Una estrategia eficiente para la generación de sistemas de transcripción binario tejidos específicos en Drosophila genoma editando

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Aquí, presentamos un método para generar sistemas de transcripción binario tejidos específicos en Drosophila sustituyendo el primer exón de la codificación de los genes con los conductores de la transcripción. El método basado en el CRISPR/Cas9 coloca una secuencia de transactivator bajo la regulación endógena de un gen sustituyó y en consecuencia facilita la expresión de transctivator exclusivamente en los patrones espacio-temporales de gene-específico.

Cite this Article

Copy Citation | Download Citations

Du, L., Zhou, A., Sohr, A., Roy, S. An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing. J. Vis. Exp. (139), e58268, doi:10.3791/58268 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Sistemas de transcripción binario son poderosas herramientas genéticas utilizadas para visualizar y manipular el celular destino y expresión genética en grupos específicos de células o tejidos en organismos modelo. Estos sistemas contienen dos componentes como líneas transgénicas. Una línea de conductor expresa un activador transcripcional bajo el control de promotores específicos de tejido/potenciadores y un puertos de línea de reportero/efector un gene de la blanco se coloca aguas abajo para el sitio de unión del activador de transcripción. Animales que ambos componentes inducen la transactivación específica de tejido de una expresión del gen objetivo. Precisa expresión espaciotemporal del gen en tejidos específicos es fundamental para la interpretación objetiva de la actividad del gene de la célula. Por lo tanto, es esencial el desarrollo de un método para generar líneas exclusivo controlador de células/tejidos específicos. Aquí presentamos un método para generar sistema de expresión específicos altamente específica de tejido mediante el empleo de un "cluster regularmente Interspaced corto palindrómico Repeat/CRISPR-asociados" (CRISPR/Cas)-basado en genoma edición técnica. En este método, la endonucleasa Cas9 está dirigido por dos quimérica guía RNAs (gRNA) a sitios específicos en el primer exón de la codificación de un gen en el genoma de Drosophila para crear roturas de doble cadena (DSB). Posteriormente, usando un plásmido donante exógeno que contenga la secuencia del transactivator, la maquinaria de reparación celular autónoma permite reparación dirigida de homología (HDR) del OSD, dando por resultado la eliminación precisa y reemplazo del exón con el transactivator secuencia. El transactivator noqueó en se expresa exclusivamente en las células donde el cis-elementos regulatorios del gen sustituyó son funcionales. El protocolo paso a paso detallado presentado aquí para generar un controlador transcripcional binario expresado en Drosophila fgf/servicios-produciendo células epiteliales/neuronales puede adoptarse para cualquier expresión del gene o tejido específico.

Introduction

La caja de herramientas genética para genes específicos se ha desarrollado bien en Drosophila, convirtiéndolo en uno de los mejores sistemas de modelo para investigar la función de genes implicados en una amplia variedad de procesos celulares. Sistemas de expresión binaria, como levadura Gal4/UAS (secuencia de activación upstream), primero fue adoptada para regiones reventado y gen potenciador de tejidos específicos en el modelo genético de Drosophila 1 (figura 1). Este sistema facilita el desarrollo de un gran número de técnicas tales como la regulación espacio-temporal de sobreexpresión de genes, regiones, golpe de gracia en determinados grupos de células, así como en la ablación de la célula, marca de celular, en rastreo de celulares y moleculares procesos en el embrión y los tejidos, rastreo de linaje y mosaico análisis durante el desarrollo. Un número del sistema binario de la transcripción, como la bacteriana LexALexAop (figura 1) y Q-sistema de Neurospora , son poderosas herramientas genéticas que son ampliamente utilizados en Drosophila, además el original sistema de Gal4/UAS dirigida gene expresión1,2,3.

Aquí, presentamos un método para generar sistema fiable expresión binaria de tejidos específicos mediante el empleo de una técnica de edición del genoma. Los recientes avances en la tecnología de edición CRISPR/Cas9 genoma han permitido oportunidades sin precedentes hacer cambios de genoma dirigido en una amplia gama de organismos. En comparación con las otras técnicas de edición de genoma disponible, el sistema CRISPR/Cas9 es barato, eficiente y confiable. Esta tecnología utiliza componentes del sistema inmune adaptativo bacteriano: una endonucleasa Cas9 de Streptococcus pyogenes que crea una rotura de doble cadena (DSB) y un ARN quimérico guía (gRNA), que guía la Cas9 a un sitio particular del genoma para específicas OSD4. Las células contienen la maquinaria para reparar el OSD mediante diferentes vías. No homólogos se terminan uniendo (NHEJ) lleva a pequeñas inserciones o eliminaciones interrumpir funciones de los genes, mientras que la reparación dirigida de homología (HDR) presenta un definida dirigida/deseable genómico knock-en/knock-out mediante un donador exógeno de HDR como una plantilla. La estrategia de reemplazo basada en HDR puede utilizarse eficientemente para generar un sistema altamente confiable expresión binaria de tejidos específicos, que puede superar todas las limitaciones de los métodos de trampa tradicional potenciador. Describimos un procedimiento paso a paso para la utilización de reparación HDR CRISPR/Cas9-basado en la generación de una línea de controlador binario de transcripción que se expresa bajo el control de la regulación transcripcional y postranscripcional endógena de un Drosophila gen. En este protocolo, se demuestra la generación de una línea de controlador específica para servicios (bnl) gen codificando una proteína familia FGF que regula la morfogénesis ramificación de la vía aérea traqueal epitelio5. En este ejemplo, el primer exón de la codificación del gene del bnl fue substituido por la secuencia de una secuencia de transactivator bacteriana LexA sin alterar cualquier endógeno cis-secuencias reguladoras del gene del bnl . Nos muestran que la estrategia genera una línea de conductor de bnl-LexA que spatiotemporally controla la expresión de un gen reportero colocado aguas abajo de LexAoperator (LexAop o LexO) exclusivamente en bnl- expresando las células epiteliales/mesenquimales/neuronal.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. diseñar y construir el gRNA Vector de expresión

  1. Para sustituir precisamente una región larga definida de un exón, utilice un gRNA doble enfoque6, en el cual cada gRNA puede apuntar específicamente a dos extremos de la región seleccionada de interés. Para obtener la precisa expresión espaciotemporal gene-específica del controlador, seleccione dos sitios de destino de gRNA dentro del primer exón de la codificación del gene.
  2. Para Drosophila melanogaster, seleccionar los sitios de destino de gRNA utilizando la herramienta de buscador de objetivo óptimo de flyCRISPR (http://tools.flycrispr.molbio.wisc.edu/targetFinder/). Otras herramientas de diseño disponibles CRISPR se pueden utilizar, incluyendo la herramienta de diseño optimizado de CRISPR (http://crispr.mit.edu), FlyCas9 (https://shigen.nig.ac.jp/fly/nigfly/cas9) y E-(www.e-crisp.org/E-CRISP).
    Nota: Los siguientes protocolos de gRNA diseño y clonación fue adoptado de los métodos previamente descritos6,7.
    1. Copie la secuencia real en la caja proporcionada en la herramienta en línea. Seleccione el más recientemente publicado Drosophila melanogaster genoma anotación versión, "r_6," en el menú desplegable de "Seleccione genoma." En el campo "Guía seleccione longitud (nt)," entrada "20." Seleccione para encontrar "Todos los objetivos CRISPR" y haga clic en «Buscar CRISPR objetivos».
    2. Evaluar todos los objetivos de la gRNA candidato poniendo "Máximo" por "Rigor" y "NGG sólo" para "PAM". Trate de seleccionar los sitios de gRNA sin ningún objetivo de potencial o un número mínimo de posibles fuera de objetivos. Uso la herramienta web descrito en Doench et al 2014 8 para seleccionar gRNAs con una puntuación de "bueno" de la actividad potencial.
    3. Al mismo tiempo, no Asegúrese de que polimorfismo de nucleótido único en los objetivos de gRNA en el genoma de la línea de mosca de padres seleccionado para la inyección (Por ejemplo, nos Cas9 en cromosoma X, BL # 54591). Seguir el protocolo descrito en Gratz et al 20157 para extraer el ADN genómico de la línea de mosca de los padres. Amplificación de PCR, aproximadamente, las regiones nt 500 – 1.000 utilizando cebadores que flanquean la secuencia de interés y una ADN polimerasa de alta fidelidad; secuencia-verificar los productos PCR amplificado.
  3. Para generar un vector de expresión de gRNA tándem, siga una ligadura independiente clonación protocolo6 para introducir dos secuencias protospacer en un vector de expresión de RNA de pCFD4. Tenga en cuenta que un vector de expresión multi-gRNA mejorada (pCFD5) ya está disponible donde se expresan tanto el sgRNAs de la U6:3 fuertes promotores9 (https://www.crisprflydesign.org). Use un método de ensamblaje de ADN a clonar los gRNAs en el vector de pCFD4.
    1. Diseñar y ordenar los iniciadores hacia adelantados y hacia atrás para introducir dos secuencias protospacer en el pCFD4 de vector de expresión de RNA (tabla 1A). Como se describió anteriormente6, el primer avance contiene la primera secuencia de protospacer flanqueada por las regiones correspondientes al promotor U6-1 y base del gRNA en pCFD4; el primer reverso contiene la secuencia del complemento reverso de la segunda protospacer flanqueado por las regiones correspondientes al gRNA core y el promotor U6-3 en pCDF4.
    2. Resuspender cartillas a 100 μM con agua destilada doble libre de RNasa y DNasa (ddH2O). Hacer una cartilla de concentración 10 μM trabajo. Utilice pCFD4 plásmido como plantilla y configurar la reacción de PCR utilizando una polimerasa de alta fidelidad y recomendados para PCR la reacción6.
    3. Para clonar el producto amplificado en pCFD4, digerir pCFD4 plásmido con enzimas de BbsI estableciendo la siguiente reacción: 2 – 5 μg de plásmido pCFD4, 5 μL de 10 x buffer de digestión, 1 μL de enzima de BbsI y ddH2O para hacer el volumen final de 50 μL. Mezcle el contenido de reacción suavemente golpeando ligeramente el tubo y recogiendo todas las gotitas dispersas de la pared del tubo a la parte inferior por un centrifugado breve. Incubar la mezcla de reacción a 37 ° C por 2 h.
    4. Ejecutar el producto PCR de paso 2 y el producto digerido desde el paso 3 en un gel de agarosa al 1%. Realizar la electroforesis para el tiempo suficiente para separar completamente las bandas de ADN. Corte el correcto tamaño de bandas de ADN en un trans-iluminador UV antes de purificar los productos esperados utilizando columna de elución de gel siguiendo las instrucciones del fabricante (véase Tabla de materiales). El producto PCR debe ser 600 bp y el plásmido linearizado pCFD4 debe ser ~6.4 kb 6.
    5. Configurar la reacción de la Asamblea de ADN en un tubo PCR, por las instrucciones del fabricante (véase Tabla de materiales).
    6. Transformar 2 μL del producto conjunto de bacterias competentes (DH5α o variedades similares con ΔrecA1, ΔendA1), placa de ampicilina (100 μg/mL) que contiene las placas de agar LB (LB/Amp) e incube a 37 ° C durante la noche. Tenga en cuenta que la mezcla de Asamblea de ADN podría ser tóxica para ciertas cepas de bacterias, pero diluyendo la mezcla de montaje puede reducir la toxicidad.
    7. Escoger 3-4 colonias resistentes a la ampicilina de la placa se incubó durante la noche, inocular la colonia de 3 mL LB con ampicilina μg/mL 100 y crecen las bacterias inoculadas en una coctelera de 37 ° C durante la noche. Extraiga el plásmido de las bacterias cultivadas durante la noche utilizando el kit de preparación para el mini plásmido siguiendo las instrucciones del fabricante (véase Tabla de materiales).
    8. La plásmidos con el imprimador universal T3 pantalla para los clones correcto que contiene la inserción de gRNA tándem de la secuencia. Establecer un stock de glicerol de bacterias transformadas con un gRNA pCFD4 de secuencia verificada en glicerol al 20% y almacenar en un congelador de-80 ° C para su uso futuro.

2. diseñar y construir al donante HDR

  1. Para genómica knock-in de una secuencia Gal4 o LexA , diseño de un donante HDR de doble cadena que contiene la secuencia del transactivator flanqueada por dos brazos de homología.
    1. Uso > 1,5 kb a la izquierda y brazos de homología derecha flanqueando el gRNA dirigidos a sitios. Brazos extendidos homología aumentan la eficiencia de HDR durante el proceso de reparación de 10.
    2. PCR amplifica los brazos de la homología de la DNA genómico (gDNA) extraído de la línea de mosca de padres seleccionada para la inyección (Por ejemplo, nos Cas9 (en el cromosoma X), BL # 54591). Utiliza una enzima de hot-start Taq-DNA polimerasa de revisión adecuada para la larga extensión PCR (véase Tabla de materiales). Verificar la secuencia.
  2. Para evitar el retargeting de gRNA al lugar geométrico ingeniería, diseño al donante de recambio de tal manera que los sitios de reconocimiento de gRNA se interrumpen por la secuencia exógena introducida.
    Nota: para evitar alterar el elementos cis-reguladores putativos, siempre seleccionar los sitios de reconocimiento de gRNA dentro de la región codificante del exón.
  3. Para la generación de un cassette de recambio, plan de la estrategia de la Asamblea de ADN para unir cuatro segmentos: los brazos de homología 5' y 3' la secuencia de ADN del medio transactivator exógena y la clonación lineal vector columna vertebral (por ejemplo, pUC19 u otro utilizan vectores de clonación). Siguiendo la pauta del fabricante para el montaje de la DNA (véase tabla de materiales), diseño de los cebadores adecuados para la amplificación por PCR y montaje de cada segmento. Resuspender cartillas a 100 μM con ddH2O. hacer una cartilla de concentración 10 μM trabajo. Usar la polimerasa de alta fidelidad para todas las reacciones de PCR. Siga el siguiente protocolo:
    1. PCR amplifica un cassette de expresión de Gal4 o LexA de un vector disponible (por ejemplo, nls-LexA:p65; la plásmidos de expresión de Gal4/LexA/QF2 ideal se pueden encontrar y obtenida de recursos comunes como Addgene) utilizando el cartillas enumeradas en la Tabla 1B.
      1. Para conservar todas las regulaciones originales transcripcionales y postranscripcional del exón sustituyó en la expresión de la secuencia de ADN del transactivator, diseño de la cinta de tal manera que el alelo genómico editado expresaría un mRNA quimérico de la transactivator y el gen. Preservar el extremo 5' y 3' del exón dirigido a retener cualquier señal que empalma.
      2. Incorporar una T2A auto Hendedoras secuencia del péptido entre el residuo 5' codificación exón y la secuencia del transactivator para evitar la traducción a una proteína quimérica. Añadir un codón de parada de traducción después de la secuencia del transactivator exógeno (figura 5).
    2. PCR amplifica los brazos de la homología de la DNA genómico (gDNA) extraído de la línea de mosca de padres seleccionada para la inyección (Por ejemplo, nos Cas9 (en el cromosoma X), BL # 54591) usando los cebadores enumerados en la Tabla 1B. Usar la polimerasa de alta fidelidad para todas las reacciones de PCR utilizando los sistemas como sigue: 5 μL de 5 x Buffer de reacción, 0.5 μL de 10 mM de dNTPs, 1.25 μL de 10 μM adelante cartilla, 1.25 μL de 10 μM cartilla reversa, 0.5 μL de DNA de la plantilla, 0,25 μL de polimerasa de la DNA alta fidelidad , 16,25 μL de ddH2O.
    3. Utilice el vector linearizado clonación como pUC19. Ahora hay un número de vectores de donantes. Ver una lista completa en el siguiente sitio web-http://flycrispr.molbio.wisc.edu.
    4. Ejecutar los productos PCR en un gel de agarosa al 1%. Realizar la electroforesis durante suficiente tiempo asegurar una clara separación de la banda deseada de las bandas de no específicos no deseadas (si existe). Gel-purificar los fragmentos de ADN esperados. Medir la concentración de cada fragmento de ADN purificado usando un espectrofotómetro.
    5. Configurar la reacción de la Asamblea de ADN siguiendo las instrucciones del fabricante. Mezclar los fragmentos lineal de vectores y destino clonación del paso 3 y paso 4 en la siguiente reacción: 1 μL de linear vector (50 ng/μL), 2 – 3 veces exceso de cada fragmento de destino, 10 μL de 2 x mezcla principal de la Asamblea de ADN, la clonación llevar el volumen final de reacción de 20 μL con ddH < C21 > 2O. Incubar la mezcla de reacción durante 1 hora a 50 ° C.
    6. Transformar 2 μL del producto de la Asamblea en bacterias competentes, placa en placas de agar LB/Amp con 100 ampicilina μg/mL. También, Añadir X-Gal + IPTG en la placa para azul/blanco cribado.
    7. Tomar 3-4 colonias blancas de la placa se incubó durante la noche, inocular la colonia de 3 mL LB con ampicilina μg/mL 100 y crecen a 37 ° C durante la noche en una coctelera Boston. Manual del extracto de plásmido de las bacterias cultivadas durante la noche utilizando el kit de preparación para el mini plásmido siguiendo el fabricante (véase Tabla de materiales).
    8. Pantalla de la Colonia positivo por PCR o restricción de la digestión.
    9. Secuencia de verificar la región donante HDR del plásmido final. Guardar una acción bacteriana transformada con los clones correcto en 20% de glicerol a-80 ° C para inoculación de futuro.

3. embrión inyección, mosca genética y proyección para la edición del genoma

  1. Preparar el gran vector de expresión de pureza gRNA libre de endotoxinas, así como el plásmido donante HDR usando un plásmido maxiprep kit (véase Tabla de materiales).
  2. Conjuntamente inyectar el plásmido de expresión de gRNA (100 ng/μL) y el donante de recambio (500 ng/μL) en la línea germinal de Enmiendas Cas9 embriones6. Nota: utilizamos un servicio comercial para la inyección, pero este procedimiento puede realizarse en el laboratorio también.
  3. La mosca genética y proyección (figura 2 y figura 3):
    1. Cuando los embriones inyectados se convierten en adultos, cruzado cada solo G0 vuela Vuela balanceador. Seleccione el adecuado balanceador para el cromosoma con el alelo específico.
    2. Anestesiar la F1 prole de G0 cada cruz en una almohadilla de CO2 y elegir al azar los machos de 10-20 bajo un estereomicroscopio. Cruzarlos individualmente a las hembras de balanceador como se muestra en la figura 3.
    3. Cuando la escotilla de larvas de F2, recoger el padre de F1 único de cada cruz y extraer gDNA usando el única mosca genomic ADN preparación protocolo:
      1. Preparar el tampón de extracción gDNA: 10 mM Tris-Cl de pH 8.2, EDTA 1 mM, 25 mM NaCl, almacenar a temperatura ambiente. Prepare 20 mg/mL de proteinasa K solución y almacenar en el congelador.
      2. Colocar cada mosca en un tubo de microcentrífuga de 1,5 mL y etiquetar el tubo. Mantener en el congelador de-80 ° C durante la noche.
      3. Preparar un volumen de trabajo fresca del gDNA tampón de extracción que contiene la concentración final de 200 μg/mL de proteinasa K.
        Nota: No use un tampón antiguo para este paso.
      4. Aplastar cada mosca para 10 – 15 s con una punta de pipeta con 50 μL de aplastar las buffer sin suministro del líquido. Dispensar buffer restante en el tubo y mezclar bien. Incubar a 37 ° C durante 20-30 min.
      5. Poner tubos en el bloque de calor de 95 ° C durante 1 – 2 minutos inactivar la proteinasa K.
      6. Desactivación por 5 min a 10.000 x g. Guarde la preparación en 4 ° C para su posterior análisis de la polimerización en cadena.
  4. Utilizar el mismo método para preparar gDNA de una mosca nos Cas9 , que sirve como control negativo. Realizar pantallas PCR basado en tres pasos para identificar el correcto extremos del"hacia fuera" HDR (figura 2, figura 5) usando gDNA de cada macho F1 como una plantilla de5. Use 1 μL de la preparación de ADN en el sistema siguiente de la reacción de PCR: 10 μL de 2 x PCR Master Mix con tinte, 1 μL de cada cebador (10 μM), 1 μL de plantilla de la DNA y 7 μL de ddH2O.
  5. Como se muestra en la figura 5A, realizar PCR utilizando primers fwd1 y rev1 a pantalla la existencia de la inserción o reemplazo; realizar PCR utilizando primers fwd2 y rev2 para verificar la inserción o reemplazo de 3' región; realizar PCR utilizando primers M13F y rev3 para revisar los "extremos en" HDR (tabla 1).
  6. Mantener las líneas de mosca con el HDR extremos de salida confirmada y establecer acciones equilibradas de la generación F2. Outcross a las moscas balanceador otra vez para quitar cualquier mutaciones no deseadas en otros cromosomas.
  7. Preparar gDNA de alta calidad de las acciones establecidas para la amplificación de la polimerización en cadena larga (> 800 – 1.000 nt) amplicones con Taq polimerasa de alta fidelidad y secuencia verificar los amplicones obtenidos de las regiones genómicas ingeniería. Alternativamente, utilice extracto crudo gDNA como se describe anteriormente para amplificar más corta (< 800 nt), superposición de productos de la PCR para validar de secuencia el genoma editado. Utilizar el siguiente protocolo para preparar el ADN genómico de la Drosophila de buena calidad:
    1. Poner sobre 25 moscas adultas en un tubo de microcentrífuga de 1,5 mL y congelar en el congelador de-20 ° C o -80 ° C durante al menos 1 hora.
    2. Añadir 250 μL de solución A (pH 9.0 Tris HCl 0.1 M, EDTA 0,1 M, SDS 1%).
    3. Homogeneizar las moscas mediante las homogeneización majas en tubos de microcentrífuga y poner el tubo en hielo.
    4. Incubar a 70 ° C por 30 minutos.
    5. Añadir 35 μL de KOAc (5 M), agitar y mezclar bien, pero hacer no agitar con vortex.
    6. Incubar en hielo durante 30 minutos.
    7. Vuelta a 12.000 x g durante 15 minutos.
    8. Con una micropipeta de 1 mL, cuidadosamente transferir sólo el sobrenadante a un tubo nuevo, dejando atrás cualquier precipitado o interfase.
    9. Añadir 150 μL de isopropanol para el sobrenadante. Mezclar suavemente por inversión.
    10. Centrifugado a 10.000 x g durante 5 minutos.
    11. Cuidadosamente Quite el sobrenadante y dejar el sedimento en el tubo.
    12. Lavar el pellet con 1 mL 70% EtOH.
    13. Vuelta a 12.000 x g durante 5 minutos.
    14. Eliminar el sobrenadante. Secar el pellet por 15 a 20 min. No secar sobre el sedimento.
    15. Disolver el sedimento en 100 μL de ddH2O.
    16. Uso de alta fidelidad de la polimerasa de la DNA conveniente para productos largos (> 800 bp) para amplificar la región editada completa. Lo ideal es tomar dos cartillas fuera el cassette insertado para amplificar la región genomic. Gel de purificar el producto PCR, y como se describió anteriormente, la secuencia de verificar el producto con múltiples cebadores superpuestos.
  8. Validar los patrones de expresión espaciotemporal correcta de tejidos o embriones disecados de las líneas de mosca dirigidos:
    1. Realizar RT-PCR del ARN total para verificar la expresión del producto de mRNA híbrido (tabla 1).
    2. Llevar a cabo un hibridación en situ del producto de interés en los tejidos larval/embrión para validar la expresión mRNA.
    3. Pantalla para los patrones de expresión espacio-temporal específica de tejido precisa entre las líneas de salida de extremos secuencia verificada, cruzar las líneas editadas obtenidos para el conductor de la expresión binaria con el LexO- GFP o LexO- RFP (para LexA driver) line (disponible en los centros de población de Bloomington) y observe la LexA o Gal4 impulsado por la expresión del gen reportero en los tejidos de larvas y adultos de embrión, bajo un microscopio de fluorescencia.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Este protocolo fue utilizado con éxito para generar una expresión binaria específica reportero sistema específica para bnl expresando células5. El cis-elementos reguladores (CREs) que controlan la expresión espaciotemporal complejo bnl no caracterizan. Por lo tanto, para lograr expresión espacio-temporal bajo el control de la secuencia de regulación endógena bnl , solamente el primer exón codificación de bnl fue diseñado para ser reemplazado con la secuencia de la bacteriana LexA transactivator. Se seleccionó una cinta mejorada nls LexA::p65 conocida por proporcionar una óptima expresión en Drosophila .

La estrategia de reemplazo para generar un quimérico nls-LexA:p65-bnl mRNA bajo control transcripcional y postranscripcional endógeno. Este mRNA quimérico contiene un intacto bnl 5' UTR, el extremo 5' y extremo 3' de la edición bnl codificación exón (primer exón) y las aguas abajo completa bnl intrones y exones. Para conservar el bnl específicas de RNA empalme del exón sustituyó, se conservaron pequeños extremos 5' y 3' del exón codificación sustituyó. Sin embargo evitar la síntesis de una proteína quimérica de Bnl fusionado a nls -LexA: p65, una T2A auto Hendedoras secuencia de péptido fue incorporado entre el residual 5' bnl codificación región y ATG de nls-LexA:p65. También, un codón de parada de traducción fue agregado después de la nls-LexA:p65 secuencia para evitar la traducción de un truncado Bnl proteína5 (figura 4 y figura 5).

Se utilizó un donante de reemplazo que contiene todas estas características, que tenía el T2A-nls-LexA:p65 brazos de homología de secuencia y 2 kb 5' y 3' y 1,8 kb -. Brazos largos homología fueron utilizados para HDR eficaz y la inserción de un gran fragmento de ADN en el sitio de reparación (T2A-nls-LexA:p65 es de 1,8 kb) (figura 5A).

Dos gRNAs fueron utilizados para crear consejos escolares distritales en las posiciones definidas para eliminar la mayor parte del primer exón codificación de bnl. Dos gRNAs que coinciden todos los criterios descritos en la sección 1.3 (secuencia del PAM subrayada) fueron:
gRNA1: TGTATCTGCGATGCCCCTCATGG
gRNA2: ATCCTTCAGATATTGCGGGATGG

Ambos sitios de reconocimiento de gRNA fueron interrumpidas en el donante de recambio por los exógenos T2A-nls-LexA:p65 secuencia, que es la forma más fácil de evitar retargeting de gRNAs al lugar geométrico de ingeniería. Fueron las secuencias de reconocimiento de gRNA interrumpida en el donante de reemplazo (las secuencias exógenos que alteraron la gRNA sitios de reconocimiento en cursiva):
gRNA1: TGTATCTGCG -GGCTCCGGCGAAGGAC...
gRNA2:... AAAAACTCGTTTAGA- CGGGATGG

El vector de expresión de gRNA pCFD4 que contienen estos gRNAs, junto con el donante de reemplazo, fue conjuntamente inyectar en la línea germinal de embriones nos Cas9 . Posteriormente, se siguió el protocolo descrito aquí para detectar la sustitución prevista (figura 5B, C). Alrededor del 67% de inyectado G0 animales fueron fértil. Y 56% de los G0s fértiles fueron los fundadores, que dieron lugar a progenie de HDR-positivo. Entre la progenie F1 comprobada, alrededor del 23% eran positivo para el éxito HDR, y el 73% de lo HDR positivo eran "extremos-out" (tabla 2). Desde la primera codificación exón de bnl fue "noqueado", todas las líneas HDR fueron encontradas para ser homocigóticos letal y las acciones se mantuvieron en balanceadores.

La generación de un quimérico mRNA LexA-bnl en las células fue validada por análisis de RT-PCR (figura 5). Para verificar si los obtenidos bnl-LexA líneas fueron expresadas en el modelo de expresión endógena bnl , cada "extremos" HDR línea fue cruzada a LexO-mCherryCAAX moscas transgénicas5y el patrón de expresión del periodista fue examinado en la progenie embriones y larvas. 42 de 46 líneas mostraron expresión espacio-temporal precisa coherente con las previamente divulgados bnl patrones5 (figura 6). Cuatro líneas demostradas ambos patrones de expresión débil o no específicos. Predecimos que estas líneas podrían haberse acumulado las mutaciones, que tenemos que verificar con análisis de secuencia completa. Juntos estos resultados confirmados podría empleada con éxito la estrategia de sustitución de exón HDR-mediada para generar un sistema de expresión binaria específica de un gen. La herramienta puede utilizarse con éxito para expresar reportero o genes ectópicos en los patrones espacio-temporales del gene del bnl .

Figure 1
Figura 1: esquema de un sistema de transcripción binario para la expresión del gen objetivo. Un transactivatorGAL4 o LexA, expresado bajo el control de cis-unidades de elementos reguladores (CREs) de un gen, un transgen de efector situado aguas abajo de los sitios de unión de transcripción específicos (UAS de Gal4 o LexAop de LexA). Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2: un resumen de flujo de trabajo de edición para generar un sistema binario de la transcripción genómica CRISPR/Cas9-mediada. Se indica la duración aproximada para cada paso. Haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: ilustración de CRISPR investigación y genética Cruz esquema para el establecimiento de líneas de mosca genoma editado. En cruces genéticas, R está parado para el alelo editado que está en el cromosoma 3rd . MKRS (Señora del Tp (3; 3), M (3) 76A ry de kar [1] [1] [2] Sb [1]), es un marcador del cromosoma 3rd ; TM6B (En TM6B (3LR), PFEA [Hu] e [1] Tb[1]) es un balanceador de cromosoma 3rd . Las poblaciones de mosca genoma editado son verificadas por PCR amplifica las regiones de objetivo de interés de la DNA genomic extraída de moscas generación F2 o F3 y determinar los productos PCR de la secuencia. Haga clic aquí para ver una versión más grande de esta figura.

Figure 4
Figura 4: generación del cassette de recambio por Asamblea ADN. Un dibujo esquemático que representa la amplificación por PCR y montaje de diferentes productos de la PCR (a, b y c) en el vector del donante (d) utilizando un método de ensamblaje de ADN. Haga clic aquí para ver una versión más grande de esta figura.

Figure 5
Figura 5: Generación de LexA de bnl por el reemplazo del exón CRISPR/Cas9-mediada. (A) diagrama esquemático dibujo que representa la estrategia de CRISPR/Cas9 mediada HDR para el reemplazo del exón en el locus de la bnl . Caja - exón; línea-intrón; donantes de recambio (pDonor -bnl:LexA) y dos posibles resultados del HDR fueron demostrados. PDonor -bnl:LexA tenía las siguientes características: (1)T2A-nls-LexA:p65 (~1.8kb) secuencia flanqueada por 2 kb y 1,8 kb largos brazos de homología (líneas discontinuas), (2) un T2A auto Hendedoras péptido entre el exón de terminal bnl de N residual y la NLS-LexA:p65y (3) un codón de parada de traducción (rojo *) después de la nls-LexA:p65 secuencia. El producto HDR retuvo el control transcripcional y postranscripcional de la bnly el LexA: proteína p65 se espera producir en el mismo patrón como endógeno Bnl. pequeño negro las flechas muestran los sitios de unión relativa (no en de la escala) de los iniciadores de la PCR (tabla 1) utilizados para la proyección de 3 pasos o validación de RT-PCR. (B) el gel de agarosa Fotos mostrando resultados del examen de PCR de 3 pasos. Se muestran los productos PCR amplificados de la DNA genomic de cuatro líneas HDR extremos-hacia fuera éxito; control, el ADN genómico de CNCnegativo-Cas9 línea parental; control positivo, pDonor -bnl:LexA plásmido; M, marcador (escala de ADN SL2K). (C) un ejemplo del gel de proyección que muestra el esperado producto PCR utilizando primers M13F y rev3 extremos en líneas; 7 M8 y M9-6 son dos extremos en las líneas; controles positivos y negativos, al igual que en B; M, marcador (escala de NEB 1 kb ADN). (D) análisis de RT-PCR de ARN total de bnl-LexA y el control de Cas9 nos vuela. Primer avance se une a una región específica de LexA , cartilla reversa se une a una región del exón aguas abajo bnl ; ~ banda de amplificación de bp (base-pair) 440 (*) fue detectada de RT-PCR en bnl-LexA mRNA, pero no desde el control de RNA. M, marcador de bp 100 (NEB). Adaptado de las figuras 2 y S1 en Du et al. 20175. Haga clic aquí para ver una versión más grande de esta figura.

Figure 6
Figura 6: Validación de expresión tejido específica y condicionada bnl-LexA en diversos tejidos. Expresión de bnl (A-d) (rojo) en diferentes tejidos larvales, con el btl expresando las células se muestra en verde. (A, A') Fuente de bnl ala disco por delante de la creciente primordio del saco de aire (ASP). (B, C) expresión de BNL en TR5 transversal conectivo (TC) (B) y rama dorsal TR2 (DB) (C). (D) expresión de bnl en discos genitales. (E-J) Expresión dinámica bnl (rojo) en modelar embrionario rama traqueal (verde); Flechas pequeñas, cinco fuentes de bnl que rodea el placode traqueal en fase 10. Genotipos: A-J; btl-Gal4, UAS- CD8GFP / +; bnl-LexA, LexO- CherryCAAX /+. (K-L ") La hipoxia inducida por el perfil de expresión de bnl-LexA en los discos del ala y asociados TR2 metamere traqueal (TC, DB, dorsal tronco-DT). Genotipo: bnl-LexA, LexO -CherryCAAX / +. (K) los discos de control de ex vivo cultivan órganos sin CoCl2. Discos de ala (L-L") (L, L') y la tráquea (DT, (L'')) de órganos cultivados ex vivo con CoCl2 inducida por hipoxia. Estrella, ectópica expresión inducida por hipoxia. Barras de escala = 30 μm; 50 μm (K-L"). Adaptado de la figura 3 en Du et al. 20175. Haga clic aquí para ver una versión más grande de esta figura.

GRNA a. clonación y secuenciación de
BNL-lexA gRNA fwd TATATAGGAAAGATATCCGGGTGAACTTCg TGTATCTGCGAT
GCCCCTCAGTTTTAGAGCTAGAAATAGCAAG
BNL-lexA gRNA rev ATTTTAACTTGCTATTTCTAGCTCTAAAAC TCCCGCAATATCTGAAGG
ENcGACGTTAAATTGAAAATAGGTC
Cartilla de T3 utilizada para secuenciación CAATTA ACCCTCACTAAAGG-3'
Nota: nucleótidos subrayadas recuecen promotor U6 o gRNA base sobre el vector de pCFD4, la minúscula g/c fue agregado para facilitar la transcripción del promotor dependiente de U6
Construcción de donantes B. HDR
BNL N-F_pUC19 AATTCGAGCTCGGTACtgtggtctttgaggctggaac
BNL-lexA-N-R tCCGcaagtCagtAGgctgccgcgtccttcgccggaGCC CGCAGATACAAGGCCC
C
lexA-F CTactGacttgCGGaGAtGTcGAaGAGAACCCtGGCCCt ATGCCACCCAA
GAAGAAGC
lexA-R CTAAACGAGTTTTTAAGCAAACTCACTC
BNL lexA-C Fwd TAAAAACTCGTTTAGACGGGATGGCGTTGTCAAC
BNL C-R_pUC19 GCCAAGCTTGCATGCCtcgcataattgccgcctgg
Nota: nucleótidos en capital traslapo con vector pUC19 para Gibson, nucleótidos subrayados fueron la proyección de la secuencia para la adición del péptido de T2A.
C. secuenciación y detección de HDR
BNL-lexA scr fwd1 GTGGCGCACGCCCAATAAAC
BNL-lexA scr rev1 GATCCCAGCCAATCTCCGTTG
BNL-lexA scr fwd2 CAACGGAGATTGGCTGGGATC
BNL-lexA scr rev2 CTGGCCAACTGTAGGGAAGTC
extremos en cheque rev3 GCAATGTTATGCAATGCGTTGAC
BNL-lexA seq fwd3 CACTTGTCGCCCATATTGATACAATTG
Nota: Estos iniciadores se utilizaron para la PCR de detección y secuenciación, la ubicación aproximada de sitios de unión del cebador es como se ve en la figura 5A fwd1-2 y 3 rev1.
D. Análisis de RT-PCR de
RT-f GATATGGATTTCTCCGCTTTGCTG
RT-r CCATGCAGAGATACAGGCAAGTG

Tabla 1: cartillas utilizan en este estudio. (A) cartillas de gRNA vector de expresión de la clonación y la secuenciación. (B) cartillas para clonar plantilla de donantes HDR. (C) bases para la selección y secuenciación de los productos HDR. (D) cebadores utilizados para la verificación de la RT-PCR del quimérico producto de mRNA de LexA-bnl .

genotipo HDR % de la tarifa de transmisión (# rendimiento de HDR G0 / # fértil G0) # HDR-positivos F1 / # F1 total comprobado (%) # "extremos-out" HDR / # total IDH (%)
BNL-LexA 56 (15/27) 23 (60/259) 73 (46/60)

Tabla 2: eficacia de HDR CRISPR/Cas9-mediada. La tasa de transmisión de HDR se calcula como el # de HDR-rendimiento G0 / # de G0 fértil total. % Éxito de HDR se calcula como el # de HDR-positivos F1 / # de F1 total proyectado. "Extremos-out" % se calcula como el número de "salida de extremos" HDR / # de HDR positivo total.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Tradicionalmente, las trampas de potenciador de Drosophila fueron generadas por dos métodos diferentes. Una de las formas incluye inserción al azar de un conductor (ej., Gal4) secuencia en el genoma por transposición (e.g., transposición de elemento P)1 . Por otra parte, las secuencias de controlador pueden colocarse bajo el control transcripcional de una región enhancer putativos/promotor en una construcción del plásmido, que luego se integrarían en un sitio ectópico del genoma3,11. Aunque estos métodos han generado una gran piscina de Gal4 o trampas de potenciador de LexA para Drosophila, tienen varias limitaciones. La inserción al azar del genoma mediada por el elemento P puede interrumpir la actividad reguladora de crítica cis-secuencias reguladoras. Debido a la transposición al azar en el genoma, expresión transactivator puede presentar patrones de múltiples genes vecinos. Por otro lado, un conocimiento previo de las secuencias cis-reguladoras de un gen es necesario para una construcción de plásmido de reforzador de la trampa. También hay un límite a la longitud de una secuencia que puede ser reproducida y probada en la construcción de un plásmido. Aislamiento y clonación sólo un fragmento parcial de ADN fuera del contexto genómico endógeno no pueden reproducir un patrones de expresión génica específica completa. Por ejemplo, la línea de bnl-Gal4 (NP2211), que se generó mediante la inserción de elemento P de una trampa de enhancer Gal4 elemento justo por delante del gen de la bnl , no reproducir completamente los patrones de expresión específica de genes en el embrión5 . Por lo tanto, en tales contextos, aplicaciones técnicas, tales como hackear (homología asistida CRISPR knock-in), que puede convertir el Gal4 existentes líneas en otra LexA o Q-system basado en controlador línea12 podría no ser muy útil. Para superar estas limitaciones, aquí, hemos descrito un método eficaz y alternativo para la generación de sistemas de expresión binaria por la edición del genoma. En este método, el primer exón de la codificación de un gene se intercambia con el transactivator (eg., LexA o Gal4) la secuencia de modo que la expresión de la controlador de transcripción exclusivamente imita los patrones espacio-temporales de la expresión génica. Aunque la estrategia y protocolos descritos aquí fueron optimizados para bnl -expresión, el método puede ser adoptado fácilmente por otros genes.

Determinar un sitio de la inserción dentro de la región de genes específicos es el paso más crítico en esta estrategia experimental. El método que presentamos fue diseñado para retener todo el original transcripcional así como las regulaciones postranscripcional de la bnl gen5. Por lo tanto, planea eliminar la mayor parte de la primera codificación exón del gene de bnl y reemplazarlo con el cassette de LexA . El reemplazo fue planeado de tal manera que el alelo editado expresa un híbrido LexA-bnl mRNA de la traducción y transcripción endógena comenzar sitio de bnl conservando todas las regiones intrónicas. Sin embargo, el híbrido mRNA fue diseñado para producir única proteína LexA pero no Bnl. Nos demostró que la estrategia con éxito había generado una LexA bnl /LexO-basado sistema de la transcripción y que el sistema pudiera informar con precisión los patrones de expresión dinámica, spatiotemporal bnl (figura 5)5 . Una limitación de este proceso es la letalidad homocigótica en las líneas de Drosophila el gen objetivo es esencial para la supervivencia. Además, uso de una estrategia dual gRNA puede aumentar la posibilidad de editar fuera del objetivo. Una estrategia alternativa puede ser empleada para evitar estos problemas. En esta estrategia, una cinta de LexA o Gal4 puede colocarse derecho en el sitio de inicio ATG del gene substituido y una T2A auto Hendedoras secuencia de péptido puede colocarse entre el casete de LexA/Gal4 y el inicio del exón intacto de la codificación de el gene de la blanco. Se espera que esta estrategia produce un mRNA quimérico que se puede traducir en el transctivator y el producto génico funcional. Tal diseño posiblemente podría reducir la probabilidad de mortalidad homocigótica. En esta estrategia, una gRNA sola es suficiente para la edición del genoma. Sin embargo, en presencia de dos copias de genes funcionales, expresión de las variantes de la proteína transgénica conducido por el conductor de Gal4/LexA (eg., LexA de bnl por expresión de LexO- Bnl: GFP fusiones o Bnl proteínas con canceladuras) no proporcionará información de la funcionalidad de las proteínas variantes.

Una limitación de la estrategia edición genómica es el laborioso proceso de focalización y la edición de un solo gen en un momento. Sin embargo, la simplicidad y la eficiencia del método de edición de genoma CRISPR/Cas9-mediada han revolucionado la específica genómica knock-en/knock-out y tecnología de reemplazo que puede ser adoptada fácilmente en cualquier laboratorio estándar establecido. En los últimos años, Drosophila investigadores han desarrollado herramientas convenientes para la edición del genoma que pueden emplearse para ampliar los conjuntos de herramientas genética esencial para la comprensión biológica fundamental procesos7,13 . El genoma de edición y selección de procesos descritos aquí es relativamente más rápido y tarda aproximadamente dos meses en comparación con cualquier otro reemplazo basados en la recombinación homóloga. Resultados edición del genoma exitosa y eficiente, es importante seguir varios pasos técnicamente críticos: 1) cada gRNA es seleccionado por el máximo rigor y actividad sin potencial objetivo; 2) el donante HDR contiene ~1.5 kb homología brazos flanqueando el gRNA dirigidos a sitios. Más largos brazos de homología (1.8 – 2 kb) se utilizan para aumentar la eficiencia del HDR cuando un fragmento de ADN exógeno grande necesita ser insertado; 3) el donante HDR está diseñado para ser libre de los sitios de reconocimiento de gRNA evitar retargeting de gRNA al lugar geométrico diseñado; y 4) un elaborado plan infalible y coordinación de la sincronización de cruces genéticos con proyección basados en la PCR 3 pasos para seleccionar una "extremos" HDR línea.

A diferencia de la transposición aleatoria o construcciones potenciador clonados, la estrategia y protocolos que Describimos aquí asegura la generación de un objetivo exclusivamente sistema binario transcripción de genes específicos. Puesto que la expresión del controlador sustituye un exón gen nativo, expresión génica específica del conductor también es versátil y se espera que imitan patrones de expresión genética bajo condiciones de desarrollo, metabólicos y fisiológicos los5. Expresión génica/celular-específica es el criterio más deseable de todas las líneas del controlador binario cuando se utilizan en diferentes células y métodos de la biología del desarrollo. Por ejemplo, gene-específica expresión de genes del reportero por un conductor de transcripción facilita análisis fiable del linaje de las células que expresan el gene de la blanco. También permite la proyección de imagen vivo y seguimiento de la expresión espaciotemporal, la migración y la reorganización de las células durante el desarrollo. Para investigar los eventos celulares y moleculares durante la morfogénesis de tejidos, Gal4 o LexA por sobreexpresión/regiones de varios transgenes y silenciación de genes knock-down en conjuntos específicos de las células son esenciales. Sistema de expresión específicos altamente específica proporciona una imparcial análisis e interpretación de los resultados. Por lo tanto, CRISPR/Cas9 basado en objetivos de un exón del gene y su reemplazo con una secuencia del transactivator proporciona una mejor alternativa para la generación de sistemas de expresión de genes específicos altamente específico.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen conflictos de interés divulgar.

Acknowledgments

Agradecemos Dr. F. Port, Dr. K. o ' Connor-Giles y el Dr. S. Feng debates sobre estrategia CRISPR; Dr. T.B. Kornberg y el centro de Stock de Bloomington de reactivos; Instalaciones de centrales de UMD; y el financiamiento de NIH: R00HL114867 y R35GM124878 al SR.

Materials

Name Company Catalog Number Comments
X-Gal/IPTG Gentrox (Genesee Scientific) 18-218 cloning
LB-Agar BD Difco BD 244520 cloning
Tris-HCl Sigma Aldrich T3253 Molecular Biology
EDTA Sigma Aldrich E1161 Molecular Biology
NaCl Sigma Aldrich S7653 Molecular Biology
UltraPure DNase/RNase-Free Water ThermoFisher Scientific 10977-023 Molecular Biology
10% SDS Sigma Aldrich 71736 Molecular Biology
KOAc Fisher-Scientific P1190 Molecular Biology
EtOH Fisher-Scientific 04-355-451 Molecular Biology
GeneJET Miniprep ThermoFisher Scientific K0503 Miniprep
PureLink HiPure Plasmid Maxipep kits ThermoFisher Scientific K210006 Maxiprep
BbsI NEB R0539S Restriction enzyme
Primers IDT-DNA PCR
pCFD4 Kornberg Lab DNA template and vector for gRNA
KAPA HiFi Hot Start- (Kapa Biosystems) Kapa biosystems KK2601 PCR
Q5-high fidelity Taq NEB NEB #M0491 PCR
Gibson Assembly Master Mix NEB NEB #E2611 DNA assembly
pBPnlsLexA:p65Uw Addgene DNA template for LexA amplification
Proteinase K ThermoFisher Scientific 25530049 Molecular Biology
2x PCR PreMix, with dye (red) Sydlab MB067-EQ2R Molecular Biology
Gel elution kit Zymo Research (Genesee Scientific) 11-300 Molecular Biology
TRI reagent Sigma-Aldrich Molecular Biology
Direct-zol RNA purification kits Zymo Research (Genesee Scientific) 11-330 Molecular Biology
OneTaq One-Step RT-PCR Kit NEB E5315S Molecular Biology
lexO-CherryCAAX Kornberg Lab Fly line
UAS-CD8:GFP Kornberg lab Fly line
btl-Gal4 Kornberg lab Fly line
MKRS/TB6B Kornberg lab Fly line
Confocal Microscope SP5X Leica Imaging expression pattern
CO2 station Genesee Scientific 59-122WCU fly pushing
Stereo microscope Olympus SZ-61 fly pushing
Microtube homogenizing pestles Fisher-Scientific 03-421-217 genomic DNA isolation
NanoDrop spectrophotometer ThermoFisher Scientific ND-1000 DNA quantification

DOWNLOAD MATERIALS LIST

References

  1. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, (2), 401-415 (1993).
  2. Lai, S. -L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nature Neuroscience. 9, (5), 703-709 (2006).
  3. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141, (3), 536-548 (2010).
  4. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  5. Du, L., Zhou, A., Patel, A., Rao, M., Anderson, K., Roy, S. Generation of a targeted expression system for branchless and characterization of novel cellular expression patterns of the gene in Drosophila. Developmental Biology. 427, (1), 35-48 (2017).
  6. Port, F., Chen, H. -M., Lee, T., Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 111, (29), E2967-E2976 (2014).
  7. Gratz, S. J., Rubinstein, C. D., Harrison, M. M., Wildonger, J., O'Connor-Giles, K. M. CRISPR-Cas9 Genome Editing in Drosophila. Current Protocols in Molecular Biology. 111, (1), 31.2.1-20 (2015).
  8. Doench, J. G., Hartenian, E., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  9. Port, F., Bullock, S. L. Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nature Methods. 13, (10), 852-854 (2016).
  10. Beumer, K. J., Trautman, J. K., Mukherjee, K., Carroll, D. Donor DNA Utilization During Gene Targeting with Zinc-Finger Nucleases. G3. 3, (4), Bethesda, Md. 657-664 (2013).
  11. Pfeiffer, B. D., Ngo, T. -T. B., et al. Refinement of tools for targeted gene expression in Drosophila. Genetics. 186, (2), 735-755 (2010).
  12. Lin, C. -C., Potter, C. J. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 203, (4), 1613-1628 (2016).
  13. Li, W., Köster, J., et al. Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. Genome Biology. 16, (1), 281 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics