Genom düzenleyerek Drosophila içinde doku özel ikili transkripsiyon sistemleri oluşturmak için etkili bir strateji

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Burada, ilk kodlama exon genlerin transkripsiyon sürücüleri ile değiştirerek Drosophila içinde doku özel ikili transkripsiyon sistemleri oluşturmak için bir yöntem mevcut. CRISPR/Cas9-tabanlı yöntemi bir transactivator sıra değiştirilen bir gen endojen Yönetmeliği altında yerleştirir ve sonuç olarak transctivator ifade sadece şekillerindeki gene özgü kronolojik zamanmekansal kolaylaştırır.

Cite this Article

Copy Citation | Download Citations

Du, L., Zhou, A., Sohr, A., Roy, S. An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing. J. Vis. Exp. (139), e58268, doi:10.3791/58268 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

İkili transkripsiyon sistemleri görselleştirme ve hücre kader ve gen ifade hücrelerin belirli gruplar veya model organizmalar içinde doku manipülasyonu için yaygın olarak kullanılan güçlü genetik araçlardır. Bu sistemlerde iki bileşeni ayrı transgenik çizgiler olarak bulunmaktadır. Bir sürücü çizgi transkripsiyon bir aktivatör doku özel Rehberleri/arttırıcılar kontrolünü ve hedef gen aşağı transkripsiyon harekete geçirmek bağlama sitesine yerleştirilen bir muhabir/efektör satır limanları altında ifade eder. Her iki bileşenin yataklık hayvan doku özgü transactivation bir hedef Gen ifadesinin neden. Kesin kronolojik zamanmekansal gen hedeflenen dokularda hücre/gen etkinliğini tarafsız yorumlanması için kritik ifadesidir. Bu nedenle, özel hücre/doku özel sürücü satırları oluşturmak için bir yöntem geliştirmek esastır. Burada istihdam ederek yüksek doku özel hedeflenmiş ifade sistemi oluşturmak için bir yöntem mevcut bir "düzenli olarak kümelenmiş Interspaced kısa palindromik tekrar/CRISPR-ilişkili" (CRISPR/CA)-Teknik düzenleme genom dayalı. Bu yöntemde, bir genin iki iplikçikli kırılmalar (DSB) oluşturmak için Drosophila genom içinde ilk kodlama exon belirli sitelere RNA'ların (gRNA) yol Cas9 chimeric iki tarafından hedeflenen endonükleaz. Daha sonra transactivator sıra içeren bir eksojen donör plazmid kullanmak, hücre özerk onarım makineleri Homoloji yönetmen onarım (HDR) kesin silme ve değiştirme exon transactivator ile sonuçlanan DSB, sağlar sıra. Knocked olarak transactivator sadece hücrelerde ifade edilir nerede CIS-eski yerine koymak gen düzenleyici elemanlarının fonksiyonel. Burada ikili bir transkripsiyon sürücü Drosophila fgfiçinde ifade oluşturmak için sunulan ayrıntılı adım adım Protokolü /branchless-epitel/nöronal hücreleri üreten kabul için herhangi bir gen veya doku özel ifade.

Introduction

Genetik toolbox için hedeflenen Gen ifadesinin de dahil çok çeşitli hücresel genlerin işlevi araştırmak için en iyi model sistemleri biri haline Drosophila, geliştirilmiştir. Maya Gal4/UAS (ters yönde harekete geçirmek sıra) gibi ikili ifade sistemleri ilk doku özgü artırıcı bindirme ve gen misexpression Drosophila genetik model1 (Şekil 1) için kabul edilmiştir. Bu sistem çok sayıda gen overexpression, misexpression, seçili grup hücreleriyle de olduğu gibi hücre ablasyon, hücre işaretleme, hücresel ve moleküler canlı izleme nakavt kronolojik zamanmekansal düzenlenmesi gibi teknikleri geliştirilmesi kolaylaştırdı embriyo ve doku, soy izleme ve mozaik analizleri geliştirme sırasında süreçleri. Bakteriyel LexAgibi ikili transkripsiyon sistemi bir dizi /LexAop sistemi (Şekil 1) ve Neurospora Q-sistem, şimdi yaygın olarak Drosophila, ek olarak kullanılan güçlü genetik Araçlar Orijinal Gal4/UAS sistemi için hedeflenen gen ifade1,2,3.

Burada, genom düzenleme tekniği istihdam ederek son derece sağlam doku özel ikili ifade sistemi oluşturmak için bir yöntem mevcut. CRISPR/Cas9 genom düzenleme teknolojisinde son gelişmeler çok çeşitli organizmalar yönlendirilmiş genom değişiklikler yapmak eşi görülmemiş fırsat sağladı. Diğer kullanılabilir genom düzenleme teknikleri için karşılaştırıldığında, CRISPR/Cas9 sistem, verimli, ucuz ve güvenilir. Bu teknoloji bakteriyel adaptif bağışıklık sisteminin bileşenleri kullanır: bir Cas9 endonükleaz iki iplikçikli mola (DSB) oluşturan Streptococcus pyogenes ve Cas9 için belirli genom sitesine kılavuzları chimeric Kılavuzu RNA (gRNA), hedeflenen DSB4. Hücreleri farklı yollar kullanarak DSB onarmak için makine içerir. Sigara homolog sonunda (NHEJ) katılmadan küçük eklemelerin veya silmelerin eksojen bir HDR donör şablon olarak kullanarak bir tanımlanmış yönetmen/arzu genomik knock-içinde/knock-out Homoloji yönetmen onarım (HDR) tanıttı iken gen işlevi, bozmaya yol açar. HDR tabanlı yedek stratejisi verimli bir şekilde geleneksel artırıcı tuzak yöntemleri tüm sınırlamalar üstesinden son derece sağlam doku özel ikili ifade sistemi oluşturmak için yararlı olabilir. Biz bir Drosophila endojen transkripsiyon ve çoğu düzenleme kontrolü altında ifade edilir bir ikili transkripsiyon sürücü çizgi oluşturma HDR CRISPR/Cas9-esaslı onarım kullanımı için adım adım bir yordam tarif gen. Bu protokol için biz göstermek için belirli bir sürücü satır nesil branchless trakeal hava yolu epitel5dallanma morfogenez düzenleyen bir FGF aile protein kodlama (bnl) Gen. Bu örnekte, bir bakteriyel LexA transactivator sıra sıra tarafından herhangi bir endojen CISdeğiştirmeden ilk kodlama exon bnl gen değiştirildi- bnl gen düzenleyici diziler. Biz strateji sadece bnl - içinde LexAoperator (LexAop veya LexO) aşağı yerleştirilen bir muhabir gen ifadesi spatiotemporally denetleyen bir bnl LexA sürücü satır oluşturulan gösterir epitel/mezenkimal/nöronal hücre ifade ediyorum.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. tasarlama ve gRNA ifade vektör oluşturma

  1. Tam bir exon uzun tanımlanmış bir bölgenin değiştirmek için her gRNA özellikle ilgi seçili bölgenin iki ucu hedefleyebilirsiniz bir çift gRNA yaklaşım6, kullanın. Sürücünün doğru bir gen özgü kronolojik zamanmekansal ifade elde etmek için iki gRNA hedef site içinde ilk kodlama exon genin seçin.
  2. Drosophila melanogasteriçin flyCRISPR en iyi hedef bulma aracını (http://tools.flycrispr.molbio.wisc.edu/targetFinder/) kullanarak gRNA hedef siteleri seçin. Diğer kullanılabilir CRISPR tasarım araçları de, en iyi duruma getirilmiş CRISPR tasarım aracı (http://crispr.mit.edu), FlyCas9 de dahil olmak üzere kullanılabilir (https://shigen.nig.ac.jp/fly/nigfly/cas9) ve E-net (www.e-crisp.org/E-CRISP).
    Not: Aşağıdaki iletişim kuralları gRNA tasarım ve klonlama yöntemleri yukarıda açıklanan6,7' den kabul edilmiştir.
    1. Gerçek sırası online araç kutusu içine kopyalayın. Belgili tanımlık en geçende serbest bırakmak Drosophila melanogaster genom ek açıklama yorum, "r_6," "Select genom." açılır menüsünü seçin Alan "Select kılavuz uzunluğunu (nt)," giriş "20." "Tüm CRISPR hedefler" bulun ve "CRISPR hedefleri bulmak" tıklatın seçin.
    2. Tüm aday gRNA hedefler "Sıkılık" ve "Sadece NGG" için "Maksimum" ayarlayarak "PAM" için değerlendirin. Herhangi bir potansiyel kapalı-hedefleri veya hedefleri kapalı olası en az sayıda olmadan gRNA siteleri seçmeyi deneyin. Web aracını kullanma Doench vd. gRNAs potansiyel bir "iyi" etkinliği puan ile seçmek için 2014 8 açıklanan.
    3. Aynı anda, orada hiçbir tek nükleotit polimorfizmi gRNA hedeflere enjeksiyon (Örneğin, nos Cas9 X kromozomu, BL # 54591 üzerinde) için seçili üst sinek çizgi genomu içinde olduğundan emin. Gratz vd 20157 genomik DNA üst sinek satırından ayıklamak için açıklanan protokol izleyin. PCR yükseltmek, yaklaşık olarak, faiz ve bir yüksek-sadakat DNA polimeraz dizisi kanattan primerler kullanılarak 500 – 1000 nt bölgeler; sıra-güçlendirilmiş PCR ürünleri doğrulayın.
  3. Tandem gRNA ifade vektör oluşturmak için iki protospacer diziyi pCFD4 RNA ifade vektör tanıtmak için bir tüp ligasyonu bağımsız Kopyalama Protokolü6 izleyin. Her iki sgRNAs güçlü U6:3 Rehberleri9 (https://www.crisprflydesign.org) ifade edilir nerede bir geliştirilmiş multi-gRNA ifade vektör (pCFD5) artık kullanılabilir olduğunu unutmayın. GRNAs pCFD4 vektör clone için DNA derleme yöntemini kullanın.
    1. Tasarım ve iki protospacer diziyi RNA ifade vektör pCFD4 tanıtmak için ileriye ve geriye doğru astar sipariş (tablo 1A). Yukarıda açıklanan6, ileri astar U6-1 organizatörü ve pCFD4'gRNA core karşılık gelen bölgeler çevrili ilk protospacer sıra içerir; ters astar gRNA çekirdek ve U6-3 organizatörü pCDF4 içinde karşılık gelen bölgeler çevrili ikinci protospacer geriye doğru tamamlayıcı dizisini içerir.
    2. DNaz ve RNase free Çift Kişilik distile su (GKD2O) ile 100 mikron için astar resuspend. 10 mikron çalışma konsantrasyonu astar olun. PCFD4 plazmid şablon olarak kullanmak ve bir yüksek-sadakat polimeraz kullanarak ve PCR reaksiyon6için önerilen ayarları PCR reaksiyon ayarlayın.
    3. PCFD4 plazmid BbsI enzim ile güçlendirilmiş ürün pCFD4 clone için aşağıdaki tepki kadar ayarlayarak sindirmek: 2-5 μg pCFD4 plazmid in, 10 sindirim arabellek x 5 μL, BbsI enzim ve son hacim için 50 μL getirmek için GKD2O 1 μL. Yavaşça tüp dokunarak ve dağınık damlacıkları tüp duvardan altına tarafından kısa bir tur toplama tarafından tepki içeriği karıştırın. Reaksiyon mix 2 h 37 ° C'de kuluçkaya.
    4. PCR ürünü adım 2 ve 3. adımdaki sindirilir ürün üzerinde % 1'özel jel çalıştırın. Tamamen DNA bantları ayırmak yeterli süre Elektroforez gerçekleştirin. Kesim doğru ölçekli DNA bantları bir UV trans-ışığı altında önce arındırıcı jel elüsyon sütununda üreticinin yönerge kullanarak beklenen ürünler ( Tablo malzemelerigörmek). PCR ürünü 600 olmalıdır bp ve Doğrusallaştırılmış pCFD4 plazmid ~6.4 kb 6olmalıdır.
    5. DNA derleme tepki üreticinin yönerge başına bir PCR tüp ayarlayın (bkz. Tablo malzeme).
    6. Yetkili bakteri (DH5α veya ΔrecA1, ΔendA1ile benzer suşları) derleme ürünün 2 μL dönüştürmek, plaka üzerinde ampisilin (100 μg/mL) LB (LB/Amp) ağar kaplamalar içeren ve 37 ° C'de gecede kuluçkaya. Not DNA derleme mix bazı bakteri suşları için zehirli olabilir, ancak derleme mix sulandrarak toksisite azaltabilir.
    7. 3-4 ampisilin dayanıklı kolonileri gecede inkübe plaka almak, 3 mL 100 μg/mL ampisilin içeren LB kolonisinde aşılamak ve bakteri aşılanmış bir 37 ° C Shaker gecede büyümek. Plazmid üreticinin öğretim takip plazmid mini hazırlık seti kullanarak bir gecede kültürlü bakterilerden ayıklamak ( Tablo malzemelerigörmek).
    8. Plazmid T3 tandem gRNA ekleme içeren doğru klonlar için ekran için evrensel astar ile sıra. Bir sıra onaylı pCFD4-gRNA içinde % 20 gliserol ve ileride kullanmak için bir-80 ° C dondurucu mağaza ile dönüştürülmüş bakteri gliserol stokunun kurmak.

2. tasarlama ve oluşturma HDR donör

  1. Genomik knock-içinde için bir Gal4 veya LexA sırasında iki Homoloji kolu tarafından çevrili transactivator sıra içeren bir çift iplikçikli HDR donör tasarlayın.
    1. Kullanım > 1,5 kb sol ve sağ Homoloji silah gRNA hedefleme kanat site (ler). Genişletilmiş Homoloji silah sırasında onarım işlemi 10HDR verimliliğini artırmak.
    2. PCR yükseltmek Homoloji silah enjeksiyon için seçilen üst sinek satırı çıkarılan genomik DNA (gDNA) (Örneğin, nos Cas9 (üzerinde X kromozomu), BL # 54591). Bir ispat okuma sıcak-başlangıç Taq DNA polimeraz enzimi uzun PCR uzantısı için uygun kullanın (bkz. Tablo malzeme). Sıra-doğrulayın.
  2. GRNA mühendislik odağı için yeniden hedefleme önlemek için yedek donör gRNA tanıma siteleri tanıtıldı eksojen sırası tarafından kesintiye şekilde tasarlayın.
    Not: sözde CIS düzenleyici elemanlarının değiştirmekten kaçının için her zaman kodlayıcı exon bölge içerisinde gRNA tanıma siteleri seçin.
  3. Bir yedek kaset oluşturmak için dört kesimleri birlikte katılmak için DNA derleme strateji planı: omurga (Örneğin, pUC19 veya diğer vektör 5' ve 3' Homoloji silah, orta eksojen transactivator DNA dizisi ve Doğrusallaştırılmış klonlama vektörel çizimler klonlama çok kullanılan). DNA derleme için üreticinin kılavuz takip (bkz. tablo malzemeler), PCR güçlendirme ve her parçanın montajı için uygun astar tasarım. 100 μM GKD2O. olun 10 mikron çalışma konsantrasyonu astar astar resuspend. Yüksek sadakat polimeraz PCR reaksiyonları için kullanın. Aşağıdaki iletişim kuralı uygulayın:
    1. PCR yükseltmek kullanılabilir bir vektör üzerinden Gal4 veya LexA ifade kaset (Örneğin, nls-LexA:p65; ideal Gal4/LexA/QF2 ifade plazmit bulundu ve Addgene gibi ortak kaynaklardan elde edilen) kullanarak tablo 1Badımında listelenen astar.
      1. Tüm orijinal transkripsiyon ve çoğu Yönetmeliği transactivator DNA dizisi ifade üzerinde değiştirilen exon korumak için böyle bir şekilde düzenlenmiş genomik alleli chimeric mRNA Hızlı Kaset tasarım, transactivator ve Gen. Tutkallama herhangi bir sinyal korumak için hedeflenen exon 5' ve 3' sonu korumak.
      2. Bir T2A kendi kendine sıyırmada peptid sırası arasında kalan 5' exon ve chimeric protein tercüme önlemek için transactivator sıra kodlama dahil. Çeviri kodonu eksojen transactivator sırası (Şekil 5) sonra ekleyin.
    2. PCR yükseltmek Homoloji silah enjeksiyon için seçilen üst sinek satırı çıkarılan genomik DNA (gDNA) (Örneğin, nos Cas9 (üzerinde X kromozomu), BL # 54591) tablo 1Badımında listelenen primerler kullanılarak. Yüksek sadakat polimeraz gibi sistemleri kullanarak tüm PCR reaksiyonları için kullanın: 5 x reaksiyon arabellek, 10 mM dNTPs 0.5 μL, 10 mikron 1,25 μL 5 μL ileri astar, 10 mikron 1,25 μL ters astar, şablon DNA, 0,25 μL High-Fidelity DNA polimeraz 0.5 μL , GKD2O. 16.25 μL
    3. Doğrusallaştırılmış klonlama vektör pUC19 gibi kullanın. Donör vektörel çizimler bir dizi artık kullanılabilir. Aşağıdaki Web sitesi-http://flycrispr.molbio.wisc.edu, kapsamlı bir listesine bakın.
    4. PCR ürünleri üzerinde % 1'özel jel çalıştırın. İstenmeyen belirsiz bantları (varsa) istenen grubun net bir ayrılık emin olmak yeterli süre Elektroforez gerçekleştirin. Jel-beklenen DNA parçalarının arındırmak. Konsantrasyon her saf DNA parçasının bir spektrofotometre kullanarak ölçmek.
    5. Üreticinin öğretim takip DNA derleme tepki kadar ayarla. Mix Doğrusallaştırılmış klonlama vektör ve hedef parçaları kimden adım 3 ve adım 4 aşağıdaki reaksiyon: 1 μL doğrusal, klonlama vektör (50 ng/μL), 2-3 kat fazla her hedef parçasının, 2 DNA derleme ana mix, x 10 μL getirmek son tepki birim GKD ile 20 μL < C21 > 2O. Incubate reaksiyon mix 1 saat 50 ° c
    6. Derleme ürünün 2 μL yetkili bakteri, plaka üzerinde 100 μg/mL ampisilin içeren LB/Amp ağar kaplamalar dönüşümü. Ayrıca, mavi/beyaz tarama için plaka üzerinde X-Gal + IPTG ekleyin.
    7. 3-4 beyaz kolonileri gecede inkübe plaka almak, 3 mL 100 μg/mL ampisilin içeren LB kolonisinde aşılamak ve geceleme bir shaker 37 ° C'de büyümek. Özü plazmid üretici takip plazmid mini hazırlık seti kullanarak bir gecede kültürlü bakterilerden el ile (bkz. Tablo malzeme).
    8. Ekran PCR veya kısıtlama sindirim tarafından olumlu koloni.
    9. Sıra son plazmid HDR donör bölgesi doğrulayın. Gelecekteki aşılama için-80 ° C'de % 20 gliserol doğru klonlar ile dönüştürülmüş bir bakteriyel hisse senedi kaydedin.

3. embriyo enjeksiyon, sinek genetik ve genom düzenlemek için tarama

  1. Yüksek hazırlamak saflık endotoksin-Alerjik gRNA ifade vektör yanı sıra bir plazmid maxiprep kullanarak HDR donör plazmid kiti ( Tablo malzemelerigörmek).
  2. GRNA ifade plazmid (100 ng/μL) ve yedek donör (500 ng/μL) Co nos-Cas9 embriyo6germline enjekte. Not: ticari servisine enjeksiyon için kullandığımız ancak bu yordamı laboratuvarda de gerçekleştirilebilir.
  3. Genetik ve tarama (Şekil 2 ve Şekil 3) fly:
    1. Ne zaman yetişkin enjekte embriyo geliştirmek, tek her G0 dengeleyici sinekler için uçar. Hedeflenen gen içeren kromozom için uygun dengeleyici seçin.
    2. Yavru her G0 üzerinden bir CO2 yastık üzerinde çapraz ve rasgele 10-20 erkek bir stereomicroscope altında almak F1 anestezi. Onları tek tek Şekil 3' te gösterilen dengeleyici kadın için çapraz.
    3. Ne zaman F2 larva kapağı her çapraz tek F1 babadan almak ve gDNA tek sinek genomik DNA hazırlık protokolü kullanarak ayıklayın:
      1. GDNA ayıklama arabellek hazırlamak: 10 mM Tris-Cl pH 8.2, 1 mM EDTA, 25 mM NaCl, mağaza oda sıcaklığında. 20 mg/mL İndinavir K hisse senedi çözüm hazırlamak ve dondurucuda saklayın.
      2. Her sinek bir 1,5 mL mikro-santrifüj tüpü yerleştirmek ve tüp etiket. -80 ° C dondurucuya gecede devam et.
      3. GDNA ayıklama arabellek İndinavir K. 200 µg/mL son konsantrasyonu içeren çalışma hacmi çok taze hazırlamak
        Not: eski bir arabellek için bu adımı kullanmayın.
      4. Her sinek 10-15 s için arabellek sıvı dağıtımı olmadan squishing 50 μL içeren bir pipet ucu ile ezmek. Tüpün içine geri kalan arabellek dağıtmak ve iyice karıştırın. 20-30 dk 37 ° C'de kuluçkaya.
      5. Tüpler 95 ° C ısı blok 1-2 dk İndinavir K. devre dışı bırakabilirsiniz için koymak
      6. Spin aşağı 10.000 x gde 5 min için. Daha fazla PCR analiz hazırlık-4 ° C'de depolayın.
  4. Üzerinden bir negatif kontrol hizmet veren bir nos-Cas9 sinek gDNA hazırlamak için aynı yöntemi kullanın. Dışarı doğru "biter" HDR (Şekil 2, Şekil 5) kullanarak tanımlamak için üç adımlı temel PCR ekranlar gerçekleştirmek her F1 erkek bir şablon5olarak gDNA. DNA hazırlık 1 μL aşağıdaki PCR reaksiyon sistemi kullanım: 2 PCR Master Mix Boya, her astar (10 mikron), DNA şablonunun 1 μL ve 7 μL GKD2O. 1 μL x 10 μL
  5. Şekil 5A' de gösterildiği PCR ekleme veya değiştirme varlığı için astar fwd1 ve Değişiklik1 için ekran kullanarak gerçekleştirmek; PCR ekleme veya değiştirme bölgesinden 3' doğrulamak için fwd2 ve rev2 primerler kullanılarak gerçekleştirmek; PCR "etraf-in" HDR (Tablo 1 c) kontrol etmek için astar M13F ve rev3 kullanarak gerçekleştirin.
  6. Sinek satırlarını teyit biter-out HDR ile tutmak ve F2 kuşaktan dengeli hisse senetleri kurmak. Yine diğer kromozom üzerinde herhangi bir istenmeyen mutasyonlar kaldırmak için dengeleyici sinekler için outcross.
  7. Yüksek kaliteli gDNA üzerinden kurulan hisse senetleri uzun PCR yükseltecek için hazırlamak (> 800-1000 nt) amplicon yüksek-sadakat Taq polimeraz ve tam sırası ile mühendislik genomik bölgelerden elde edilen amplicons doğrulayın. Alternatif olarak, ham gDNA özü açıklandığı gibi daha önce daha kısa yükseltmek için kullanın (< 800 nt), sıra Düzenlenmiş genom doğrulamak için PCR ürünleri örtüşen. Kaliteli Drosophila genomik DNA hazırlamak için aşağıdaki iletişim kuralı kullanın:
    1. 1.5 mL microcentrifuge tüp 25 yetişkin sinekli hakkında koymak ve en az 1 saat-20 ° C veya-80 ° C dondurucuda dondurma.
    2. Çözüm A 250 μL ekleyin (pH 9.0 Tris HCl 0.1 M, EDTA 0.1 M, SDS % 1).
    3. Homojenizasyon dibekler microcentrifuge tüplerde kullanarak sinekler homojenize ve tüp buza koy.
    4. 70 ° c 30 dk için kuluçkaya.
    5. 35 KOAc (5 M) μL, sallamak, iyi ekleyip karıştırın, ama yapmak değil girdap.
    6. 30 dk için buz üzerinde kuluçkaya.
    7. 12.000 x g 15dk için de spin.
    8. 1 mL micropipette ile dikkatli bir şekilde sadece açık süpernatant geri herhangi bir çökelti bırakarak yeni bir tüp için transfer veya Interphase.
    9. İsopropanol 150 μL süpernatant için ekleyin. INVERSION tarafından karışımı yavaşça.
    10. 10.000 x g 5 min için de spin.
    11. Dikkatle süpernatant kaldırır ve Pelet tüp içinde bırakır.
    12. Pelet 1 mL % 70 ile yıkayın alkol.
    13. 12.000 x g 5 min için de spin.
    14. Süpernatant kaldırın. Hava kuru Pelet 15-20 dk için. Üzerinde Pelet kuru değil.
    15. GKD2O. 100 μL Pelet dağıtılması
    16. Yüksek sadakat DNA polimeraz uzun amplicon için uygun kullanın (> 800 bp) tam düzenlenen bölge yükseltmek için. İdeal olarak, iki astar genomik bölge yükseltmek için eklenen kaset dışında al. Jel PCR ürünü arındırmak ve daha önce açıklandığı gibi sıra ürün birden çok örtüşen astar ile doğrulayın.
  8. Disseke dokular/embriyo mühendislik sinek satır doğru kronolojik zamanmekansal ifade desenlerini doğrula:
    1. RT-PCR hibrid mRNA ürün (Tablo 1 d) ifade doğrulamak için toplam RNA gerçekleştirin.
    2. MRNA ürün larva dokular/ifade doğrulamak için embriyo ilgi bir in situ hibridizasyon gerçekleştirin.
    3. LexO- GFP veya LexO- RFP (için ile ikili ifade driver için doğru doku özgü kronolojik zamanmekansal ifade desenleri sıra doğrulanmış biter-out satırları arasında çapraz için düzenlenen satırlarının her birindeki ekran için elde LexA sürücü) (Bloomington hisse senedi merkezlerinden temin edilir) satır ve LexA veya floresan mikroskop altında embriyo, larva ve yetişkin dokularda muhabir-gen ekspresyonu tahrik Gal4 uyun.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Bu iletişim kuralı başarıyla hedeflenen ikili ifade muhabir sistem belirli hücreleri5ifade bnl için bir oluşturmak için kullanılan. BDT-karmaşık kronolojik zamanmekansal bnl ifade kontrol düzenleyici elemanlarının (CREs) değil karakterize. Bu nedenle, kronolojik zamanmekansal ifade endojen bnl Düzenleyici sıralı denetim altında elde etmek için yalnızca ilk kodlama exon bnl , bakteriyel LexA transactivator sıra ile değiştirilmesi için tasarlanmıştır. Drosophila en iyi ifade sağlamak için bilinen bir geliştirilmiş nls-LexA::p65 kaset seçildi.

Bir chimeric oluşturmak için yedek stratejisi amaçlı nls-LexA:p65-bnl mRNA endojen transkripsiyon ve çoğu kontrol altında. Bu chimeric mRNA bnl sağlam bir 5' UTR, 5' ucu ve exon kodlama düzenlenmiş bnl 3' sonu parçası bulunan (ilk exon) ve tam aşağı akım bnl intron ve ekzonlar. Bnl RNA özgü değiştirilen exon Uçbirleştirme korumak için değiştirilen kodlama exon küçük 5' ve 3' ucunda muhafaza. Ancak, nls -LexAiçin erimiş chimeric Bnl protein sentezi önlemek için: p65, kendi kendine sıyırmada peptit dizisi kodlama bölge ve ATG, kalan 5' bnl arasında dahil bir T2A nls-LexA:p65. Ayrıca, bir çeviri kodonu sonra eklendi nls-LexA:p65 sıra bir kesilmiş Bnl protein5 (Şekil 4 ve Şekil 5A) ortak çeviri önlemek için.

Tüm bu özellikler içeren bir yedek donör kullanılan, T2A- vardınls-LexA:p65 dizisi ve 2 kb 5' - ve 1,8 kb 3' - Homoloji silah. Uzun Homoloji silah verimli HDR ve onarım yerinde büyük bir DNA parçasının ekleme için kullanılmıştır (T2A-nls-LexA:p65 1,8 KB) (Şekil 5A).

İki gRNAs DSBs ilk kodlama exon bnl, çoğunu silmek için tanımlanmış pozisyonlarında oluşturmak için kullanılmıştır. 1.3 (PAM sıra altı çizili) bölümünde açıklanan tüm ölçütleriyle eşleşen iki gRNAs vardı:
gRNA1: TGTATCTGCGATGCCCCTCATGG
gRNA2: ATCCTTCAGATATTGCGGGATGG

Her iki gRNA tanıma site yerine donör tarafından eksojen T2A- bozdunls-LexA:p65 sıra, mühendislik locus gRNAs, yeniden hedefleme önlemek için en kolay yoludur. Yedek donör (gRNA tanıma siteleri italik kesintiye eksojen dizileri) kesintiye gRNA tanıma serilerinde vardı:
gRNA1: TGTATCTGCG -GGCTCCGGCGAAGGAC...
gRNA2:... AAAAACTCGTTTAGA- CGGGATGG

Yedek donör ile birlikte bu gRNAs içeren pCFD4 gRNA ifade vektör Co nos-Cas9 embriyo germline enjekte. Daha sonra burada açıklanan protokol izledi için amaçlanan değiştirme (Şekil 5B, C) ekran. Yaklaşık %67 enjekte G0 hayvanların bereketli idi. Ve verimli G0s %56 HDR-pozitif döl için doğuran kurucuları idi. Kontrol F1 Döl arasında yaklaşık %23 başarılı HDR için pozitif ve olumlu HDR % 73 "biter-out" (Tablo 2) idi. İlk kodlama beri bnl exon "elendikçe", tüm HDR satırları bulunamadı homozigoz olmak öldürücü ve hisse senetleri dengeleyici üzerinde muhafaza.

Hücrelerdeki chimeric LexA bnl mRNA nesil RT-PCR analizleri (Şekil 5 d) tarafından doğrulandı. Elde edilen bnl-LexA satırları olup olmadığını doğrulamak için endojen bnl ifade şeklinde ifade, her "biter-out" HDR LexO-mCherryCAAX transgenik sinekler5ve muhabir ifade deseninin çizgiyi yapıldı. Döl embriyo ve larva incelenmiştir. dışarı-in 42 46 satırları doğru kronolojik zamanmekansal ifade daha önce raporlanmış bnl desen5 (Şekil 6) ile tutarlı gösterdi. Dört satır ya zayıf veya belirsiz ifade desenleri gösterdi. Biz bu satırları kapsamlı sıralama analizleri ile doğrulamanız gerekir mutasyonlar birikmiş tahmin. Birlikte bu sonuçlar HDR-aracılı exon yedek stratejisi başarıyla bir gen için hedeflenen ikili ifade sistemi oluşturmak için istihdam olabilir doğruladı. Aracı başarıyla muhabir veya bnl gen kronolojik zamanmekansal şekillerindeki ektopik genlerin ifade etmek için kullanılabilir.

Figure 1
Şekil 1: hedeflenen gen ifadesi için bir ikili transkripsiyon sisteminin düzenini. CISkontrolü altında ifade edilen bir transactivator (GAL4 veya LexA),-bir gen düzenleyici elemanlarının (CREs) belirli transkripsiyon bağlayıcı siteleri (UAS Gal4 için aşağı yerleştirilen bir efektör transgene sürücüler veya LexAop LexAiçin) Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2: CRISPR/Cas9-aracılı genom ikili transkripsiyon sistemi oluşturmak için düzenlemek için iş akışının genel bir bakış. Her adım için gerekli yaklaşık bir süre belirtilir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: Eleme ve genetik düzeni genom düzenlenmiş sinek satırları oluşturmak için çapraz CRISPR bir örnek. Genetik çarpılar içinde R 3rd kromozom üzerinde düzenlenen alleli simgeler. MKRS (Tp (3; 3) Bayan M (3) 76A [1] kar [1] ry [2] Sb [1]), bir 3rd kromozom; belirtecidir TM6B ((3LR) TM6B, Antp [Hu] e [1] içinde Tb[1]) bir 3rd kromozom dengeleyici olduğunu. Düzenlenmiş genom sinek hisse senetleri F2 veya F3 üretimi sinekler ve PCR ürünlerinin belirlenmesi sıra--dan hulâsa genomik DNA dan ilgi hedef bölgeleri yükseltecek PCR tarafından doğrulanır. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4: DNA derleme tarafından yedek kaset nesil. PCR güçlendirme ve derleme farklı PCR ürünlerinin resmeden bir şematik çizim (a, b ve c) (d) bir DNA derleme yöntemiyle donör vektör içine. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 5
Şekil 5: Nesil bnl LexA CRISPR/Cas9-aracılı exon yedek tarafından. (A) CRISPR/Cas9 strateji gösteren çizim şematik aracılı HDR bnl locus exon değiştirme için. Kutusu - exon; çizgi-intron; yedek donör (pDonor -bnl:LexA) ve iki olası sonucu HDR görünümü gösterilmiştir. PDonor -bnl:LexA aşağıdaki özellikleri vardı: (1)T2A-nls-LexA:p65 (~1.8kb) sıra çevrili 2 kb ve 1,8 kb tarafından uzun Homoloji silah (kesikli çizgiler), (2) bir T2A kendi kendine sıyırmada peptid kalan N terminal bnl exon ve arasında NLS-LexA:p65ve (3) çeviri kodonu (kırmızı *) sonra nls-LexA:p65 dizisi. Bnlve LexAtüm transkripsiyon ve çoğu kontrolünü HDR ürün muhafaza: p65 protein endojen Bnl. küçük siyah okları göreli bağlayıcı siteleri (değil de gösterdiği gibi aynı desende üretilmesi bekleniyor 3-adım tarama veya RT-PCR doğrulama için kullanılan PCR astar (Tablo 1), çap). ((B)) 3-adım PCR tarama sonuçlarını gösteren özel jel fotoğraflar. PCR ürünleri dört başarılı biter-out HDR satır genomik DNA'güçlendirilmiş gösterilir; negatif kontrol, nosgenomik DNA-Cas9 ebeveyn hattı; pozitif kontrol, pDonor -bnl:LexA plazmid; M, Marker (SL2K DNA merdiven). (C) biter satırları için astar M13F ve rev3 kullanarak beklenen PCR ürünü gösterilen tarama jel örneği; M8-7 ve M9-6 biter, iki satır vardır; negatif ve pozitif denetimleri, B ile aynıdır; M, Marker (NF'leri 1 kb DNA merdiven). (D) uçar bnl LexA ve nos-Cas9 denetim toplam RNA RT-PCR analiz. İleri astar LexA belirli bir bölgeye bağlar, ters astar bir aşağı akım bnl exon bölgesine bağlar; ~ 440 bp (temel-çift) güçlendirme grubu (*) bnl LexA üzerinde RT-PCR algılandığı mRNA, ancak denetim RNA. M, 100 bp Marker (NF'leri). Rakamlar 2 ve S1 Du ve arkuyarlanmış. 20175. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 6
Şekil 6: Doğrulama doku özgü ve koşullu bnl LexA ifade farklı dokularda. (A-D) bnl ifade (içinde farklı larva doku, kırmızı) hücreleri yeşille gösterildiği ifade btl ile. (A, A') Kanat disk bnl kaynak öncesinde artan hava sac primordium (ASP). (B, C) BNL ifade TR5 çapraz bağ (TC) (B) ve TR2 dorsal şube (DB) (C). (D) bnl genital diskler ifadede. (E-J) Embriyonik trakeal şube (yeşil) desenlendirme sırasında dinamik bnl ifade (kırmızı); Küçük okları, trakeal placode 10 aşamada çevreleyen beş bnl kaynakları. Genotip: A-J; btl-Gal4, UAS- CD8GFP / +; bnl-LexA, LexO- CherryCAAX /+. (K-L ") Hipoksi-kanat diskler bnl LexA ifade profilinde indüklenen ve TR2 trakeal metamere (TC, DB, dorsal gövde-DT) ilişkili. Genotip: bnl-LexA, LexO -CherryCAAX / +. (K) ex vivo disklerinden denetim organları CoCl2olmadan kültürlü. (L-L") kanat diskler (L, L') ve soluk borusu (DT, (L'')) kültürlü ex vivo organları CoCl2 ile gelen hipoksi indüklenen. Yıldız, ektopik ifade tarafından hipoksi indüklenen. Ölçek çubukları 30 µm; = 50 µm (K-L"). Şekil 3 ' Du ve arkuyarlanmış. 20175. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

A. gRNA klonlama ve sıralama
BNL lexA gRNA ileri sar TATATAGGAAAGATATCCGGGTGAACTTCg TGTATCTGCGAT
GCCCCTCAGTTTTAGAGCTAGAAATAGCAAG
BNL lexA gRNA devir ATTTTAACTTGCTATTTCTAGCTCTAAAAC TCCCGCAATATCTGAAGG
CGACGTTAAATTGAAAATAGGTC ,
Sıralama için kullanılan T3 astar CAATTA ACCCTCACTAAAGG-3'
Not: altı çizili nükleotit U6 organizatörü veya pCFD4 vektör gRNA çekirdeğini tavlama, küçük g/c U6 organizatörü bağımlı transkripsiyonu yardımcı olmak için eklenmiştir
B. HDR donör İnşaat
BNL N-F_pUC19 AATTCGAGCTCGGTACtgtggtctttgaggctggaac
BNL-lexA-N-R tCCGcaagtCagtAGgctgccgcgtccttcgccggaGCC CGCAGATACAAGGCCC
C
lexA-F CTactGacttgCGGaGAtGTcGAaGAGAACCCtGGCCCt ATGCCACCCAA
GAAGAAGC
lexA-R CTAAACGAGTTTTTAAGCAAACTCACTC
BNL lexA-C Fwd TAAAAACTCGTTTAGACGGGATGGCGTTGTCAAC
BNL C-R_pUC19 GCCAAGCTTGCATGCCtcgcataattgccgcctgg
Not: pUC19 vektör sermaye çakışma Gibson derleme, altı çizili nükleotit için nükleotit dizisi çıkıntı T2A peptid ek vardı.
C. HDR filtreleme ve sıralama
BNL lexA scr fwd1 GTGGCGCACGCCCAATAAAC
BNL lexA scr Değişiklik1 GATCCCAGCCAATCTCCGTTG
BNL lexA scr fwd2 CAACGGAGATTGGCTGGGATC
BNL lexA scr rev2 CTGGCCAACTGTAGGGAAGTC
onay biter-in rev3 GCAATGTTATGCAATGCGTTGAC
BNL lexA seq fwd3 CACTTGTCGCCCATATTGATACAATTG
Not: Bu astar filtreleme ve sıralama PCR için kullanıldı, astar bağlayıcı siteleri yaklaşık yerlerini şekil 5A ' fwd1-2 ve Değişiklik1-3 olarak gösterilir.
Ö RT-PCR Analizi
RT-f GATATGGATTTCTCCGCTTTGCTG
RT-r CCATGCAGAGATACAGGCAAGTG

Tablo 1: Bu çalışmada kullanılan astar. (A)astar gRNA ifade vektör klonlama ve sıralama için. (B) astar HDR donör şablon klonlama için. Filtreleme ve sıralama HDR ürünleri için (C) astar. RT-PCR chimeric LexA bnl mRNA ürün doğrulaması için kullanılan (D) astar.

genotip HDR iletim oranı % (# G0 / # verimli G0 HDR verimli) # HDR-pozitif F1 / # toplam F1 kontrol (%) # "biter-HDR / # toplam HDR (%) out"
BNL LexA 56 (15/27) 23 (60/259) 73 (46/60)

Tablo 2: CRISPR/Cas9-aracılı HDR verimliliğini. HDR iletim hızı HDR verimli G0/sayısı toplam verimli G0 # hesaplanır. Başarılı HDR % HDR-pozitif F1 / # toplam F1 ekranlı # hesaplanır. "Biter-out" % "biter-out" HDR/sayısı toplam olumlu HDR # hesaplanır.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Geleneksel olarak, Drosophila artırıcı tuzakları iki farklı yöntemlerle üretilen. Bir yolu bir sürücü rasgele yerleştirilmesi içerir (örneğin., Gal4) genom tarafından devralınmasına sırayla (e.g., P-eleman transpozisyonu)1 . Alternatif olarak, sürücü dizileri sonra genom3,11ektopik bir siteye entegre bir plazmid yapısında bir sözde artırıcı/organizatörü bölgesinin transkripsiyon kontrolü altında yerleştirilebilir. Bu yöntemler Gal4 veya LexA artırıcı tuzakları büyük bir havuz Drosophilaiçin üretilip rağmen bazı sınırlamaları vardır. P öğe aracılı rasgele ekleme genom içinde kritik CISdüzenleyici etkinlik engel olabilecek-düzenleyici diziler. Genom içinde rasgele aktarılması nedeniyle transactivator ifade birden fazla komşu gen desen bildirebilir. Öte yandan, CIS düzenleyici bir gen dizilerinin bir ön bilgi bir enhancer-tuzak plazmid inşa için gereklidir. Ayrıca klonlanmış ve plazmid yapı içinde test eden bir sıra uzunluğu için bir sınır yoktur. İzole edip sadece DNA kısmi bir parçası endojen genomik bağlam dışında klonlama tam gene özgü ifade desenleri yeniden üretmek değil. Örneğin, P-öğe ekleme bir artırıcı tuzak Gal4 öğesi sadece önde bnl Gen tarafından oluşturulan, bnl-Gal4 (NP2211) satırı tamamen embriyo5 gen özgü ifade desenleri çoğaltmak değil . Bu nedenle, böyle bağlamı altında repurposing teknikleri (Homoloji destekli CRISPR knock-gelen), kesmek gibi dönüştürmek varolan Gal4 satırları başka bir LexA veya Q-sistem içine dayalı sürücü satır12 çok yararlı olabilir. Bu sınırlamalarını aşmak için burada, genom düzenleyerek ikili ifade sistemleri oluşturmak için verimli ve alternatif bir yöntem açıklanmıştır. Bu yöntemde, bir genin ilk kodlama exon transactivator ile takas edilir (örn., LexA veya Gal4) transkripsiyon sürücü ifade sadece gen ekspresyonu kronolojik zamanmekansal şekillerinin taklit eder böylece sıra. Strateji ve burada açıklanan protokoller bnl -ifadesi için en iyi şekilde rağmen Yöntem kolayca diğer genler için kabul edilebilir.

Hedeflenen gen bölgesi içinde bir ekleme site belirleniyor bu deneysel strateji en önemli adımdır. Yöntemi biz sunulan tüm orijinal yanı sıra bnl gene5düzenlemeler çoğu transkripsiyon korumak için tasarlanmıştır. Bu nedenle, biz ilk kodlama exon bnl gen çoğunu silin ve eski yerine koymak o ile LexA kaset planlanan. Yerine düzenlenen alleli bir melez LexA-bnl ifade eder şekilde planlanmıştı mRNA endojen transkripsiyon ve translasyon üzerinden başlatmak bnl sitenin tüm intronic bölgeler koruyarak. Ancak, mRNA tasarlanmış üretmek tek LexA protein ama değil Bnl melez. Biz strateji başarıyla bnl LexA oluşturulan gösterdi /LexO-tabanlı transkripsiyon sistemi ve sistem doğru dinamik, kronolojik zamanmekansal bnl ifade modelleri (Şekil 5)5 rapor olabilir . Hedeflenen gen hayatta kalmak için gerekli ise bu sürecin bir sınırlama Drosophila satırlarındaki homozigoz ölümcül olur. Ayrıca, bir ikili gRNA strateji kullanımını hedef kapalı düzenleme şansını artırabilir. Alternatif bir strateji bu sorunları önlemek için istihdam edilebilir. Eski yerine koymak gen ve kendi kendine sıyırmada peptit dizisi LexA/Gal4 kaset ve sağlam kodlama exon başlangıcı arasında yerleştirilebilir bir T2A ATG başlangıç yerinde sağ LexA veya Gal4 kaset yerleştirilebilir bu strateji, hedef gene. Bu strateji hem transctivator ve işlevsel bir gen ürün tercüme chimeric bir mRNA üretmek için bekleniyor. Böyle bir tasarım muhtemelen homozigoz ölümcül şansını azaltmak. Bu strateji, bir tek gRNA genom düzenlemek için yeterlidir. Ancak, işlevsel genleri, ifade Gal4/LexA sürücü tarafından tahrik transgenik protein versiyonlarının iki kopyası varlığında (örn., LexO- Bnl ifade tahrik bnl LexA : GFP füzyon veya Bnl proteinler ile silme) bilgi varyant proteinlerin işlevselliği sağlamak değil.

Genom düzenleme strateji hedefleme ve tek bir gen düzenlenmesine zahmetli süreci kısıtlamadır. Ancak, basitlik ve genom düzenleme yöntemi CRISPR/Cas9-aracılı verimliliğini hedeflenen genomik knock-içinde/knock-out ve kolayca herhangi bir standart laboratuar içinde kabul edilebilir yerine teknoloji devrim. Son birkaç yılda,7,13 temel biyolojik süreçleri anlamak için gerekli genetik toolsets genişletmek için istihdam genom düzenleme için uygun araci Drosophila araştırmacılar geliştirdik . Düzenleme ve burada anlatılan işlemleri eleme genom nispeten daha hızlı ve herhangi bir diğer Homolog rekombinasyon tabanlı yerine göre yaklaşık iki ay sürer. Başarılı ve verimli genom düzenleme sonucu elde etmek için birçok teknik olarak kritik adımları izlemeniz önemlidir: 1) her gRNA en büyük sıkılık ve potansiyel kapalı hedef; olmadan faaliyet tarafından seçilir 2) HDR donör ~1.5 kb Homoloji silah siteleri hedefleme gRNA kanat içerir. Daha uzun Homoloji silah (1,8-2 kb) büyük bir eksojen DNA parçası eklenecek gerektiğinde HDR verimliliğini artırmak için kullanılır; 3) HDR donör gRNA tanıma siteleri için tasarlanmış locus gRNA, yeniden hedefleme önlemek için ücretsiz olması için tasarlanmış; ve 4) bir kusursuz ayrıntılı plan ve koordinasyon bir zamanlama 3 adımlı PCR tabanlı tarama ile genetik haçlar bir "biter-out" HDR satırı seçmek için.

Rasgele aktarılması veya klonlanmış artırıcı yapıları farklı olarak, strateji ve biz burada açıklanan protokoller nesil sağlar bir gen özel ikili transkripsiyon sistemi özel olarak hedef. Ifade sürücüsünün yerel gen exon değiştirir gene özgü ifade sürücünün de çok yönlüdür ve gen ifade desenleri tüm gelişimsel, metabolik ve fizyolojik koşullar5altında taklit etmesi bekleniyor. Çeşitli hücre ve gelişim biyolojisi yöntemleri kullanıldığında gen/hücre özel ikili sürücü satırları en çok arzu edilen ölçüt ifadesidir. Örneğin, gene özgü ifade muhabir Gen transkripsiyonu sürücüsü tarafından güvenilir soy analizleri hedef gen ifade hücre kolaylaştırır. Ayrıca canlı görüntüleme ve kronolojik zamanmekansal ifade, geçiş ve hücre reorganizasyon geliştirme sırasında izleme sağlar. Hücresel ve moleküler olaylar sırasında doku morfogenez, Gal4 veya overexpression/misexpression, tahrik LexA araştırmak için çeşitli transgenes ve RNAi aracılı gen knock-down hücreleri belirli kümesi gereklidir. Çok özel hedeflenmiş ifade sistemi sağlar bir tarafsız analizleri ve sonuçların yorumlanması. Bu nedenle, bir gen exon ve onun yerine bir transactivator sırası ile CRISPR/Cas9-esaslı hedefleme çok özel hedeflenmiş gen ifade sistemleri üretmek için daha iyi bir alternatif sağlar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar hiçbir ifşa etmek çıkar çatışması var.

Acknowledgments

Dr. F. liman, Dr. K. O'Connor-Giles ve Dr. S. Feng CRISPR strateji üzerine tartışmalar için teşekkürler; Dr. T.B. Kornberg ve reaktifler Bloomington stok merkezi; UMD görüntüleme çekirdek tesis; ve NIH finansman: R00HL114867 ve R35GM124878 SR.

Materials

Name Company Catalog Number Comments
X-Gal/IPTG Gentrox (Genesee Scientific) 18-218 cloning
LB-Agar BD Difco BD 244520 cloning
Tris-HCl Sigma Aldrich T3253 Molecular Biology
EDTA Sigma Aldrich E1161 Molecular Biology
NaCl Sigma Aldrich S7653 Molecular Biology
UltraPure DNase/RNase-Free Water ThermoFisher Scientific 10977-023 Molecular Biology
10% SDS Sigma Aldrich 71736 Molecular Biology
KOAc Fisher-Scientific P1190 Molecular Biology
EtOH Fisher-Scientific 04-355-451 Molecular Biology
GeneJET Miniprep ThermoFisher Scientific K0503 Miniprep
PureLink HiPure Plasmid Maxipep kits ThermoFisher Scientific K210006 Maxiprep
BbsI NEB R0539S Restriction enzyme
Primers IDT-DNA PCR
pCFD4 Kornberg Lab DNA template and vector for gRNA
KAPA HiFi Hot Start- (Kapa Biosystems) Kapa biosystems KK2601 PCR
Q5-high fidelity Taq NEB NEB #M0491 PCR
Gibson Assembly Master Mix NEB NEB #E2611 DNA assembly
pBPnlsLexA:p65Uw Addgene DNA template for LexA amplification
Proteinase K ThermoFisher Scientific 25530049 Molecular Biology
2x PCR PreMix, with dye (red) Sydlab MB067-EQ2R Molecular Biology
Gel elution kit Zymo Research (Genesee Scientific) 11-300 Molecular Biology
TRI reagent Sigma-Aldrich Molecular Biology
Direct-zol RNA purification kits Zymo Research (Genesee Scientific) 11-330 Molecular Biology
OneTaq One-Step RT-PCR Kit NEB E5315S Molecular Biology
lexO-CherryCAAX Kornberg Lab Fly line
UAS-CD8:GFP Kornberg lab Fly line
btl-Gal4 Kornberg lab Fly line
MKRS/TB6B Kornberg lab Fly line
Confocal Microscope SP5X Leica Imaging expression pattern
CO2 station Genesee Scientific 59-122WCU fly pushing
Stereo microscope Olympus SZ-61 fly pushing
Microtube homogenizing pestles Fisher-Scientific 03-421-217 genomic DNA isolation
NanoDrop spectrophotometer ThermoFisher Scientific ND-1000 DNA quantification

DOWNLOAD MATERIALS LIST

References

  1. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, (2), 401-415 (1993).
  2. Lai, S. -L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nature Neuroscience. 9, (5), 703-709 (2006).
  3. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141, (3), 536-548 (2010).
  4. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  5. Du, L., Zhou, A., Patel, A., Rao, M., Anderson, K., Roy, S. Generation of a targeted expression system for branchless and characterization of novel cellular expression patterns of the gene in Drosophila. Developmental Biology. 427, (1), 35-48 (2017).
  6. Port, F., Chen, H. -M., Lee, T., Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 111, (29), E2967-E2976 (2014).
  7. Gratz, S. J., Rubinstein, C. D., Harrison, M. M., Wildonger, J., O'Connor-Giles, K. M. CRISPR-Cas9 Genome Editing in Drosophila. Current Protocols in Molecular Biology. 111, (1), 31.2.1-20 (2015).
  8. Doench, J. G., Hartenian, E., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  9. Port, F., Bullock, S. L. Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nature Methods. 13, (10), 852-854 (2016).
  10. Beumer, K. J., Trautman, J. K., Mukherjee, K., Carroll, D. Donor DNA Utilization During Gene Targeting with Zinc-Finger Nucleases. G3. 3, (4), Bethesda, Md. 657-664 (2013).
  11. Pfeiffer, B. D., Ngo, T. -T. B., et al. Refinement of tools for targeted gene expression in Drosophila. Genetics. 186, (2), 735-755 (2010).
  12. Lin, C. -C., Potter, C. J. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 203, (4), 1613-1628 (2016).
  13. Li, W., Köster, J., et al. Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. Genome Biology. 16, (1), 281 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics