Crystal struktur af den N-terminale domæne af ryanodinreceptoren fra Plutella xylostella

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

I denne artikel vil beskrive vi protokoller af protein udtryk, rensning, krystallisering og struktur bestemmelse af domænet N-terminalen af ryanodinreceptoren fra diamondback moth (Plutella xylostella).

Cite this Article

Copy Citation | Download Citations

Nayak, B. C., Wang, J., Lin, L., He, W., You, M., Yuchi, Z. Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella. J. Vis. Exp. (141), e58568, doi:10.3791/58568 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Udviklingen af potente og effektive insekticider målretning insekt ryanodine receptorer (RyRs) har været af stor interesse i området med landbrugs skadedyr. Indtil flere diamide insekticider rettet mod skadedyr RyRs har været kommercialiseret, som generere en årlig omsætning på 2 milliarder amerikanske dollars. Men forståelse af virkningsmekanismen af RyR-targeting insekticider er begrænset af manglen strukturelle oplysninger om insekt RyR. Dette begrænser igen forståelse af udviklingen af insekticidresistens hos skadedyr. Diamondback moth (DBM) er en ødelæggende skadedyr ødelægge korsblomstrede afgrøder på verdensplan, som er også blevet rapporteret til at vise modstand mod diamide insekticider. Derfor er det af stor praktisk betydning at udvikle roman insekticider målretning DBM RyR, især rettet mod en region adskiller sig fra den traditionelle diamide bindingssted. Vi præsenterer her, en protokol for at strukturelt karakterisere domænet N-terminalen af RyR fra DBM. X-ray krystalstruktur blev løst af molekylære udskiftning ved en opløsning af 2,84 Å, som viser en beta-kløverblad folde motiv og en flankerende alpha helix. Denne protokol kan tilpasses til udtryk, rensning og strukturel karakterisering af andre domæner eller proteiner i almindelighed.

Introduction

Ryanodine receptorer (RyRs) er specifikke Ionkanaler, der mægle gennemtrængning af Ca2 + ioner på tværs af sarcoplasmic reticulum (SR) membranerne i muskelceller. Derfor, de spiller en vigtig rolle i excitation sammentrækning kobling proces. I den funktionelle form, RyR samler som en homo-tetramer med en molekylvægt > 2 MDa, med hver underenhed bestående af ~ 5000 aminosyrerester. Der er tre isoformer i pattedyr,: RyR1 - skeletmuskulatur type, RyR2 - hjertemuskulaturen type og RyR3-allestedsnærværende udtrykt i forskellige væv1.

I insekter er der kun én type af RyR, som er udtrykt i muskel- og nerve væv2. Insekt RyR er mere ligner pattedyr RyR2 med en sekvens identitet omkring 47%3. Diamide insekticider målretning RyR af Lepidoptera og Coleoptera har udviklet og markedsført af store selskaber som Bayer (flubendiamid), DuPont (chlorantraniliprole) og Syngenta (cyantraniliprole). Siden lanceringen relativt nylige er diamide insekticider blevet en af de hurtigst voksende klasse af insekticider. I øjeblikket har salget af disse tre insekticider årligt krydsede 2 milliarder amerikanske dollars med en vækst på mere end 50% siden 2009 (Agranova).

Nylige undersøgelser har rapporteret af udvikling af resistens i insekter efter et par generationer af brugen af disse insekticider4,5,6,7,8. Modstand mutationerne i domænet transmembrane af RyRs fra diamondback moth (DBM), Plutella xylostella (G4946E, I4790M) og de tilsvarende positioner i tomat leafminer, Tuta absoluta (G4903E, I4746M) viser, at regionen kunne være involveret i diamide insekticid bindende, da denne region er kendt for at være afgørende for gating af channel4,8,9. Trods omfattende forskning på dette område fortsat de præcise molekylære mekanismer af diamide insekticider undvigende. Derudover er det uklart om modstand mutationer påvirker interaktioner med diamides direkte eller allosterically.

Tidligere undersøgelser har rapporteret adskillige RyR domæner fra pattedyrarter struktur og strukturen i fuld længde pattedyr RyR1 og RyR2 af røntgenkrystallografi og kryo-elektronmikroskopi, henholdsvis10,11, 12,13,14,15,16,17,18,19,20,21 . Men hidtil har ingen struktur af insekt RyR er blevet rapporteret, som forbyder os at forstå de molekylære snørklede af funktionen receptor samt de molekylære virkningsmekanismer insekticid og udvikling af insekticidresistens.

I dette manuskript præsenterer vi en generaliseret protokol for strukturel karakterisering af N-terminale β-kløverblad domæne af ryanodinreceptoren fra diamondback møl, en ødelæggende skadedyr inficerer korsblomstrede afgrøder på verdensplan22. Konstruktionen blev designet ud fra den offentliggjorte kanin RyR1 NTD krystal strukturer23,24og den cryo-EM strukturelle modeller16,17,18,19, 20 , 21. det er den første kodebaseret struktur rapporteret for insekt RyR, som afslører mekanismen for kanal gating og giver en vigtig skabelon for udviklingen af artsspecifikke insekticider ved hjælp af struktur-baseret drug design. For struktur udredning ansat vi røntgenkrystallografi, der betragtes som den "gyldne standard" for protein struktur bestemmelse på nær atomic opløsning. Selvom krystallisering processen er uforudsigelige og arbejdsintensive, vil denne trinvise protokol hjælpe forskerne med at udtrykke, rense og karakterisere andre domæner af insekt RyR eller nogen andre proteiner i almindelighed.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. gen kloning, Protein udtryk og rensning

  1. PCR forstærke DNA svarer til protein af interesse (rester 1-205 af DBM RyR, Genbank acc. nr. AFW97408) og klon til pET-28a-HMT vektor af ligatur-uafhængig kloning (LIC)25. Denne vektor indeholder en histidin tag, MBP tag og en TEV protease kavalergang site på N-terminus15.
    1. Design LIC primere for forstærkning af target gen med LIC-kompatible 5' udvidelser:
      Videresende LIC primer:
      5' TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3'
      Omvendt LIC primer:
      5' TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3'
    2. Kombinerer komponenterne reaktion (50 μl): 1 μL af DNA skabeloner (100 ng/μl), 1 μL fremad primer (10 μM), 1 μL af reverse primer (10 μM), 0,5 μl DNA polymerase (NEB), 5 μl af 10 x reaktion buffer, 1 μL dNTP (25 mM) , 40,5 μL af RNase gratis ddH2O.
      1. Placer reaktionsblandingen i en PCR-maskine og køre følgende program.
      2. Der inkuberes ved 95 ° C i 3 min, og derefter køre 30 cyklusser af (95 ° C til 30 s, 58 ° C i 15 s, 72 ° C i 1 min). Der inkuberes ved 72 ° C i 5 min og derefter holde ved 4 ° C.
      3. Køre hele reaktion mix (50 μl) på en 2%-agarosegel og uddrag med en Gel udvinding Kit. Følg producentens protokol.
    3. Ligatur-uafhængig kloning (LIC)
      1. Udføre SspI fordøjelsen (60 μl): 20 μL af vektor DNA (50 ng/μl), 6 μl af 10 x reaktion buffer, 4 μL af SspI og 30 μL af Hedeselskabet2O. Incubate ved 37 ° C i 3 h. køre hele reaktionen mix på 1% agarosegel og uddrag med en Gel udvinding Kit. Følg producentens protokol.
      2. Udføre T4 DNA Polymerase behandling af vektoren og indsætte DNA. Kombinere følgende: 5 μl af vektor eller Indsæt DNA (50 ng/μl), 2 μl af 10 x T4 DNA Polymerase Buffer, 1 μL dGTP (25 mM) for vektor eller 1 μL dCTP (25 mM) for Indsæt DNA, 1 μL af DTT (100 mM), 0,4 μL af T4 DNA Polymerase (LIC-kvalificeret) , og 9,6 μL af Hedeselskabet2O. Incubate reaktioner ved stuetemperatur til 40 min. varme-inaktivere enzym ved 75 ° C i 20 min.
        Bemærk: LIC vektor og insert DNA skal behandles i særskilt reaktioner.
      3. Udføre LIC udglødning reaktion. Kombinere følgende: 2 μl af T4-behandlede Indsæt DNA, 2 μl af T4-behandlede LIC vektor DNA. Inkuber reaktion ved stuetemperatur i 10 min.
  2. Omdanne BL21 (DE3) E. coli celler med denne rekombinant plasmid.
    1. Tø kompetente celler (50 μl i micro-centrifugerør) på is.
    2. Tilsæt ca 1 μL (50 ng) af plasmid ind i røret. Bland celler og DNA af forsigtigt svippede røret 2 – 3 gange. Røret anbringes i isbad i 20 min.
    3. Varme chok på 42 ° C til 40 s. sted rør på is igen for 2 min. Tilføj 1 mL stuetemperatur LB medier til røret.
    4. Sted blanding røret i 250 rpm shaker ved 37 ° C i 45 min. sprede 150 – 200 µL af blandingen på udvalg plader. Vend pladen og der inkuberes natten over ved 37 ° C.
  3. Vælge en enkelt koloni og kultur celler i 100 mL 2YT medium indeholdende 50 µg/mL kanamycin ved 37 ° C natten over. Næste morgen, podes 1 L 2YT medium indeholdende 50 µg/mL kanamycin med 10 mL af overnight kultur og Inkuber i 37 ° C shaker inkubator ved 250 rpm, indtil OD600 når ~ 0,6. Derefter fremkalde kultur med IPTG til en endelig koncentration på 0,4 mM og vokse i en anden 5 timer ved 30 ° C.
  4. Høste cellerne ved centrifugering ved 8.000 x g i 10 min. ved 4 ° C, indsamle cellerne og resuspend hver 10 g celler i 40 mL lysisbuffer (10 mM HEPES pH 7,4, 250 mM KCl, 10 mM β-mercaptoethanol, 25 μg/mL Lysozym, 25 μg/mL DNase 1 mM PMSF).
    1. Forstyrre det ved hjælp af sonikering på 65% amplitude i 8 min. med 1 s på og 1 s off. Fjerne celle debris ved centrifugering ved 40.000 x g i 30 min. ved 4 ° C. Filtrer supernatanten ved at passere gennem 0,22 μm filter og indlæse den på prøve loop.
  5. Rense fusion protein, spaltes til tag og igen rense target proteinet.
    1. Rense fusion protein ved hjælp af Ni-NTA kolonne (binding buffer: 10 mM HEPES pH 7,4, 250 mM KCl; eluering buffer: 10 mM HEPES pH 7,4, 250 mM KCl, 500 mM imidazol) og rense ved en luftrensning system, med en lineær gradient af 20-250 mM imidazol.
    2. Kløver elueret target proteinet med TEV protease (1:50 ratio) natten over ved 4 ° C.
    3. Rense kavalergang reaktionsblanding ved hjælp af amylose harpiks kolonne (binding buffer: 10 mM HEPES pH 7,4, 250 mM KCl; eluering buffer: 10 mM HEPES pH 7,4, 250 mM KCl, 10 mM maltose) og Ni-NTA kolonne til at fjerne tag og TEV protease. Target proteinet bliver i gennemstrømnings-brøkdel af disse to kolonner.
    4. Dialyze prøve mod dialyse buffer (10 mM Tris-HCl pH 8,8, 50 mM KCl, 10 mM β-mercaptoethanol til at reducere den saltkoncentration. Rense prøve på en anion Ionbytterkolonnen (binding buffer: 10 mM Tris-HCl pH 8,8, 10 mM β-mercaptoethanol; eluering buffer: 10 mM Tris-HCl pH 8,8, 1 M KCl, 10 mM β-mercaptoethanol) ved en lineær gradient 20-500 mm KCl i eluering buffer.
    5. Som et sidste skridt i rensningsprocessen, koncentrere protein ved hjælp af centrifugal koncentrator (10 kDa MWCO) og indsprøjtes i en Superdex 200 26/600 gel-filtrering kolonne for at kontrollere homogeniteten.
  6. Undersøge renheden af protein ved at køre det på en 15% SDS side.
    Bemærk: Alle kolonner kører på et protein luftrensning system med en bindende strømningshastigheden af 2 mL/min., og en eluering flow af 4 mL/min med undtagelse af gel-filtrering på 1 mL/min.

2. protein forberedelse og krystallisering

  1. Koncentrere oprenset protein prøven til 10 mg/mL ved hjælp af centrifugal koncentrator (10 kDa MWCO) og buffer exchange til krystallisering buffer før opbevaring ved-80 ° C.
  2. Udføre krystallisering screening (1:1 ratio, 200 nL af protein og 200 nL reservoir buffer) af mødet drop vapor diffusion metode på 295 K med flere krystallisering kits ved hjælp af en automatiseret væske håndtering robotic system i en 96-brønds format.
    Bemærk: Vi brugte kits fra molekylære dimensioner og Hampton forskning og Gryphon automatiseret flydende håndtering system.
  3. Forsegle 96-brønd krystallisering plade for at undgå fordampning og aktiverer ækvilibrering af protein drop med reservoir buffer. Derefter holde pladerne i crystal inkubator ved 18 ° C.
  4. Tjek de 96-brønd plader med jævne mellemrum ved hjælp af et lysmikroskop for at overvåge crystal dannelse og vækst.
  5. For at differentiere protein krystaller fra salt krystaller, bruge et protein farvestof. Tilføj 1 µL af farvestof til target drop. Vent i ca 1 time og observere under mikroskop. Protein krystaller bliver blå.
  6. Brug positiv krystallisering betingelser (1,5 M ammoniumsulfat, 0,1 M Tris pH 8,0) til yderligere optimere krystallerne ved hjælp af hængende slip damp-diffusion metode i 24-godt plader.
    1. Optimere pH fra 7.0 til 8,5 med 0,5 pH-enhed interval hvert skridt. Optimere koncentration af ammonium sulfat fra 1,2 M til 1,7 M med 0,1 M interval hvert skridt. (I vores tilfælde den bedste betingelse producerer store plade-formede krystaller var 0,1 M HEPES pH 7,0 og 1,6 M ammoniumsulfat)

3. krystal montering, X-Ray dataindsamling og struktur bestemmelse

  1. Montere krystaller i en cryoloop og flash-cool i flydende kvælstof ved hjælp af reservoir løsning indeholdende 20% glycerol som cryo-protectant. Placere krystaller i unipuck til opbevaring og transport.
  2. Pre-skærm protein krystaller ved hjælp af en Rigaku in-house X-ray diffractor. Vælge de bedste af dem med de højeste opløsninger for dataindsamling på synkrotron faciliteter (vores datasæt blev indsamlet fra BL17U1 på Shanghai synkrotron stråling facilitet).
    1. Brug beamline control software BluIce26 til at montere og center krystaller af automatisk eller manuel centrering funktion. Udføre test engagementer for at bestemme data indsamling strategi, herunder indlede vinkel, eksponeringstid, detektor afstand, ramme bredde og tal.
    2. Indsamle datasæt i overensstemmelse hermed (vi indsamlet 180 rammer med 1 s eksponeringstid, 1° ramme bredde og detektor afstand på 350 mm).
  3. Indeks, integrere og skalere det datasæt, der bruger HKL2000 suite27. Først gennemfører peak søgefunktion til at finde diffraktion steder, og derefter indeksere steder og vælg den rigtige plads. Efter peak integration, skalere datasæt med rette fejl model og gemme filen .sca.
  4. Fase løses ved Molekylær udskiftning ved hjælp af Phaser28 i PHENIX29.
    1. Beregne mulige kopi antallet af proteinmolekyler i den asymmetriske enhed ved Xtriage30.
    2. Ser for de rette struktur skabeloner med høj sekvens identitet og strukturelle lighed som target proteinet ved hjælp af kendte strukturer fra litteratur eller de modeller, der er genereret af struktur forudsigelse server såsom Phyre231 (vi brugte kanin RyR1 NTD som en søgemodel, PDB ID 2XOA).
    3. Køre Phaser ved hjælp af diffraktion datafil, struktur skabelonfil og protein sekvens fil for at finde løsningen.
  5. Udføre AutoBuild32 i PHENIX29 til at generere den oprindelige model ved hjælp af den output fra Phaser og filen sekvens fra target proteinet.
  6. Manuelt opbygge strukturen i den modificerede eksperimentelle elektron tæthed ved hjælp af Blishøne33 og forfine ved hjælp af phenix.refine34 i iterative cyklusser.
  7. Validere den endelige model ved hjælp af værktøjerne til validering i PHENIX18.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Rensning

Domænet N-terminalen af DBM RyR blev udtrykt som en fusion protein med en hexahistidine tag, en MBP tag og en TEV protease kavalergang site. Vi fulgte en fem-trins rensning strategi for at opnå en meget ren protein, egnet til krystallisering formål. I første omgang, var fusion protein renset fra den vandopløselige fraktion af celle lysate af Ni-NTA kolonne (HisTrap HP). Næste, fusion protein blev udsat for TEV protease kavalergang og hexahistidine-MBP gruppe blev fjernet af amylose harpiks kolonne efterfulgt af Ni-NTA kolonne. Yderligere, at protein var renset af anion Ionbytterkolonnen (Q Sepharose HP) og endelig af gel-filtrering kolonne (Superdex 200 26/600). Det endelige udbytte af oprenset protein fra 1 L bakteriekultur ved hjælp af 2YT media var ~ 4 mg. Den renset protein viste en enkelt band på SDS-PAGE på ~ 21 kDa (figur 1). Eluering volumen fra gel-filtrering kolonne bekræftet den renset RyR NTD for at være en monomer (figur 1).

Krystallisering

Indledende krystallisering screening i 96-brønd plader givet krystaller i flere forhold. Disse betingelser blev udvalgt til crystal optimering i 24 godt plader. Den mest optimale tilstand hvor høj kvalitet plade-formet krystaller blev dannet var 0,1 M HEPES pH 7,0 og 1,6 M ammoniumsulfat (figur 2).

Struktur bestemmelse

Krystaller opnået var diffrakteres til 2,84 Å på beamline BL17U1 på Shanghai synkrotron stråling facilitet. Krystal var indekseret i rummet gruppe P61 med enhed-celle parametre en = 170.13, b = 170.13, c = 51.763 Å, α = β = 90,00 °, γ = 120 °. Til bestemmelse af struktur, var Molekylær udskiftning ansat ved hjælp af kanin RyR1 NTD som en søgemodel i PHENIX. Yderligere finjustering af strukturen blev gjort i PHENIX til en afsluttende Rarbejde og Rfri af 21.63 og 24.52%, henholdsvis. Data indsamling og raffinement statistikker er angivet i tabel 1. Løst strukturen af DBM RyR NTD dækker rester 1-205 (PDB ID 5Y9V) er vist i figur 3.

Figure 1
Figur 1: SDS-PAGE og gel filtrering kromatogrammet repræsenterer rensning af DBM RyR NTD35. SDS side (15%) i indsatsen viser renset DBM RyR NTD som en enkelt band efter de fem trin rensning strategi. Den venstre vognbane viser standard protein markør (PM). Gel filtrering kromatogrammet fremstillet ved hjælp af en Superdex 200 26/600 kolonne viser eluering peak på 240 mL, hvilket svarer til monomere form af proteinet. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2. Krystallisering af DBM RyR NTD35Krystaller af DBM RyR NTD produceret af damp-diffusion metode som set under et lysmikroskop. Krystallisering betingelse var 0,1 M HEPES pH 7,0 og 1,6 M ammoniumsulfat. Skalalinjen = 200 µm. venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: Struktur af DBM RyR NTD (PDB ID 5Y9V)35Løst strukturen af proteinet vist fra to synspunkter. Sekundær struktur elementer er mærket. Β tråde er vist i lilla. Α helix og en 310 helix er vist med blåt. Sløjfer er vist i hvid. NT og Ct repræsenterer den N-terminal og C-terminalen af proteinet, henholdsvis. Venligst klik her for at se en større version af dette tal.

Tabel 1: Data indsamling og raffinement statistikker for dødbrændt Magnesia RyR NTD krystal35. Venligst klik her for at downloade denne tabel.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

I dette papir beskrive vi proceduren for recombinantly express, rense, krystallisere og bestemme strukturen af DBM RyR NTD. For krystallisering er et afgørende krav at få proteiner med høj opløselighed, renhed og homogenitet. I vores protokol valgte vi at bruge pET-28a-HMT vektor, da det indeholder et hexahistidine tag og MBP tag, som begge kunne udnyttes til rensning at opnå en højere fold renhed. Derudover MBP tag hjælpemidler i opløseligheden af target proteinet. Vi rensede protein af fem på hinanden følgende trin, der gav protein, der var meget ren og egnet til krystallisering. Krystallisering screening blev udført ved hjælp af automatiserede væske håndtering system. Sammenlignet med traditionelle screening af manuel drop indstilling, automatiseret system bruger meget små mængder af prøven, sparer tid og energi. Det øger også reproducerbarhed på grund af nøjagtigheden af flydende håndtering. Krystaller var diffrakteres in-house for screening og på synkrotron for dataindsamling da det giver x-ray med højere intensitet og mindre divergens, hvilket giver data af høj kvalitet. Molekylær udskiftning var vores første valg som lignende strukturelle skabeloner var tilgængelige i databasen. Den alternativ metode er at bruge eksperimentelle udfasning, herunder MAD, SAD, MIR, osv.

Mens løse strukturen af DBM RyR NTD, Matthews koefficienter fra Xtriage30 foreslog, at den asymmetriske enhed (ASU) allersnarest indeholdt fire monomerer med 46% opløsningsmiddel indhold, som har en sandsynlighed på 49%. Men vi kunne ikke finde den rigtige løsning med fire molekyler i ASU. Efterfølgende løber hen til kigge efter to, tre, fem, seks molekyler også mislykkedes. Til sidst fandt vi den rigtige løsning med kun ét molekyle i ASU, som kun har 4% sandsynlighed og over 86% opløsningsmidler indhold. Højt vandindhold blev bekræftet efter vi løst strukturen. Således eksisterer den ekstrem høje opløsningsmiddel indhold afhængigt af den iboende måde, hvilke protein pakker.

Selvom røntgenkrystallografi er en guld-standard i protein struktur bestemmelse, er proteiner med stor lidelse eller fleksible regioner og nogle store proteinkomplekser med svag affinitet udfordrende for at krystallisere. Protein engineering metoder, herunder loop-trunkering, overflade entropi reduktion og danne tvaerbindinger, kan forbedre chancen for at opnå bedre protein krystaller. Udover afslørende af høj opløsning proteinstrukturer kan røntgenkrystallografi også bruges til at undersøge protein-pesticiders vekselvirkning, som ville hjælpe os på struktur-baseret pesticider design. Qi et al. fandt, at forskellige familier af diamides kan binde til forskellige websteder, der er forskellige på tværs af arter36. Ved hjælp af vores strategi, kan man bestemme RyR strukturer fra flere arter og identificere de unikke elementer, der er ansvarlig for de observerede species-specificity. Samlet set kan denne protokol tilpasses til udtryk, rensning, krystallisering og struktur bestemmelse af proteiner eller protein domæner af sig selv eller i kompleks med lille molekyle narkotika.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgements

Finansieringen af denne forskning blev leveret af: nationale nøglen forskning og udvikling Program af Kina (2017YFD0201400, 2017YFD0201403), National karakter Science Foundation of China (31320103922, 31230061) og projekt af nationale grundlæggende forskning (973) Program af Kina (2015CB856500, 2015CB856504). Vi er taknemmelige for personale på beamline BL17U1 på Shanghai synkrotron stråling facilitet (SSRF).

Materials

Name Company Catalog Number Comments
pET-28a-HMT vector This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain Novagen 69450-3CN
HisTrapHP column (5 mL) GE Healthcare 45-000-325
Amylose resin column New England Biolabs E8021S
Q Sepharose high-performance column  GE Healthcare 17-1154-01
Amicon concentrators (10 kDa MWCO) Millipore UFC901008
Superdex 200 26/600 gel-filtration column  GE Healthcare 28-9893-36
Automated liquid handling robotic system  Art Robbins Instruments Gryphon
96 Well CrystalQuick Greiner bio-one 82050-494
Uni-Puck Molecular Dimensions MD7-601
Mounted CryoLoop - 20 micron Hampton Research HR4-955
CryoWand Molecular Dimensions MD7-411
Puck dewar loading tool Molecular Dimensions MD7-607
Nano drop Thermo Scientific NanoDrop One
Crystal incubator Molecular Dimensions MD5-605
X-Ray diffractor Rigaku FRX
PCR machine Eppendorf Nexus GX2
Plasmid mini-prep kit Qiagen 27104
Gel extraction kit Qiagen 28704
SspI restriction endonuclease NEB R0132S
T4 DNA polymerase Novagen 2868713
Kanamycin Scientific Chemical 25389940
IPTG Genview 367931
HEPES Genview 7365459
β-mercaptoethanol Genview 60242
Centrifuge Thermo Scientific Sorvall LYNX 6000 
Sonnicator Scientz II-D
Protein purification system GE Healthcare Akta Pure
Light microscope Nikon SMZ745
IzIt crystal dye Hampton Research HR4-710
Electrophoresis unit Bio-Rad 1658005EDU
Shaker Incubator Zhicheng ZWYR-D2401
Index crystal screen Hampton Research HR2-144
Structure crystal screen Molecular Dimensions MD1-01
ProPlex crystal screen Molecular Dimensions MD1-38
PACT premier crystal screen Molecular Dimensions MD1-29
JCSG-plus crystal screen Molecular Dimensions MD1-37

DOWNLOAD MATERIALS LIST

References

  1. Giannini, G., Sorrentino, V. Molecular structure and tissue distribution of ryanodine receptors calcium channels. Medicinal Research Reviews. 15, (4), 313-323 (1995).
  2. Takeshima, H., et al. Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster. FEBS Letters. 337, (1), 81-87 (1994).
  3. Sattelle, D. B., Cordova, D., Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebrate Neuroscience. 8, (3), 107-119 (2008).
  4. Steinbach, D., et al. Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella. Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).
  5. Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China. Pest Management Science. 69, (5), 661-665 (2013).
  6. Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae). Journal of Economic Entomology. 108, (4), 1978-1985 (2015).
  7. Guo, L., et al. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Management Science. 70, (7), 1083-1089 (2014).
  8. Troczka, B., et al. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochemistry and Molecular Biology. 42, (11), 873-880 (2012).
  9. Roditakis, E., et al. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).
  10. Borko, L., et al. Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias. Acta Crystallographica Section D. 70, (Pt 11), 2897-2912 (2014).
  11. Sharma, P., et al. Structural determination of the phosphorylation domain of the ryanodine receptor. FEBS Journal. 279, (20), 3952-3964 (2012).
  12. Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface. Nature Communications. 4, 1506 (2013).
  13. Lau, K., Van Petegem, F. Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain. Nature Communications. 5, 5397 (2014).
  14. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  15. Lobo, P. A., Van Petegem, F. Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations. Structure. 17, (11), 1505-1514 (2009).
  16. des Georges, A., et al. Structural Basis for Gating and Activation of RyR1. Cell. 167, (1), 145-157 (2016).
  17. Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. Architecture and conformational switch mechanism of the ryanodine receptor. Nature. 517, (7532), 39-43 (2015).
  18. Peng, W., et al. Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2. Science. 354, (6310), (2016).
  19. Wei, R. S., et al. Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1. Cell Research. 26, (9), 977-994 (2016).
  20. Yan, Z., et al. Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution. Nature. 517, (7532), 50-55 (2015).
  21. Zalk, R., et al. Structure of a mammalian ryanodine receptor. Nature. 517, (7532), 44-49 (2015).
  22. Furlong, M. J., Wright, D. J., Dosdall, L. M. Diamondback moth ecology and management: problems, progress, and prospects. Annual Review of Entomology. 58, 517-541 (2013).
  23. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  24. Lobo, P. A., Van Petegem, F. Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations. Structure. 17, (11), 1505-1514 (2009).
  25. Aslanidis, C., de Jong, P. J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Research. 18, (20), 6069-6074 (1990).
  26. Stepanov, S., et al. JBluIce-EPICS control system for macromolecular crystallography. Acta Crystallographica Section D. 67, (3), 176-188 (2011).
  27. Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes. Acta Crystallographica Section D. 62, (Pt 8), 859-866 (2006).
  28. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40, (Pt 4), 658-674 (2007).
  29. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D. 66, (Pt 2), 213-221 (2010).
  30. Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation. CCP4 Newsletter. (43), 27-35 (2005).
  31. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 10, (6), 845-858 (2015).
  32. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D. 64, (Pt 1), 61-69 (2008).
  33. Emsley, P., Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallographica Section D. 60, 2126-2132 (2004).
  34. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallographica Section D. 68, (Pt 4), 352-367 (2012).
  35. Lin, L., et al. Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites. Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).
  36. Qi, S., Casida, J. E. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor. Pesticide Biochemistry and Physiology. 107, (3), 321-326 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics