerat mutationer, som vi måste kontrollera med noggrann sekvensering analyser. Ihop bekräftat dessa resultat att strategin HDR-medierad exon ersättare framgångsrikt kunde användas för att generera en riktade binärt uttryck systemet för en gen. Verktyget kan framgångsrikt användas till express reporter eller ektopisk gener i genen bnl spatiotemporal konsumtionsmönster.

Figure 1
Figur 1: systemet av ett binärt transkription system för riktade genuttryck. En transactivator (GAL4 eller LexA), uttryckt under kontroll av cis-reglerande element (CREs) av en gen, driver en effektor transgenens placeras nedströms de specifika transkription bindningsställen (UAS för Gal4 (eller LexAop för LexA). Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: en översikt över arbetsflöden för CRISPR/Cas9-medierad genomet redigering för att generera ett binärt transkription system. Den ungefärliga tid som krävs för varje steg är indicerat. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: en illustration av CRISPR screening och genetiska gränsöverskridande system för fastställande av genomet-redigeras fluglinor. I genetisk kors står R för den redigerade allelen som är på 3rd kromosomen. MKRS (Tp (3; 3) MRS, M (3) 76A [1] kar [1] ry [2] Sb [1]), är en 3rd kromosom-markör; TM6B (I (3LR) TM6B, Antp [Hu] e [1] Tb[1]) är en 3rd kromosom balancer. Genomet redigeras flyga bestånd verifieras genom PCR förstärkande Regionkommittén target sevärdheter från genomisk DNA extraheras från F2 eller F3 generation flugor och sekvensen bestämning av PCR-produkter. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: generationen av ersättare kassett av DNA-församling. En schematisk ritning föreställande PCR-amplifiering och montering av olika PCR-produkter (a, b och c) i den givaren vektor (d) använda en metod för DNA-församling. Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5: Generering av bnl-LexA genom CRISPR/Cas9-medierad exon ersätter. (A) Schematisk ritning föreställande strategin av den CRISPR/Cas9 medierad HDR för exon ersättning i det bnl locus. Box - exon; linje-intron; byte givare (pDonor -bnl:LexA) och två möjliga utfall av HDR visades. Den pDonor -bnl:LexA hade följande funktioner: (1)T2A-nls-LexA:p65 (~1.8kb) sekvens flankerad av 2 kb och 1.8 kb länge homologi armar (streckade linjer), (2) en T2A själv proteinspjälkande peptid mellan de kvarvarande N terminal bnl exon och NLS-LexA:p65, och (3) en översättning stop kodon (röd *) efter den nls-LexA:p65 sekvens. HDR produkten behöll alla transkriptionell och post-transcriptional kontroll av bnl,och LexA: p65 protein förväntas produceras i samma mönster som endogena Bnl. små svarta pilarna visar de relativa bindningsställen (inte i skala) av PCR primers (tabell 1) används för 3-steg screening eller RT-PCR validering. (B) agarosgel bilder visar resultaten av 3-steg PCR-screening. PCR-produkter som amplifierats genomisk DNA från fyra framgångsrika ändar ut HDR rader visas; negativ kontroll, genomisk DNA av nos-Cas9 faderlig linje; positiv kontroll, pDonor -bnl:LexA plasmid; M, markör (SL2K DNA stege). (C) ett exempel på screening gelen visar beräknade PCR produkten använda primers M13F och rev3 för slutar-i linjer; M8-7 och M9-6 är två ändar-i linjer. negativa och positiva kontroller, samma som i B; M, markör (NEB 1 kb DNA stege). (D) RT-PCR-analys på total-RNA från bnl-LexA och nos-Cas9 kontroll flyger. Framåt primer binder till en specifik region LexA , reverse primer binder till en nedströms bnl exon region. ~ 440 bp (base-par) förstärkning band (*) upptäcktes från RT-PCR på bnl-LexA mRNA, men inte från kontrollen RNA. M, 100 bp markör (NEB). Anpassad från figurerna 2 och S1 i Du et al. 20175. Klicka här för att se en större version av denna siffra.

Figure 6
Figur 6: Validering av vävnadsspecifika och villkorliga bnl-LexA uttryck i olika vävnader. (A-D) bnl uttryck (röd) i olika larver vävnader, med den btl uttrycker cellerna visas i grönt. (A, A') Wing skivkälla bnl inför den växande air sac primordium (ASP). (B, C) BNL uttryck i TR5 tvärgående connective (TC) (B) och TR2 dorsal gren (DB) (C). (D) bnl uttryck i genitala skivor. (E-J) Dynamiska bnl uttryck (röda) under embryonala luftrör gren (green) mönster; Små pilar, fem bnl källor kring de luftrör placode skede 10. Genotyper: A-J; btl-Gal4, UAS- CD8GFP / +; bnl-LexA, LexO- CherryCAAX /+. (K-L ”) Hypoxiinducerad bnl-LexA uttryck profil i flygeln skivor och tillhörande TR2 trakeal metamere (TC, DB, dorsala trunk-DT). Genotyp: bnl-LexA, LexO -CherryCAAX / +. (K) kontroll skivor från ex vivo odlade organ utan CoCl2. (L-L') wing skivor (L, L') och luftstrupen (DT, (L'')) från odlade ex vivo organ med CoCl2 inducerad hypoxi. Stjärna, ektopisk uttryck som induceras av hypoxi. Skala barer = 30 µm; 50 µm (K-L ”). Anpassad från figur 3 i Du et al. 20175. Klicka här för att se en större version av denna siffra.

A. gärna kloning och sekvensering
BNL-lexA gärna fwd TATATAGGAAAGATATCCGGGTGAACTTCg TGTATCTGCGAT
GCCCCTCAGTTTTAGAGCTAGAAATAGCAAG
BNL-lexA gärna rev ATTTTAACTTGCTATTTCTAGCTCTAAAAC TCCCGCAATATCTGAAGG
cGACGTTAAATTGAAAATAGGTC
T3 primer används för sekvensering CAATTA ACCCTCACTAAAGG-3'
Obs: nukleotider underströk glödga U6 arrangören eller gärna core på pCFD4 vector, gement g/c lades till stöd U6 arrangören-beroende transkription
B. HDR givare konstruktion
BNL N-F_pUC19 AATTCGAGCTCGGTACtgtggtctttgaggctggaac
BNL-lexA-N-R tCCGcaagtCagtAGgctgccgcgtccttcgccggaGCC CGCAGATACAAGGCCC
C
lexA-F CTactGacttgCGGaGAtGTcGAaGAGAACCCtGGCCCt ATGCCACCCAA
GAAGAAGC
lexA-R CTAAACGAGTTTTTAAGCAAACTCACTC
BNL lexA-C Fwd TAAAAACTCGTTTAGACGGGATGGCGTTGTCAAC
BNL C-R_pUC19 GCCAAGCTTGCATGCCtcgcataattgccgcctgg
Obs: nukleotider i kapital överlappning med pUC19 vektor för Gibson församling, nukleotider underströk var sekvens överhäng för T2A peptid tillägg.
C. HDR screening och sekvensering
BNL-lexA scr fwd1 GTGGCGCACGCCCAATAAAC
BNL-lexA scr rev1 GATCCCAGCCAATCTCCGTTG
BNL-lexA scr fwd2 CAACGGAGATTGGCTGGGATC
BNL-lexA scr rev2 CTGGCCAACTGTAGGGAAGTC
slutar-i Kontrollera rev3 GCAATGTTATGCAATGCGTTGAC
BNL-lexA seq fwd3 CACTTGTCGCCCATATTGATACAATTG
Obs: Användes dessa primers för PCR screening och sekvensering, de ungefärliga platserna av primer bindande platser visas i figur 5A som fwd1-2 och rev1-3.
D. RT-PCR-analys
RT-f GATATGGATTTCTCCGCTTTGCTG
RT-r CCATGCAGAGATACAGGCAAGTG

Tabell 1: Primers används i denna studie. (A) Primers för kloning gärna uttryck vektor och sekvensering. (B) Primers för kloning HDR givare mall. (C) Primers för screening och sekvensering av HDR produkter. (D) Primers används för RT-PCR-kontroll av chimära LexA-bnl mRNA produkten.

genotyp HDR transmission rate % (# HDR-framställning G0 / # bördiga G0) # HDR-positiv F1 / # totala F1 kontrolleras (%) # ”ändarna-out” HDR / # totala HDR (%)
BNL-LexA 56 (15/27) 23 (60/259) 73 (46/60)

Tabell 2: effektiviteten av CRISPR/Cas9-medierad HDR. HDR överföringshastighet beräknas som # av HDR-framställning G0 / # av totala bördiga G0. Framgångsrika HDR % beräknas som # av HDR-positiv F1 / # av totala F1 screenas. ”Ändarna-out” % beräknas som # av ”ändarna-out” HDR / # av totala positiva HDR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Traditionellt, genererades Drosophila enhancer fällor av två olika metoder. Ett sätt omfattar slumpmässig införande av en drivrutin (t.ex., Gal4) sekvens i genomet av införlivande (t.ex., P-elementet införlivande)1 . Alternativt kan föraren sekvenser placeras under transkriptionell kontroll av en förmodad förstärkare/arrangören region i en plasmid konstruktion, som sedan skulle integreras i en ektopisk webbplats av genomet3,11. Även om dessa metoder har genererat en stor pool av Gal4 eller LexA enhancer fällor för Drosophila, har de flera begränsningar. P-elementet-medierad slumpmässiga införandet i genomet kan störa rättsliga aktiviteten av kritiska cis-reglerande sekvenser. På grund av slumpmässiga införlivandet i genomet, kan transactivator uttryck rapportera mönster av flera intilliggande gener. Däremot, är en tidigare kunskap om cis-reglerande sekvenser av en gen nödvändigt för en förstärkare-fällan plasmid konstruktion. Det finns också en gräns för längden på en sekvens som kan klonas och testas i en plasmid-konstruktion. Isolera och kloning endast en partiell fragment av DNA ur det endogena genomisk sammanhanget kan inte återge en komplett gen-specifika uttrycksmönster. Exempelvis reproducera raden bnl-Gal4 (NP2211), som genererades genom P-elementet en enhancer-trap Gal4 elementet strax före genen bnl , helt inte gen-specifika uttrycksmönster i embryot5 . Under sådana sammanhang, de återanvända teknikerna, såsom HACK (homologi assisterad CRISPR inpressning), kan som kan konvertera det befintliga Gal4 linjer i en annan LexA eller Q-system baserat föraren linje12 inte därför mycket användbara. För att övervinna dessa begränsningar, beskrev vi här, en effektiv och alternativa metod för att generera binära uttryck system av gen editering. Den här metoden är den första kodning exon av en gen bytte med transactivator (t.ex., LexA eller Gal4) sekvens så att uttrycket av transkription föraren uteslutande härmar spatiotemporal mönster av genuttrycket. Även om strategin och protokoll som beskrivs här var optimerad för bnl -uttryck, kan metoden enkelt antas för andra gener.

Att bestämma en insticksstället inom regionen riktade gene är det mest kritiska steget i denna experimentella strategi. Metoden vi presenterade var utformad för att behålla alla original transkriptionell samt post-transcriptional reglementet av bnl gen5. Därför har vi planerat att ta bort de flesta av de första kodning exon av bnl genen och ersätta det med LexA kassett. Ersättning planerades på ett sådant sätt att den redigerade allelen uttrycker en hybrid LexA-bnl mRNA från den endogena transkription och translation starta webbplats av bnl behåller alla intronic regioner. Dock den hybrid som mRNA var konstruerad att producera bara LexA protein, men inte Bnl. Vi visade att strategin framgångsrikt hade genererat en bnl-LexA /LexO-baserat transkription system och att systemet korrekt kunde rapportera de dynamiska, spatiotemporal bnl uttryck mönsterna (figur 5),5 . En begränsning av denna process är homozygot dödlighet i Drosophila raderna om riktade genen är nödvändig för överlevnad. Dessutom kan används en dubbla gärna öka risken för off-target redigering. En alternativ strategi kan användas för att undvika dessa problem. I denna strategi, en LexA eller Gal4 kassett som kan placeras rätt på ATG start platsen för den ersatta genen och en T2A själv proteinspjälkande peptid sekvens kan placeras mellan LexA/Gal4 kassett och i början av den intakta kodning exon av målgenen. Denna strategi förväntas producera en chimär mRNA som kan översättas till både transctivator och produktens funktionella genen. Sådan konstruktion kunde möjligen minska risken för homozygot dödlighet. I denna strategi räcker en enda gärna gen editering. Dock i närvaro av två kopior av funktionella gener, uttryck för varianter av transgena protein som drivs av Gal4/LexA föraren (t.ex., bnl-LexA driven uttryck för LexO- Bnl: GFP fusioner eller Bnl proteiner med borttagningar) kommer inte att ge information av funktionaliteten hos de variant proteinerna.

En begränsning av editering strategin är den mödosamma processen med inriktning och redigering av en enda gen i taget. Dock har enkelheten och effektiviteten av CRISPR/Cas9-medierad genomet redigering metod revolutionerat riktade genomisk knock-knock-utcheckning och ersättning teknik som lätt kan antas i någon standard laboratorium ställa in. Under de senaste åren, har Drosophila forskare utvecklat praktiska verktygslådor för editering som kan användas för att expandera genetiska toolsets avgörande för förstå grundläggande biologiska processer7,13 . Genomet redigering och screening processer som beskrivs här är relativt snabbare och tar cirka två månader jämfört med alla andra homolog rekombination-baserad ersättning. För framgångsrika och effektiva editering resultat, är det viktigt att följa flera tekniskt kritiska steg: 1) varje gärna väljs av maximal stringens och aktivitet utan potentiella off-target; (2) HDR givaren innehåller ~1.5 kb homologi armar flankerar den gärna inriktning platser. Längre homologi armar (1,8 – 2 kb) används för att öka effektiviteten i HDR när en stor exogent DNA-fragment behöver införas; (3) den HDR-givaren är utformad för att vara fri från de gärna erkännande platserna att undvika retargeting av gärna till det bakåtkompilerade locus; och 4) en idiotsäker utarbetad plan och samordning av tidpunkten för genetiska korsningar med 3-stegs PCR-baserad screening för att välja en ”ändarna-out” HDR linje.

Till skillnad från slumpmässiga införlivande eller klonade enhancer konstruktioner, strategi och protokoll som vi beskrivit här säkerställer generation en uteslutande rikta gen-specifika binära transkription system. Eftersom uttrycket av föraren ersätter en native gen exon, gen-specifika uttryck för föraren är också mångsidig och förväntas att efterlikna gen uttrycksmönster under alla utvecklingstoxicitet, metaboliska och fysiologiska villkor5. Gen/cell-specifika uttryck är de mest önskvärda kriterierna av alla rader som binära drivrutinen när de används i olika cell och utvecklingsbiologi. Till exempel underlättar genen-specifika uttryck för reporter gener av en transkription-drivrutin tillförlitlig härstamning analyser av de celler som uttrycker målgenen. Det möjliggör också levande imaging och spårning av spatiotemporal uttryck, migration och omorganiseringen av celler under utveckling. För att undersöka de cellulära och molekylära händelserna under vävnad morfogenes, Gal4 eller LexA driven överuttryck/misexpression av är olika transgener och RNAi-medierad gen knock-down i specifika uppsättningar av celler avgörande. Mycket specifikt riktade uttryck systemet ger en opartisk analyser och tolkning av resultaten. CRISPR/Cas9-baserade inriktning av en gen exon och ersätts med en transactivator sekvens ger därför ett bättre alternativ för att skapa mycket specifika riktade gene expression system.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har inga intressekonflikter avslöja.

Acknowledgments

Vi tackar Dr. F. Port, Dr. K. Olsson-Giles och Dr. S. Feng för diskussioner om CRISPR strategi; Dr. T.B. Kornberg och Bloomington lager Center för reagenser. UMD imaging core facilitet; och finansiering från NIH: R00HL114867 och R35GM124878 till SR.

Materials

Name Company Catalog Number Comments
X-Gal/IPTG Gentrox (Genesee Scientific) 18-218 cloning
LB-Agar BD Difco BD 244520 cloning
Tris-HCl Sigma Aldrich T3253 Molecular Biology
EDTA Sigma Aldrich E1161 Molecular Biology
NaCl Sigma Aldrich S7653 Molecular Biology
UltraPure DNase/RNase-Free Water ThermoFisher Scientific 10977-023 Molecular Biology
10% SDS Sigma Aldrich 71736 Molecular Biology
KOAc Fisher-Scientific P1190 Molecular Biology
EtOH Fisher-Scientific 04-355-451 Molecular Biology
GeneJET Miniprep ThermoFisher Scientific K0503 Miniprep
PureLink HiPure Plasmid Maxipep kits ThermoFisher Scientific K210006 Maxiprep
BbsI NEB R0539S Restriction enzyme
Primers IDT-DNA PCR
pCFD4 Kornberg Lab DNA template and vector for gRNA
KAPA HiFi Hot Start- (Kapa Biosystems) Kapa biosystems KK2601 PCR
Q5-high fidelity Taq NEB NEB #M0491 PCR
Gibson Assembly Master Mix NEB NEB #E2611 DNA assembly
pBPnlsLexA:p65Uw Addgene DNA template for LexA amplification
Proteinase K ThermoFisher Scientific 25530049 Molecular Biology
2x PCR PreMix, with dye (red) Sydlab MB067-EQ2R Molecular Biology
Gel elution kit Zymo Research (Genesee Scientific) 11-300 Molecular Biology
TRI reagent Sigma-Aldrich Molecular Biology
Direct-zol RNA purification kits Zymo Research (Genesee Scientific) 11-330 Molecular Biology
OneTaq One-Step RT-PCR Kit NEB E5315S Molecular Biology
lexO-CherryCAAX Kornberg Lab Fly line
UAS-CD8:GFP Kornberg lab Fly line
btl-Gal4 Kornberg lab Fly line
MKRS/TB6B Kornberg lab Fly line
Confocal Microscope SP5X Leica Imaging expression pattern
CO2 station Genesee Scientific 59-122WCU fly pushing
Stereo microscope Olympus SZ-61 fly pushing
Microtube homogenizing pestles Fisher-Scientific 03-421-217 genomic DNA isolation
NanoDrop spectrophotometer ThermoFisher Scientific ND-1000 DNA quantification

DOWNLOAD MATERIALS LIST

References

  1. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, (2), 401-415 (1993).
  2. Lai, S. -L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nature Neuroscience. 9, (5), 703-709 (2006).
  3. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141, (3), 536-548 (2010).
  4. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  5. Du, L., Zhou, A., Patel, A., Rao, M., Anderson, K., Roy, S. Generation of a targeted expression system for branchless and characterization of novel cellular expression patterns of the gene in Drosophila. Developmental Biology. 427, (1), 35-48 (2017).
  6. Port, F., Chen, H. -M., Lee, T., Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 111, (29), E2967-E2976 (2014).
  7. Gratz, S. J., Rubinstein, C. D., Harrison, M. M., Wildonger, J., O'Connor-Giles, K. M. CRISPR-Cas9 Genome Editing in Drosophila. Current Protocols in Molecular Biology. 111, (1), 31.2.1-20 (2015).
  8. Doench, J. G., Hartenian, E., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  9. Port, F., Bullock, S. L. Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nature Methods. 13, (10), 852-854 (2016).
  10. Beumer, K. J., Trautman, J. K., Mukherjee, K., Carroll, D. Donor DNA Utilization During Gene Targeting with Zinc-Finger Nucleases. G3. 3, (4), Bethesda, Md. 657-664 (2013).
  11. Pfeiffer, B. D., Ngo, T. -T. B., et al. Refinement of tools for targeted gene expression in Drosophila. Genetics. 186, (2), 735-755 (2010).
  12. Lin, C. -C., Potter, C. J. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 203, (4), 1613-1628 (2016).
  13. Li, W., Köster, J., et al. Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. Genome Biology. 16, (1), 281 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics