Кристаллическая структура N-концевой домен рианодиновыми рецепторов от Plutella xylostella

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

В этой статье мы опишем протоколы протеина выражение, очистка, кристаллизации и структуры определения N-концевой домен рецептора рианодиновыми от diamondback моли (Plutella xylostella).

Cite this Article

Copy Citation | Download Citations

Nayak, B. C., Wang, J., Lin, L., He, W., You, M., Yuchi, Z. Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella. J. Vis. Exp. (141), e58568, doi:10.3791/58568 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Разработка мощных и эффективных инсектицидов, ориентация насекомых рианодиновыми рецепторы (RyRs) был большой интерес в области сельскохозяйственными вредителями. На сегодняшний день, несколько diamide инсектициды против вредителей, которые освоено RyRs, которые генерируют годовой доход в 2 миллиарда долларов США. Но понимание действия инсектицидов, RyR ориентация ограничивается отсутствием структурной информации о насекомых RyR. Это в свою очередь ограничивает понимание развития резистентности к инсектицидам в вредителей. Бугорчатая моли (ДБМ) является разрушительных вредителей, уничтожив крестоцветных культур во всем мире, который поступили также показать резистентности к инсектицидам diamide. Таким образом она имеет большое практическое значение для разработки новых инсектицидов, ориентация RyR дБм, особенно ориентация региона отличается от традиционной diamide привязки сайта. Здесь мы представляем протокол для структурно характеристики N-концевой домен RyR от дБм. X-ray Кристаллическая структура была решена путем молекулярной замена с разрешением 2,84 Е, который показывает бета трилистник складной мотив и фланкируя альфа-спираль. Этот протокол может быть адаптирована для выражения, очистки и структурных характеристик других доменов или белков в целом.

Introduction

Рианодиновыми рецепторы (RyRs) являются конкретные ионные каналы, которые посредником проникновение ионов Ca2 + через мембраны саркоплазматический ретикулум (SR) в мышечных клетках. Таким образом они играют важную роль в сокращении возбуждения муфты процесса. В своей функциональной формы, RyR собирает как гомо Тетрамер с молекулярной массой > 2 MDa, с каждого подразделения, состоящий из ~ 5000 аминокислотных остатков. В млекопитающих, существует три изоформ: RyR1 - скелетных мышц, типа RyR2 - сердечной мышцы и RyR3-повсеместно выражена в различных тканях1.

В насекомых существует только один тип RyR, который выражается в мышечной и нервной ткани2. Насекомое RyR больше похож на млекопитающих RyR2 с идентификатором последовательности около 47%3. Diamide инсектициды, ориентированные на RyR чешуекрылых и Coleoptera разработаны и продаются в крупных компаний, как Bayer (flubendiamide), DuPont (Хлорантранилипрол) и "Сингента" (cyantraniliprole). С момента своего запуска относительно недавно diamide инсектициды стали одним из быстро растущих класса инсектицидов. В настоящее время продажи этих трех инсектицидов ежегодно пересекли 2 миллиарда долларов США с темпами роста более чем на 50% с 2009 года (Agranova).

Недавние исследования сообщили развитие резистентности у насекомых после нескольких поколений использования этих инсектицидов4,5,6,,78. Сопротивление мутаций в трансмембранных доменов RyRs от diamondback моли (ДБМ), Plutella xylostella (G4946E, I4790M) и соответствующие позиции в томатном яблонный, Tuta absoluta (G4903E, I4746M) показывают, что регион могут быть вовлечены в diamide инсектицид привязки, как этот регион известен быть критическим для стробирования канала4,8,9. Несмотря на обширные исследования в этой области точные молекулярные механизмы diamide инсектицидов остаются недостижимой. Кроме того неясно, затрагивают ли мутации сопротивления взаимодействия с гидразиды прямо или allosterically.

Ранее проведенные исследования сообщили структуру нескольких доменов RyR от видов млекопитающих и структура полнометражных RyR1 млекопитающих и RyR2 рентгеноструктурного анализа и крио электронная микроскопия, соответственно10,11, 12,13,14,,1516,,1718,19,20,21 . Но пока что, нет структуры насекомых RyR сообщалось, который запрещает нам понимание молекулярных тонкости функции рецепторов, а также молекулярные механизмы действия инсектицидов и развития резистентности к инсектицидам.

В этой рукописи мы представляем обобщенных протокол для структурной характеристики N-терминальный β-трилистник домена рецептора рианодиновыми от моли diamondback, разрушительных вредителей, заражая крестоцветных культур во всем мире22. Конструкция была разработана согласно опубликованной кролик RyR1 NTD кристалл структур23,24и крио EM структурной модели16,,1718,19, 20 , 21. это первый разрешением структура для насекомых RyR, который раскрывает механизм для стробирования канала и предоставляет шаблон важные для развития вегетационных инсектицидов, с использованием проектирования на основе структуры наркотиков. Для разяснения структуры мы заняты рентгеноструктурного анализа, который рассматривается как «золотой стандарт» для определения структуры белка в вблизи атомных резолюции. Хотя процесс кристаллизации является непредсказуемым и трудоемкий, этот шаг за шагом протокол поможет исследователям выразить, очищают и в целом характеризуют другие домены насекомое RyR или любые другие белки.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. клонирование гена, выражение протеина и очистки

  1. PCR усиливает ДНК, соответствующий протеин интереса (остатки 1-205 дБм RyR, Genbank соотв. нет. AFW97408) и клонов в ПЭТ 28a-HMT вектор клонирования перевязка-независимые (LIC)25. Этот вектор содержит гистидина, MBP тег и сайт расщепления протеазы ТэВ на N-го15.
    1. Дизайн LIC Праймеры для амплификация гена целевой с LIC-совместимых 5' расширений:
      Форвард LIC грунт:
      5' TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3'
      Обратный LIC грунтовка:
      5' TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3'
    2. Объединить компоненты реакции (50 мкл): 1 мкл ДНК шаблонов (100 нг/мкл), 1 мкл вперед праймера (10 мкм), 1 мкл обратного праймера (10 мкм), 0.5 мкл ДНК полимеразы (нос), 5 мкл реакции 10 x буфер, 1 мкл dNTP (25 мм) , 40,5 мкл РНКазы бесплатно ddH2O.
      1. Поместите смесь реакции в машину ПЦР и запускать следующую программу.
      2. Инкубируйте на 95 ° C в течение 3 мин, а затем запустить 30 циклов (95 ° C за 30 сек, 58 ° C 15 s, 72 ° C в течение 1 мин). Инкубируйте на 72 ° C за 5 мин и затем провести на 4 ° C.
      3. Запуск всего реакция смеси (50 мкл) на 2% агарозном геле и извлекать с комплектом извлечения геля. Следуйте производителя протокол.
    3. Перевязка независимые клонирования (LIC)
      1. Выполнять SspI пищеварения (60 мкл): 20 мкл дна вектора (50 нг/мкл), 6 мкл 10 x буфер реакции, 4 мкл SspI и 30 мкл ddH2O. инкубировать при 37 ° C для запуска всего реакция 3 h. mix на гель агарозы 1% и извлекать с комплектом извлечения геля. Следуйте производителя протокол.
      2. Проводить лечение T4 полимеразы дна вектора и вставьте ДНК. Объединить следующее: 5 мкл вектор или Вставка ДНК (50 нг/мкл), 2 мкл 10 x T4 ДНК-полимеразы буфера, 1 мкл dGTP (25 мм) для вектора или 1 мкл дЦТФ (25 мм) для вставки ДНК, 1 мкл DTT (100 мм), 0,4 мкл T4 ДНК полимеразы (уточненное LIC) и 9.6 мкл ddH2O. инкубировать реакций при комнатной температуре за 40 мин, тепло инактивирует фермент на 75 ° C в течение 20 мин.
        Примечание: LIC вектор и вставка ДНК должны рассматриваться в отдельном реакциях.
      3. Выполните LIC, отжиг реакции. Объединить следующее: 2 мкл лечение T4 Вставка ДНК, 2 мкл лечение T4 LIC вектор ДНК. Инкубируйте реакции при комнатной температуре в течение 10 мин.
  2. Трансформировать BL21 (DE3) E. coli клетки с этой рекомбинантных плазмид.
    1. Оттепель сведущие клетки (50 мкл в микро пластиковых пробирок) на льду.
    2. Добавить примерно 1 мкл (50 нг) плазмидной в трубу. Смешайте клетки и ДНК, нежно стряхивая трубки 2 – 3 раза. Место труб на льду за 20 мин.
    3. Тепло шок при 42 ° C 40 s. место трубки на льду снова добавить по 1 мл 2 мин комнатной температуре LB СМИ к трубе.
    4. Место смесь трубки в шейкер 250 об/мин при 37 ° C на 45 мин распространение 150 – 200 мкл смеси на выбор плит. Инвертировать пластину и Инкубируйте на ночь на 37 ° C.
  3. Выберите один колонии и культуры клетки в 100 мл 2YT среде, содержащей 50 канамицин мкг/мл при 37 ° C на ночь. Следующее утро, прививать 1 Л 2YT среде, содержащей 50 мкг/мл канамицин с 10 мл на ночь культуры и инкубировать в 37 ° C шейкер инкубатор на 250 об/мин, до тех пор, пока ОД600 достигает ~ 0,6. После этого вызвать культуры с IPTG до конечной концентрации 0,4 мм и расти еще 5 ч на 30 ° C.
  4. Урожай клетки центрифугированием в 8000 x g 10 мин при температуре 4 ° C, собирать клетки и клетки каждые 10 г в 40 мл буфера lysis (10 мм HEPES рН 7,4, 250 мм KCl, β-меркаптоэтанол 10 мм, 25 мкг/мл лизоцима, 25 мкг/мл DNase Ресуспензируйте 1 мм PMSF).
    1. Срывать его, sonication на 65% амплитуды на 8 мин с 1 s на и 1 s выкл. Удалите мусор клетки центрифугированием на 40000 x г за 30 мин при 4 ° C. Фильтр супернатанта, проходя через 0,22 мкм фильтр и загрузить его в пример цикла.
  5. Очистить протеин сплавливания, Клив тег и повторно очищают целевого белка.
    1. Очистить протеин сплавливания с помощью Ni-НТА столбца (привязки буфера: 10 мм HEPES рН 7,4, 250 мм KCl; Элюирующий буфер: 10 мм HEPES рН 7,4, 250 мм KCl, 500 мм имидазола) и очистить системой очистки, с помощью линейного градиента имидазола 20 – 250 мм.
    2. Рассекающий удар eluted целевого белка с ТэВ протеазы (1:50 соотношение) на ночь при 4 ° C.
    3. Очистить смесь реакции расщепления с помощью столбца амилоза смолы (привязки буфера: 10 мм HEPES рН 7,4, 250 мм KCl; Элюирующий буфер: 10 мм HEPES рН 7,4, 250 мм KCl, мальтоза 10 мм) и столбец Ni-НТА удалить тег и ТэВ протеазы. Целевого белка будет в проточную часть этих двух столбцов.
    4. Dialyze образец против диализа буфера (10 мм трис-HCl рН 8,8, 50 мм KCl, β-меркаптоэтанол 10 мм для уменьшения концентрации соли. Очищение образца на анион обменной колонны (привязки буфера: 10 мм трис-HCl рН 8,8, 10 мм β-меркаптоэтанол; Элюирующий буфер: 10 мм трис-HCl рН 8,8, 1 M KCl, 10 мм β-меркаптоэтанол) линейный градиент 20 – 500 мм KCl в Элюирующий буфер.
    5. В качестве последнего шага в процессе очистки концентрат белка, используя концентратор центробежные (10 кДа MWCO) и вставляют Superdex 200 26/600 лари фильтрации столбца для проверки однородности.
  6. Проверьте чистоту белка, запустив его на 15% SDS страницы.
    Примечание: Все столбцы запущены на систему очистки белков с 2 мл/мин скорость потока привязки и скорость потока элюции 4 мл/мин за исключением гель фильтрации в 1 мл/мин.

2. белка подготовка и кристаллизации

  1. Концентрат очищенный протеин образца до 10 мг/мл, используя концентратор центробежные (10 кДа MWCO) и буфер обмена кристаллизации буфер перед сохранением на-80 ° C.
  2. Выполнить проверки кристаллизации (соотношение 1:1, 200 nL белков и 200 nL водохранилище буфера), сидя падение метод диффузии паров на 295 K с несколькими кристаллизации наборы, с помощью автоматизированных жидкости, робототехнические системы в формате 96-луночных обработки.
    Примечание: Мы использовали наборы от молекулярных размеров и Hampton исследований и грифона автоматизированной системы обработки жидких.
  3. Уплотнение 96-луночных кристаллизации пластины для предотвращения испарения и позволить уравновешивания белка падение с буфером водохранилище. Затем сохраните пластины в инкубаторе кристалл на 18 ° C.
  4. Проверьте 96-луночных пластины, периодически с помощью световой микроскоп для мониторинга роста и формирования кристалла.
  5. Чтобы дифференцировать белковых кристаллов от кристаллов поваренной соли, используйте краска белка. 1 мкл красителя, падение целевой. Подождите около 1 h и наблюдать под микроскопом. Кристаллы белка будет синим.
  6. Используйте положительные кристаллизации условия (сульфат аммония 1,5 М, 0,1 М трис pH 8.0) для дальнейшей оптимизации кристаллы, используя висит drop метод диффузии паров в 24-ну пластины.
    1. Оптимизируйте pH от 7,0 до 8,5 с 0,5 рН единичный интервал каждый шаг. Оптимизируйте концентрации сульфата аммония от 1,2 М до 1,7 М с интервалом 0,1 М каждый шаг. (В нашем случае лучшие условия производства крупных кристаллов, плита образный был сульфат аммония 0,1 М HEPES pH 7.0 и 1.6 М)

3. Монтаж, кристалл рентгеновские сбора данных и определения структуры

  1. Монтировать кристаллы в cryoloop и флэш прохладно в жидком азоте с помощью водохранилище раствора, содержащего 20% глицерин как крио Протравитель. Место кристаллы в unipuck для хранения и транспортировки.
  2. Предварительно просматривать белковых кристаллов с помощью Rigaku доме рентгеновского diffractor. Выберите лучшие из них с высоким резолюций для сбора данных на объектах синхротрона (наш набор данных была собрана из BL17U1 в Шанхае синхротронного излучения).
    1. Используйте программное обеспечение для контроля излучение BluIce26 монтировать и центр кристаллы функцией автоматической или ручной центрирования. Выполните тест воздействия для определения стратегии сбора данных, включая начиная угол, выдержка, детектор расстояния, ширина кадра и чисел.
    2. Сбор данных соответственно (мы собрали 180 кадры с 1 s выдержка, ширина кадра 1° и детектор расстояние 350 мм).
  3. Индекс, интегрировать и масштаб dataset с помощью HKL2000 люкс27. Сначала выполняют функцию поиска пик найти дифракции пятна и затем индекс пятна и выберите группу правой пространства. После интеграции пик масштаб набор данных с моделью надлежащего ошибки и сохраните файл вывода .sca.
  4. Решить проблему фазы, молекулярные замены с помощью Phaser28 в Феникс29.
    1. Вычислите количество белковых молекул в группе асимметричных копии Xtriage30.
    2. Посмотрите для надлежащей структуры шаблонов с высокой последовательности идентичности и структурно сходство как целевого белка, используя известные структуры из литературы или модели, создаваемые сервером Предсказание структуры таких Phyre231 (мы использовали кролик RyR1 NTD как Поиск модели, PDB ID 2XOA).
    3. Запустите Phaser, используя файл данных дифракции, шаблон структуры файла и файл последовательности белка найти решение.
  5. Выполните автосборки32 в Феникс29 для создания первоначальной модели с помощью выходного файла от Phaser и файл последовательности от целевого белка.
  6. Создание структуры в модифицированных экспериментальной электронной плотности, используя Лысуха33 и уточнить с помощью phenix.refine34 в итерационные циклы вручную.
  7. Проверка конечной модели, с помощью средств проверки в PHENIX18.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Очистка

N-концевой домен дБм RyR была выражена как синтез белка с hexahistidine тегов, тег MBP и ТэВ протеазы расщепления сайта. Мы последовали за пять этапов очистки стратегию для получения чистого белка, подходит для цели кристаллизации. Во-первых синтез белка был очищен от растворимая фракция lysate клетки по колонке Ni-НТА (HisTrap HP). Далее синтез белка был подвергнут ТэВ протеазы расщепления и hexahistidine-MBP остаток был удален по столбцу смолы амилозы, следуют колонке Ni-НТА. Кроме того, белок был очищен, анион обменной колонны (Q Sepharose HP) и наконец по столбцу гель фильтрация (Superdex 200 26/600). Окончательный выход очищенный протеин от 1 Л бактериальной культуры с помощью 2YT СМИ был ~ 4 мг. Очищенный протеин показал одну группу на SDS-PAGE на ~ 21 kDa (рис. 1). Элюирующий объем от гель фильтрации столбца подтвердил очищенный НТД RyR быть мономера (рис. 1).

Кристаллизация

Первоначальный кристаллизации, скрининг в пластин 96-луночных принесли кристаллы в нескольких условий. Эти условия были отобраны для оптимизации кристалл в 24 хорошо пластин. Наиболее оптимальное состояние, где высокое качество плиты форма кристаллов были сформированы был 0,1 М HEPES pH 7.0 и 1.6 М сульфата аммония (рис. 2).

Определение структуры

Полученные кристаллы дифрагированных до 2.84 Å на излучение BL17U1 в Шанхае синхротронного излучения. Кристалл был проиндексирован в пространство группы P61 с параметрами ячейки = 170.13, b = 170.13, c = 51.763 Е, α = β = 90.00 °, γ = 120 °. Для определения структуры молекулярные замена работал с помощью кролик RyR1 NTD как модель поиска в Феникс. Дальнейшее совершенствование структуры было сделано в PHENIX окончательный Rработы и Rбесплатно 21.63 и 24.52%, соответственно. Статистика сбор и уточнение данных, перечислены в таблице 1. Выполнено структура NTD RyR дБм, охватывающих остатки 1-205 (PDB ID 5Y9V) показано на рисунке 3.

Figure 1
Рисунок 1: SDS-PAGE и гель фильтрации Хроматограмма, представляющие очистки дБм RyR NTD35. СТРАНИЦА (15%) SDS в врезные показывает очищенный дБм RyR NTD как одну группу после того, как пять шагов стратегии очистки. Полосу слева показывает стандартные белка маркера (PM). Хроматограмма фильтрации геля, полученные с помощью Superdex 200 26/600 столбец показывает элюции пик в 240 мл, что соответствует односегментную форму белка. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2. Кристаллизация дБм RyR NTD35Кристаллы дБм RyR NTD, изготовленные методом диффузии паров как видно под микроскопом света. Кристаллизации условие было сульфат аммония 0,1 М HEPES pH 7.0 и 1.6 М. Шкалы бар = 200 µm. пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: Структура RyR NTD дБм (PDB ID 5Y9V)35Решена структура белка показано из двух представлений. Элементы вторичной структуры помечены. Β пряди отображаются фиолетовым. Α-спирали и 3 спирали10 показаны синим цветом. Петли указаны в белом. NT и Ct представляют и N-терминала C-терминал белка, соответственно. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Таблица 1: сбор и уточнение статистики данных DBM RyR NTD кристалл35. Пожалуйста, нажмите здесь, чтобы скачать эту таблицу.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

В этой статье мы описать процедуру recombinantly выразить, очищают, кристаллизация и определить структуру дБм RyR NTD. Для кристаллизации важнейшее требование заключается в получении белки с высокой растворимости, чистоты и однородности. В нашем протокол мы решили использовать ПЭТ 28a-HMT вектор, как он содержит тег hexahistidine и тег ПМБ, оба из которых могут быть использованы для очистки для получения более высокой чистоты раза. Кроме того тег MBP СПИДа в растворимость целевого белка. Мы очищенный протеин пять последовательных шагов, которые принесли белка, что было очень чисто и подходит для кристаллизации. Скрининг кристаллизации была выполнена с использованием автоматизированной системы обработки жидкости. По сравнению с традиционными скрининг параметром ручной падение, автоматизированная система использует очень небольшие объемы выборки, экономит время и энергию. Он также увеличивает воспроизводимость благодаря точности жидким обработки. Кристаллы были дифрагированных собственными силами для скрининга и синхротронного для сбора данных как она обеспечивает рентген с большей интенсивностью и меньше расхождений, тем самым давая высокое качество данных. Молекулярные замена был нашим первым выбором, как аналогичные структурные шаблоны были доступны в базе данных. Альтернативный способ заключается в использовании экспериментальной поэтапного, включая MAD, SAD, мир и т.д.

Хотя решения структуры дБм RyR NTD, Мэттьюс коэффициенты, полученные из Xtriage30 предложил что асимметричный блок (АГУ) скорее содержится четыре мономеров с 46% содержание растворителя, который имеет вероятность 49%. Однако мы не могли найти правильное решение с четырьмя молекулами в АГУ. Также не последующих запусках искать два, три, пять, шесть молекул. В конце концов мы нашли правильное решение с только одной молекулы в АГУ, который имеет только 4% вероятности и более 86% содержание растворителей. Высокое содержание воды было подтверждено после того, как мы решали структуры. Таким образом существует крайне высокое содержание растворителей в зависимости от встроенных в котором белка пакеты.

Хотя рентгеноструктурного анализа является золотым стандартом в определении структуры белков, белки с большой беспорядок или гибкие регионов и некоторых крупных белковых комплексов с слабым сродством бросают вызов кристаллизоваться. Белка инженерных методов, включая петлю усечение, поверхности энтропии сокращения и сшивки, может улучшить шансы на получение лучшей белковых кристаллов. Помимо выявления разрешением белковых структур, рентгеноструктурного анализа также может использоваться для изучения взаимодействия белка пестицидов, которые помогли бы нам на проектирования на основе структуры пестицидов. Ци et al. обнаружил, что разные семьи гидразиды может связывать различные сайты, которые являются различные виды36. Используя нашу стратегию, можно определить RyR структур из нескольких видов и определить ответственных за наблюдаемые видоспецифичностью уникальные элементы. В целом этот протокол может быть адаптирована для определения выражения, очистки, кристаллизации и структуры белков или доменов протеина, самостоятельно или в комплексе с маленькой молекулы наркотиков.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgements

Финансирование этого исследования была предоставлена: Национальный исследовательский ключ и Программа развития Китая (2017YFD0201400, 2017YFD0201403), национальный характер науки фонд Китая (31320103922, 31230061) и программа проекта национальных фундаментальных исследований (973) Китай (2015CB856500, 2015CB856504). Мы благодарны сотрудникам на излучение BL17U1 на объекте Шанхай синхротронного излучения (SSRF).

Materials

Name Company Catalog Number Comments
pET-28a-HMT vector This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain Novagen 69450-3CN
HisTrapHP column (5 mL) GE Healthcare 45-000-325
Amylose resin column New England Biolabs E8021S
Q Sepharose high-performance column  GE Healthcare 17-1154-01
Amicon concentrators (10 kDa MWCO) Millipore UFC901008
Superdex 200 26/600 gel-filtration column  GE Healthcare 28-9893-36
Automated liquid handling robotic system  Art Robbins Instruments Gryphon
96 Well CrystalQuick Greiner bio-one 82050-494
Uni-Puck Molecular Dimensions MD7-601
Mounted CryoLoop - 20 micron Hampton Research HR4-955
CryoWand Molecular Dimensions MD7-411
Puck dewar loading tool Molecular Dimensions MD7-607
Nano drop Thermo Scientific NanoDrop One
Crystal incubator Molecular Dimensions MD5-605
X-Ray diffractor Rigaku FRX
PCR machine Eppendorf Nexus GX2
Plasmid mini-prep kit Qiagen 27104
Gel extraction kit Qiagen 28704
SspI restriction endonuclease NEB R0132S
T4 DNA polymerase Novagen 2868713
Kanamycin Scientific Chemical 25389940
IPTG Genview 367931
HEPES Genview 7365459
β-mercaptoethanol Genview 60242
Centrifuge Thermo Scientific Sorvall LYNX 6000 
Sonnicator Scientz II-D
Protein purification system GE Healthcare Akta Pure
Light microscope Nikon SMZ745
IzIt crystal dye Hampton Research HR4-710
Electrophoresis unit Bio-Rad 1658005EDU
Shaker Incubator Zhicheng ZWYR-D2401
Index crystal screen Hampton Research HR2-144
Structure crystal screen Molecular Dimensions MD1-01
ProPlex crystal screen Molecular Dimensions MD1-38
PACT premier crystal screen Molecular Dimensions MD1-29
JCSG-plus crystal screen Molecular Dimensions MD1-37

DOWNLOAD MATERIALS LIST

References

  1. Giannini, G., Sorrentino, V. Molecular structure and tissue distribution of ryanodine receptors calcium channels. Medicinal Research Reviews. 15, (4), 313-323 (1995).
  2. Takeshima, H., et al. Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster. FEBS Letters. 337, (1), 81-87 (1994).
  3. Sattelle, D. B., Cordova, D., Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebrate Neuroscience. 8, (3), 107-119 (2008).
  4. Steinbach, D., et al. Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella. Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).
  5. Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China. Pest Management Science. 69, (5), 661-665 (2013).
  6. Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae). Journal of Economic Entomology. 108, (4), 1978-1985 (2015).
  7. Guo, L., et al. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Management Science. 70, (7), 1083-1089 (2014).
  8. Troczka, B., et al. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochemistry and Molecular Biology. 42, (11), 873-880 (2012).
  9. Roditakis, E., et al. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).
  10. Borko, L., et al. Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias. Acta Crystallographica Section D. 70, (Pt 11), 2897-2912 (2014).
  11. Sharma, P., et al. Structural determination of the phosphorylation domain of the ryanodine receptor. FEBS Journal. 279, (20), 3952-3964 (2012).
  12. Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface. Nature Communications. 4, 1506 (2013).
  13. Lau, K., Van Petegem, F. Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain. Nature Communications. 5, 5397 (2014).
  14. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  15. Lobo, P. A., Van Petegem, F. Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations. Structure. 17, (11), 1505-1514 (2009).
  16. des Georges, A., et al. Structural Basis for Gating and Activation of RyR1. Cell. 167, (1), 145-157 (2016).
  17. Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. Architecture and conformational switch mechanism of the ryanodine receptor. Nature. 517, (7532), 39-43 (2015).
  18. Peng, W., et al. Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2. Science. 354, (6310), (2016).
  19. Wei, R. S., et al. Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1. Cell Research. 26, (9), 977-994 (2016).
  20. Yan, Z., et al. Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution. Nature. 517, (7532), 50-55 (2015).
  21. Zalk, R., et al. Structure of a mammalian ryanodine receptor. Nature. 517, (7532), 44-49 (2015).
  22. Furlong, M. J., Wright, D. J., Dosdall, L. M. Diamondback moth ecology and management: problems, progress, and prospects. Annual Review of Entomology. 58, 517-541 (2013).
  23. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  24. Lobo, P. A., Van Petegem, F. Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations. Structure. 17, (11), 1505-1514 (2009).
  25. Aslanidis, C., de Jong, P. J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Research. 18, (20), 6069-6074 (1990).
  26. Stepanov, S., et al. JBluIce-EPICS control system for macromolecular crystallography. Acta Crystallographica Section D. 67, (3), 176-188 (2011).
  27. Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes. Acta Crystallographica Section D. 62, (Pt 8), 859-866 (2006).
  28. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40, (Pt 4), 658-674 (2007).
  29. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D. 66, (Pt 2), 213-221 (2010).
  30. Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation. CCP4 Newsletter. (43), 27-35 (2005).
  31. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 10, (6), 845-858 (2015).
  32. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D. 64, (Pt 1), 61-69 (2008).
  33. Emsley, P., Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallographica Section D. 60, 2126-2132 (2004).
  34. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallographica Section D. 68, (Pt 4), 352-367 (2012).
  35. Lin, L., et al. Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites. Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).
  36. Qi, S., Casida, J. E. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor. Pesticide Biochemistry and Physiology. 107, (3), 321-326 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics