מבנה גבישי של N-מסוף תחום של Ryanodine הקולטן של Plutella xylostella

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

במאמר זה, אנו מתארים את הפרוטוקולים של נחישות ביטוי, טיהור, התגבשות ומבנה חלבון של התחום N-מסוף של קולטן ryanodine מ- diamondback עש (Plutella xylostella).

Cite this Article

Copy Citation | Download Citations

Nayak, B. C., Wang, J., Lin, L., He, W., You, M., Yuchi, Z. Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella. J. Vis. Exp. (141), e58568, doi:10.3791/58568 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

פיתוח חומרי הדברה חזק ויעיל מיקוד קולטנים ryanodine חרקים (RyRs) היה עניין רב בתחום הדברה חקלאיים. נכון להיום, מספר קוטלי חרקים diamide מיקוד המזיק שחייב להיות ממוסחר RyRs, אשר מפיקים הכנסות שנתיות של 2 מיליארד דולר. אבל הבנה של מצב הפעולה של פילוח RyR קוטלי חרקים הוא מוגבל על ידי חוסר של מבני מידע לגבי חרקים RyR. זה בתורו מגבילה את ההבנה של ההתפתחות של עמידות חרקים מזיקים. העש diamondback (DBM) הוא נודניק הרסנית השמדת יבולים המצליבים ברחבי העולם, אשר דווחה גם להראות התנגדות הדברה diamide. לכן חשיבות מעשית רבה לפתח הדברה חדשניים מיקוד RyR DBM, במיוחד לעבר אזור שונים מתוך אתר איגוד diamide המסורתי. כאן, אנו מציגים פרוטוקול לאפיין מבחינה מבנית המחשבים N-מסוף של RyR מ DBM. המבנה נפתרה על-ידי החלפת מולקולרית ברזולוציה של 2.84, אשר מציגה את מוטיב מתקפלים בטא-trefoil, סליל אלפא איגוף. פרוטוקול זה ניתן להתאים את הביטוי, טיהור, אפיון מבניים של קבוצות מחשבים או חלבונים אחרים באופן כללי.

Introduction

קולטנים Ryanodine (RyRs) הם תעלות יונים וברצפטורים ספציפיים, אשר לתווך על הסתננות של Ca2 + יונים על-פני הממברנות sarcoplasmic רשת (SR) בתאי השריר. לכן, הם לשחק תפקיד חשוב להתכווצות עירור צימוד תהליך. בצורתו פונקציונלי, RyR מרכיב כמו הומו-tetramer עם מסה מולקולרית של > מד א 2, עם כל יחידה משנית הכוללת של שאריות חומצה אמינית ~ 5000. ביונקים, ישנם שלושה איזופורמים: RyR1 מסוג שרירי השלד, שריר הלב סוג RyR2 - ו RyR3-ubiquitously לידי ביטוי ברקמות שונות1.

חרקים יש רק סוג אחד של RyR, הבאה לידי ביטוי רקמות שרירים, עצבים2. RyR חרקים הוא דומה יותר RyR2 בתרבית של זהות רצף כ- 47%3. הדברה Diamide מיקוד RyR של פרפראים הזבוביים וקשיי יש כבר פותחו ומשווקים על ידי חברות גדולות כמו באייר (flubendiamide), דופונט (chlorantraniliprole) והפריבט (cyantraniliprole). מאז השקתה יחסית לאחרונה, הדברה diamide הפכו להיות אחד של המעמד הצמיחה המהירה של קוטלי חרקים. נכון לעכשיו, המכירות של אלה של שלושה קוטלי חרקים מדי שנה חצו 2 מיליארד דולר ארה עם קצב גידול של למעלה מ-50% מאז 2009 (Agranova).

מחקרים שנעשו לאחרונה דיווחו על ההתפתחות של עמידות חרקים לאחר כמה דורות של השימוש האלה קוטלי חרקים4,5,-6,-7,-8. ההתנגדות מוטציות בתחום transmembrane של RyRs העש diamondback (DBM), Plutella xylostella (G4946E, I4790M), את עמדות המקביל האילוח עגבניות, Tuta absoluta (G4903E, I4746M) מראים כי האזור יכול להיות מעורב diamide קוטל חרקים מחייב כמו אזור זה ידוע להיות קריטי עבור gating של ערוץ4,8,9. למרות מחקר מקיף בתחום זה, המנגנונים המולקולריים המדויק של קוטלי חרקים diamide נשארים חמקמקים. יתר על כן, לא ברור מוטציות עמידות להשפיע את האינטראקציות עם diamides ישירות או allosterically.

מחקרים מוקדמים יותר דיווחו על המבנה של מספר תחומים RyR של יונקים ואת המבנה של RyR1 יונקים באורך מלא, RyR2 על ידי קריסטלוגרפיה באמצעות קרני רנטגן ואלקטרון הקפאה-, בהתאמה10,11, 12,13,14,15,16,17,18,19,20,21 . אבל עד כה, אין מבנה של חרק RyR דווחה, אשר אוסרת עלינו. הבנת המורכבות מולקולרית של הפונקציה קולטן וכן את המנגנונים המולקולריים של פעולה בקוטלי חרקים, התפתחות של עמידות חרקים.

כתב יד זה, אנו מציגים עבור אפיון מבניים N-מסוף תחום β-trefoil של קולטן ryanodine מ- diamondback העש, נודניק הרסני מדביק המצליבים יבולים ברחבי העולם22פרוטוקול מוכללת. הבונה עוצבה בהתאם את הארנב שפורסם RyR1 NTD קריסטל מבנים23,24ו של הקפאה-EM מודלים מבניים16,17,18,19, 20 , 21. זה המבנה ברזולוציה גבוהה הראשון שדווחו עבור חרקים RyR, אשר חושף את המנגנון עבור ערוץ gating מספק תבנית חשוב לפיתוח חומרי הדברה תלויי מין באמצעות עיצוב מבוסס על מבנה סמים. עבור מבנה הבהרה, אנחנו מועסקים קריסטלוגרפיה באמצעות קרני רנטגן, אשר נחשב "תקן הזהב' לקביעת מבנה החלבון-ליד ברזולוציה אטומית. למרות תהליך התגבשות הוא צפוי ועבודה אינטנסיבית, פרוטוקול שלב אחר שלב זה תסייע לחוקרים אקספרס, לטהר ולאפיין תחומים אחרים של חרק RyR או כל לחלבונים אחרים באופן כללי.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. ג'ין שיבוט, ביטוי חלבונים וטיהור

  1. PCR להגביר את הדנ א המתאים חלבון עניין (1-205 שאריות DBM RyR, Genbank בדיקת. לא. AFW97408) ולשכפל לתוך pET-28a-HMT וקטורי מצדו שאינו תלוי שיבוט בעצימות25. וקטור זה מכיל תג היסטידין, תג MBP, אתר המחשוף פרוטאז אס-אמיני15-
    1. עיצוב תחל LIC עבור הגברה של היעד גנים עם LIC תואמי 5' הרחבות:
      LIC פריימר לפנים:
      5' TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3'
      הפוך LIC פריימר:
      5' TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3'
    2. שילוב הרכיבים התגובה (50 μL): μL 1 של ה-DNA תבניות (100 ng/μL), μL 1 של פריימר לפנים (10 μM), μL 1 של פריימר הפוכה (10 μM), 0.5 μL של ה-DNA פולימראז (נב), 5 μL של תגובה 10 x מאגר, μL 1 של dNTP (25 מ מ) , 40.5 μL של RNase חינם ddH2O.
      1. מניחים את תערובת התגובה במכונת ה-PCR ולהפעיל את התוכנית הבאה.
      2. דגירה ב 95 מעלות צלזיוס למשך 3 דקות ולאחר מכן הפעל 30 מחזורי (95 ° C ל 30 s, 58 ° C 15 s, 72 מעלות צלזיוס במשך 1 דקה). דגירה ב-72 מעלות למשך 5 דקות ולאחר מכן החזק ב 4 º C.
      3. להפעיל את תערובת התגובה כולה (50 μL) על 2% agarose ג'ל ולחלץ בעזרת ערכת חילוץ ג'ל. פעלתי לפי הנהלים של היצרן
    3. מצדו תלויית שיבוט (LIC)
      1. לבצע SspI עיכול (60 μL): 20 μL של וקטור דנ א (50 ng/μL), μL 6 של 10 x תגובת מאגר, μL 4 של SspI ו 30 μL של ddH2O. Incubate ב 37 מעלות צלזיוס במשך 3 ח' להפעיל את התגובה כולה לערבב על 1% agarose ג'ל, לחלץ עם ערכת חילוץ ג'ל. פעלתי לפי הנהלים של היצרן
      2. לבצע טיפול T4 DNA פולימראז של וקטור והכנס את הדנ א. לשלב הבא: 5 μL של ה-DNA וקטוריים או הוספה (50 ng/μL), μL 2 10 מאגר ה-DNA פולימראז x T4, 1 μL של dGTP (25 מ מ) עבור וקטור או 1 μL של dCTP (25 מ מ) הוספת ה-dna μL 1 של DTT (100 מ מ), 0.4 μL של T4 DNA פולימראז (מוסמך LIC) , ו- 9.6 μL של ddH2O. Incubate תגובות בטמפרטורת החדר במשך 40 דקות חום-בטל אנזים ב 75 מעלות צלזיוס למשך 20 דקות.
        הערה: וקטור LIC והוספה DNA יש לטפל בתגובות נפרדים.
      3. לבצע את LIC חישול התגובה. לשלב הבא: 2 μL של הוספה שטופלו T4 DNA, 2 μL של T4 שטופלו LIC וקטור הדנ א. דגירה התגובה בטמפרטורת החדר במשך 10 דקות.
  2. להפוך את BL21 (DE3) e. coli תאים עם זה פלסמיד רקומביננטי.
    1. הפשרת המוסמכת תאים (50 μL בצינור מיקרו-צנטריפוגה) על קרח.
    2. להוסיף כ- 1 μL (50 ng) של פלסמיד לתוך הצינור. מערבבים את התאים ואת ה-DNA על ידי מצליף בעדינות את הצינור 2 – 3 פעמים. מניחים את הצינורית על קרח למשך 20 דקות.
    3. מחממים את ההלם 42 ° C למקום ס' 40 את הצינורית על הקרח שוב על 2 דק להוסיף 1 מ"ל של מדיה בטמפרטורת החדר LB הצינור.
    4. המקום הצינור תערובת שייקר 250 סל"ד ב 37 מעלות צלזיוס במשך 45 דקות מורחים µL 150-200 של התערובת על הלוחות הבחירה. הפוך את הצלחת, דגירה בין לילה ב 37 º C.
  3. לבחור שמושבה בודדת ותרבות התאים במדיום 2YT 100 מ ל, המכיל 50 µg/mL kanamycin ב 37 מעלות צלזיוס למשך הלילה. למחרת בבוקר, לחסן בינוני 2YT 1 ליטר המכיל 50 kanamycin µg/mL עם 10 מ"ל של תרבות לילה, דגירה של 37 ° C שייקר אינקובטור ב 250 סל"ד, עד ה OD600 מגיע ~ 0.6. לאחר מכן זירוז התרבות עם IPTG כדי ריכוז סופי של 0.4 מ מ ולגדול על עוד 5 שעות ב- 30 ° C.
  4. לקצור את התאים על ידי צנטריפוגה ב x 8000 g 10 דקות ב 4 ° C, לאסוף את התאים, resuspend כל התאים 10 גרם במאגר פירוק 40 מ ל (10 מ מ HEPES pH 7.4, 250 מ מ אשלגן כלורי, β-mercaptoethanol 10 מ מ, 25 μg/mL ליזוזים, 25 μg/mL DNase 1 מ PMSF).
    1. לפרק. את זה על ידי sonication-משרעת 65% למשך 8 דקות עם 1 s s על ו- 1 הנחה. להסיר את שאריות תאים על ידי צנטריפוגה ב x 40,000 g למשך 30 דקות ב 4 º C. לסנן את תגובת שיקוע על ידי עובר דרך מסנן μm 0.22, לטעון אותה לתוך הלולאה הדגימה.
  5. לטהר את חלבון כימרי, קליב את התג, מחדש לטהר את חלבון המטרה.
    1. לטהר את חלבון כימרי באמצעות העמודה Ni-נ (איגוד מאגר: 10 מ מ HEPES pH 7.4, 250 מ מ אשלגן כלורי; • תנאי מאגר: 10 מ מ HEPES pH 7.4, 250 מ מ אשלגן כלורי, 500 מ מ imidazole) ולטהר על-ידי מערכת טיהור, עם שיפוע ליניארי של 20 – 250 מ מ imidazole.
    2. קליב את חלבון המטרה eluted עם אס פרוטאז (1:50 יחס) לילה ב 4 º C.
    3. לטהר את תערובת התגובה המחשוף באמצעות עמילוז שרף עמודה (איגוד מאגר: 10 מ מ HEPES pH 7.4, 250 מ מ אשלגן כלורי; • תנאי מאגר: 10 מ מ HEPES pH 7.4, 250 מ מ אשלגן כלורי, מלטוז 10 מ מ) ועמודה Ni-נ להסיר את התג ואת אס פרוטאז. החלבון היעד יהיה השבר זרימה דרך של שתי העמודות.
    4. Dialyze את הדגימות מאגר דיאליזה (10 מ מ טריס-HCl pH 8.8, 50 מ מ אשלגן כלורי, 10 מ מ β-mercaptoethanol כדי להפחית את ריכוז המלחים. לטהר את הדגימה על עמודה exchange אניון (איגוד מאגר: 10 מ מ טריס-HCl pH 8.8, 10 מ מ β-mercaptoethanol; • תנאי מאגר: 10 מ מ טריס-HCl pH 8.8, 1 מ' אשלגן כלורי, 10 מ מ β-mercaptoethanol) על ידי מעבר צבע ליניארי של 20 – 500 מ מ אשלגן כלורי במאגר • תנאי.
    5. כשלב האחרון בתהליך טיהור, להתרכז החלבון באמצעות רכז צנטריפוגליות (10 kDa MWCO) ולהזריק לתוך עמודה ג'ל-סינון Superdex 200 26/600 כדי לבדוק את אחידות.
  6. לבחון את הטוהר של החלבון על ידי פועל זה מרחביות 15% דף.
    הערה: כל העמודות פועלים על מערכת טיהור חלבון עם קצב זרימה איגוד של 2 mL/min, שיעור זרימת • תנאי של 4 mL/min. חוץ ג'ל-סינון-1 mL/min.

2. חלבון הכנה וגיבוש

  1. לרכז את הדגימה חלבון מטוהרים כדי 10 מ"ג/מ"ל באמצעות רכז צנטריפוגליות (10 kDa MWCO) ומאגר exchange למאגר התגבשות לפני אחסון ב- 80 ° c
  2. לבצע סינון התגבשות (יחס 1:1, 200 nL של חלבונים, 200 nL מאגר המאגר) על ידי הישיבה ירידה אדי דיפוזיה שיטה ב K 295 עם מספר ערכות התגבשות באמצעות נוזל אוטומטיות של טיפול במערכת רובוטית בתבנית 96-ובכן.
    הערה: השתמשנו ערכות ממדים מולקולרית ומחקר המפטון, Gryphon אוטומטי מערכת טיפול בנוזלים.
  3. חותם את הצלחת 96-ובכן התגבשות כדי למנוע אידוי ולאפשר את equilibration הירידה חלבון עם המאגר המאגר. אז שמור את הצלחות בחממה קריסטל-18 מעלות צלזיוס.
  4. בדוק את הצלחות 96-ובכן מעת לעת באמצעות מיקרוסקופ אור כדי לפקח קריסטל היווצרות וצמיחה.
  5. כדי להבדיל חלבון קריסטלים גבישי מלח, השתמש צבע חלבון. להוסיף 1 µL של צבע הירידה היעד. המתן כ 1 h ולאחר להתבונן במיקרוסקופ. הקריסטלים חלבון יהפוך כחול.
  6. להשתמש בתנאי התגבשות חיובי (1.5 M אמוניום סולפט, 0.1 M טריס pH 8.0) נוספת לייעל את הקריסטלים באמצעות תלוי לקפוץ שיטת אדי דיפוזיה. ובכן 24 צלחות.
    1. מיטוב pH מ- 7.0 ל 8.5 עם 0.5 מרווח יחידת ה-pH בכל שלב. מיטוב ריכוז של אמוניום סולפט מ- 1.2 מ' עד 1.7 מ' עם מרווח 0.1 M בכל שלב. (במקרה שלנו המצב הטוב ביותר לייצר גבישים גדולים בצורת צלחת היה 0.1 M HEPES pH 7.0 ו- 1.6 מ' אמוניום סולפט)

3. קריסטל הרכבה, איסוף נתונים רנטגן ונחישות מבנה

  1. הר גבישים cryoloop ו- flash-cool בבאמצעות פתרון מאגר המכיל 20% גליצרול כמו הקפאה-תרכובת חנקן נוזלי. הניחו את הקריסטלים ב- unipuck עבור אחסון והובלה.
  2. מראש מסך קריסטלים חלבון באמצעות diffractor רנטגן שבאתר של Rigaku. לבחור את הטובים ביותר עם הרזולוציות הגבוה ביותר עבור אוסף נתוני במתקני סינכרוטרון (dataset שלנו נאסף מן BL17U1 במתקן קרינה סינכרוטרון שנגחאי).
    1. השתמש בתוכנת שליטה של הפרעות לקרן החלקיקים BluIce26 כדי לעלות על מרכז את הקריסטלים על-ידי פונקציית מרכוז אוטומטי או ידני. לבצע חשיפות מבחן כדי לקבוע את האסטרטגיה אוסף נתונים, כולל החל זווית, זמן החשיפה, גלאי מרחק, מסגרת רוחב ומספרים.
    2. איסוף הנתונים (dataset) בהתאם (שאספנו מסגרות 180 עם זמן החשיפה ' s 1 ', רוחב מסגרת 1°, המרחק גלאי של 350 מ"מ).
  3. אינדקס, לשלב ולשנות את קנה המידה של הנתונים (dataset) באמצעות סוויטת HKL200027. לבצע קודם את פונקציית החיפוש שיא כדי למצוא את הנקודות עקיפה, ולאחר מכן ליצור אינדקס המקומות ובחר הקבוצה המרחב הנכון. לאחר שיא אינטגרציה, קנה מידה את ערכת הנתונים עם המודל הנכון שגיאה ולשמור קובץ .sca הפלט.
  4. לפתור את הבעיה שלב על ידי החלפת מולקולרית באמצעות הפייזר28 ב- PHENIX29.
    1. לחשב את עותק ניתן מספר מולקולות חלבון ביחידה אסימטרי מאת Xtriage30.
    2. לחפש את התבניות מבנה תקין עם דמיון זהות מבניים רצף גבוה כמו החלבון היעד באמצעות מבנים ידועים בספרות או הדגמים שנוצרו על-ידי שרת חיזוי מבנה Phyre231 (השתמשנו ארנב RyR1 NTD כמו חיפוש מודל, 2XOA מזהה PDB).
    3. הפעל את הפייזר באמצעות קובץ הנתונים עקיפה, קובץ מבנה תבנית הקובץ רצף חלבונים כדי למצוא הפתרון.
  5. ביצוע AutoBuild32 PHENIX29 כדי לייצר את הדגם הראשוני בעזרת קובץ הפלט מ הפייזר והקובץ רצף של החלבון היעד.
  6. באופן ידני את המבנה לתוך צפיפות אלקטרונים ניסיוני ששונתה באמצעות הנרגן33 ושיפורו באמצעות phenix.refine34 מחזורים איטרטיביים.
  7. לאמת את הדגם הסופי באמצעות כלי אימות ב- PHENIX18.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

טיהור

N-מסוף בתחום DBM RyR בא לידי ביטוי כמו חלבון פיוז'ן עם תג hexahistidine, תג MBP אתר אס פרוטאז המחשוף. עקבנו אסטרטגיה טיהור חמישה צעדים כדי להשיג חלבון טהור מאוד, מתאים למטרה התגבשות. בהתחלה חלבון כימרי היה טהור מן השבר מסיסים של תא lysate לפי עמודה Ni-נ (HisTrap HP). בשלב הבא, חלבון כימרי היה נתון אס פרוטאז המחשוף, moiety hexahistidine-MBP הוסר על-ידי עמילוז שרף עמודה ואחריו עמודה Ni-נ. ת. יתר על כן, החלבון היה לטהר לפי עמודה exchange אניון (Q Sepharose HP), ולבסוף לפי עמודה ג'ל-סינון (Superdex 200 26/600). התשואה הסופית של חלבון מטוהרים מתרבות חיידקי 1 L באמצעות מדיה 2YT היתה ~ 4 מ"ג. חלבון מטוהרים הראה להקת יחיד בדף-מרחביות-kDa ~ 21 (איור 1). • תנאי האחסון מעמודה ג'ל-סינון אישר את NTD RyR מטוהרים להיות מונומר (איור 1).

התגבשות

התגבשות ראשונית ההקרנה ב 96-ובכן צלחות הניב גבישים מספר תנאים. תנאים אלה נבחרו למיטוב קריסטל ב 24 צלחות היטב. המצב האופטימלי ביותר שבו נוצרו באיכות גבוהה צלחת בצורת גבישים היה 0.1 M HEPES pH 7.0 ו- 1.6 מ' אמוניום סולפט (איור 2).

מכשור לקביעת קשיות ומבנה

קריסטלים שהושג היה diffracted ל 2.84 Å על הפרעות לקרן החלקיקים BL17U1 במתקן קרינה סינכרוטרון שנגחאי. הקריסטל באינדקס בקבוצה שטח P61 עם יחידת התא בפרמטרים = 170.13, b = 170.13, c = 51.763, α = β = ° 90.00, וγ = 120 °. לקביעת מבנה, החלפת מולקולרית הועסק באמצעות ארנב RyR1 NTD כמודל חיפוש ב- PHENIX. עידון נוספת של המבנה נעשה ב- PHENIX הסופי Rעובד ו Rחינם 21.63 ו- 24.52%, בהתאמה. הסטטיסטיקה עידון ואוסף נתונים מפורטים בטבלה 1. המבנה פתור של NTD RyR DBM המכסים את שאריות 1-205 (5Y9V מזהה PDB) מוצג באיור3.

Figure 1
איור 1: chromatogram סינון מרחביות-דף, ג'ל המייצג טיהור של DBM RyR NTD35. עמוד מרחביות (15%) בשיבוץ מראה מטוהרים DBM RyR NTD כלהקה יחיד לאחר חמשת שלב טיהור אסטרטגיה. הנתיב השמאלי מציג סמן חלבון סטנדרטית (PM). Chromatogram סינון ג'ל שהושג באמצעות עמודה Superdex 200 26/600 מראה הפסגה • תנאי-240 מ ל, המתאים הטופס monomeric של החלבון. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
באיור 2. התגבשות DBM RyR NTD35גבישים של DBM RyR NTD המיוצר על ידי שיטת אדי דיפוזיה כפי שנראה במיקרוסקופ אור. התנאי התגבשות היה 0.1 M HEPES pH 7.0 ו- 1.6 מ' אמוניום סולפט. סרגל קנה מידה = 200 מיקרומטר. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: מבנה של DBM RyR NTD (PDB לזהות 5Y9V)35פתר את המבנה של החלבון שמוצג מבין שתי תצוגות. רכיבי מבנה שניוני מסומנות. Β גדילי מוצגים סגול. סליל α סליל10 3 מוצגים בכחול. לולאות מוצגים בלבן. Nt ו- Ct מייצגים את N-מסוף, C-מסוף של החלבון, בהתאמה. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

טבלה 1: אוסף הנתונים הסטטיסטיים עידון עבור קריסטל DBM RyR NTD35. אנא לחץ כאן כדי להוריד את השולחן הזה.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

בנייר זה, אנו מתארים את ההליך כדי recombinantly express, לטהר, מתגבשים, לקבוע את המבנה של DBM RyR NTD. על התגבשות, דרישה חיונית הוא לקבל חלבונים עם מסיסות גבוהה, טוהר, הומוגניות. בפרוטוקול שלנו, בחרנו להשתמש וקטור pET-28a-HMT כפי שהוא מכיל hexahistidine תג ותג MBP, אשר שניהם יכול להיות מנוצל עבור טיהור להשיג טוהר קיפול גבוה יותר. בנוסף, של MBP תג העזרים, המסיסות החלבון היעד. אנחנו טהור החלבון על ידי חמישה שלבים עוקבים אשר הניב חלבון זה היה טהור מאוד ומתאים התגבשות. התגבשות ההקרנה בוצעה באמצעות נוזל אוטומטיות טיפול המערכת. לעומת ההקרנה המסורתית על-ידי הגדרה ידנית טיפה, מערכת אוטומטית משתמשת באמצעי אחסון קטן מאוד מדגם, חוסך זמן ואנרגיה. זה גם משפר הפארמצבטית עקב הדיוק של טיפול בנוזלים. גבישים היו diffracted פנים להקרנה, סינכרוטרון עבור איסוף נתונים כפי שהיא מספקת רנטגן בעוצמה גבוהה יותר, פחות גאוס, ובכך מניב נתונים באיכות גבוהה. החלפת מולקולרית היה הבחירה הראשונה שלנו תבניות מבנית דומה היו זמינים במסד הנתונים. הדרך החלופית היא לשימוש ניסיוני בהדרגה, כולל כועס, עצוב, מיר, וכו '

מבנה DBM RyR NTD, מקדמי מתיוס המתקבל Xtriage30 הציע כי יחידת אסימטרי (אריזונה) סביר הכיל ארבעה מונומרים עם 46% הממס תוכן, אשר יש הסתברות של 49%. עם זאת, לא הצלחנו למצוא את הפתרון הנכון עם ארבע מולקולות ב אוניברסיטת אריזונה. עוקבות לחפש שתיים, שלוש, חמש, שש מולקולות גם נכשל. בסופו של דבר מצאנו את הפתרון הנכון עם מולקולה אחת בלבד של אוניברסיטת אריזונה, שבו יש רק 4% הסתברות ותוכן מעל 86% ממס. תכולת מים גבוהה אושר לאחר שפתרנו את המבנה. לפיכך, התוכן ממס גבוה קיצוניים קיים בהתאם לאופן מהותיים בחבילות חלבונים אילו.

למרות קריסטלוגרפיה באמצעות קרני רנטגן-תקן הזהב בקביעת מבנה חלבונים, חלבונים עם הפרעה גדולה או אזורים גמישים, כמה מתחמי חלבון גדולה עם זיקה חלשה מאתגרת להתגבש. שיטות הנדסת חלבונים, כולל לולאה-חיתוך, פני השטח אנטרופיה הפחתת ו- cross-linking, עשוי לשפר את הסיכוי להשגת יותר חלבון קריסטלים. מלבד חושפני של מבנה החלבונים ברזולוציה גבוהה, קריסטלוגרפיה באמצעות קרני רנטגן יכול לשמש גם כדי ללמוד את אינטראקציות חלבון-הדברה, אשר יעזור לנו על עיצוב חומרי הדברה מבוססי מבנה. . צ'י et al. מצא כי משפחות שונות של diamides אולי לאגד ברורים אתרים שונים על פני מינים36. באמצעות האסטרטגיה שלנו, אחד יכול לקבוע את המבנים RyR ממינים רבים, לזהות את הרכיבים הייחודי אחראי species-specificity הנצפה. בסך הכל, פרוטוקול זה ניתן להתאים לקביעת מבנה התגבשות, טיהור, ביטוי של חלבונים או חלבון תחומים בכוחות עצמם או במתחם עם סמים מולקולה קטנה.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgements

מימון עבור מחקר זה נמסר על ידי: המחקר מפתח הלאומי, פיתוח תוכנית של סין (2017YFD0201400, 2017YFD0201403) הלאומי הטבע מדעי היסוד של סין (31320103922, 31230061), תוכנית פרוייקט של נבחרת מחקר בסיסי (973) סין (2015CB856500, 2015CB856504). אנחנו אסירי תודה לצוות על הפרעות לקרן החלקיקים BL17U1-מתקן קרינה סינכרוטרון שנגחאי (SSRF)

Materials

Name Company Catalog Number Comments
pET-28a-HMT vector This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain Novagen 69450-3CN
HisTrapHP column (5 mL) GE Healthcare 45-000-325
Amylose resin column New England Biolabs E8021S
Q Sepharose high-performance column  GE Healthcare 17-1154-01
Amicon concentrators (10 kDa MWCO) Millipore UFC901008
Superdex 200 26/600 gel-filtration column  GE Healthcare 28-9893-36
Automated liquid handling robotic system  Art Robbins Instruments Gryphon
96 Well CrystalQuick Greiner bio-one 82050-494
Uni-Puck Molecular Dimensions MD7-601
Mounted CryoLoop - 20 micron Hampton Research HR4-955
CryoWand Molecular Dimensions MD7-411
Puck dewar loading tool Molecular Dimensions MD7-607
Nano drop Thermo Scientific NanoDrop One
Crystal incubator Molecular Dimensions MD5-605
X-Ray diffractor Rigaku FRX
PCR machine Eppendorf Nexus GX2
Plasmid mini-prep kit Qiagen 27104
Gel extraction kit Qiagen 28704
SspI restriction endonuclease NEB R0132S
T4 DNA polymerase Novagen 2868713
Kanamycin Scientific Chemical 25389940
IPTG Genview 367931
HEPES Genview 7365459
β-mercaptoethanol Genview 60242
Centrifuge Thermo Scientific Sorvall LYNX 6000 
Sonnicator Scientz II-D
Protein purification system GE Healthcare Akta Pure
Light microscope Nikon SMZ745
IzIt crystal dye Hampton Research HR4-710
Electrophoresis unit Bio-Rad 1658005EDU
Shaker Incubator Zhicheng ZWYR-D2401
Index crystal screen Hampton Research HR2-144
Structure crystal screen Molecular Dimensions MD1-01
ProPlex crystal screen Molecular Dimensions MD1-38
PACT premier crystal screen Molecular Dimensions MD1-29
JCSG-plus crystal screen Molecular Dimensions MD1-37

DOWNLOAD MATERIALS LIST

References

  1. Giannini, G., Sorrentino, V. Molecular structure and tissue distribution of ryanodine receptors calcium channels. Medicinal Research Reviews. 15, (4), 313-323 (1995).
  2. Takeshima, H., et al. Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster. FEBS Letters. 337, (1), 81-87 (1994).
  3. Sattelle, D. B., Cordova, D., Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebrate Neuroscience. 8, (3), 107-119 (2008).
  4. Steinbach, D., et al. Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella. Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).
  5. Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China. Pest Management Science. 69, (5), 661-665 (2013).
  6. Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae). Journal of Economic Entomology. 108, (4), 1978-1985 (2015).
  7. Guo, L., et al. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Management Science. 70, (7), 1083-1089 (2014).
  8. Troczka, B., et al. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochemistry and Molecular Biology. 42, (11), 873-880 (2012).
  9. Roditakis, E., et al. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).
  10. Borko, L., et al. Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias. Acta Crystallographica Section D. 70, (Pt 11), 2897-2912 (2014).
  11. Sharma, P., et al. Structural determination of the phosphorylation domain of the ryanodine receptor. FEBS Journal. 279, (20), 3952-3964 (2012).
  12. Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface. Nature Communications. 4, 1506 (2013).
  13. Lau, K., Van Petegem, F. Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain. Nature Communications. 5, 5397 (2014).
  14. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  15. Lobo, P. A., Van Petegem, F. Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations. Structure. 17, (11), 1505-1514 (2009).
  16. des Georges, A., et al. Structural Basis for Gating and Activation of RyR1. Cell. 167, (1), 145-157 (2016).
  17. Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. Architecture and conformational switch mechanism of the ryanodine receptor. Nature. 517, (7532), 39-43 (2015).
  18. Peng, W., et al. Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2. Science. 354, (6310), (2016).
  19. Wei, R. S., et al. Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1. Cell Research. 26, (9), 977-994 (2016).
  20. Yan, Z., et al. Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution. Nature. 517, (7532), 50-55 (2015).
  21. Zalk, R., et al. Structure of a mammalian ryanodine receptor. Nature. 517, (7532), 44-49 (2015).
  22. Furlong, M. J., Wright, D. J., Dosdall, L. M. Diamondback moth ecology and management: problems, progress, and prospects. Annual Review of Entomology. 58, 517-541 (2013).
  23. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  24. Lobo, P. A., Van Petegem, F. Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations. Structure. 17, (11), 1505-1514 (2009).
  25. Aslanidis, C., de Jong, P. J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Research. 18, (20), 6069-6074 (1990).
  26. Stepanov, S., et al. JBluIce-EPICS control system for macromolecular crystallography. Acta Crystallographica Section D. 67, (3), 176-188 (2011).
  27. Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes. Acta Crystallographica Section D. 62, (Pt 8), 859-866 (2006).
  28. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40, (Pt 4), 658-674 (2007).
  29. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D. 66, (Pt 2), 213-221 (2010).
  30. Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation. CCP4 Newsletter. (43), 27-35 (2005).
  31. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 10, (6), 845-858 (2015).
  32. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D. 64, (Pt 1), 61-69 (2008).
  33. Emsley, P., Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallographica Section D. 60, 2126-2132 (2004).
  34. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallographica Section D. 68, (Pt 4), 352-367 (2012).
  35. Lin, L., et al. Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites. Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).
  36. Qi, S., Casida, J. E. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor. Pesticide Biochemistry and Physiology. 107, (3), 321-326 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics