Crystal struktur av N-terminal domenet av Ryanodine reseptoren fra Plutella xylostella

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

I denne artikkelen beskrive vi protokoller av protein uttrykk, rensing, krystallisering og struktur fastsettelse av N-terminal domenet ryanodine reseptoren fra diamondback møll (Plutella xylostella).

Cite this Article

Copy Citation | Download Citations

Nayak, B. C., Wang, J., Lin, L., He, W., You, M., Yuchi, Z. Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella. J. Vis. Exp. (141), e58568, doi:10.3791/58568 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Utvikling av potente og effektive insektmidler målretting insekt ryanodine reseptorer (RyRs) har vært av stor interesse innen landbruk skadedyrbekjempelse. Hittil har flere diamide insektmidler målretting pest RyRs har blitt kommersialisert, som genererer årlig omsetning på 2 milliarder amerikanske dollar. Men forståelse av modusen for handling av RyR målretting insektmidler er begrenset av mangel på strukturelle informasjon om insekt RyR. Dette begrenser igjen forståelse av utviklingen av insektmiddel motstand i skadedyr. Diamondback møll (DBM) er en ødeleggende pest ødelegge cruciferous avlinger over hele verden, som har også blitt rapportert å vise motstand mot diamide insektmidler. Derfor er det av stor praktisk betydning å utvikle romanen insektmidler målretting DBM RyR, spesielt rettet mot en region forskjellig fra det tradisjonelle diamide binding området. Her presenterer vi en protokoll strukturelt betegner N-terminal domenet RyR fra DBM. Krystallstruktur x-ray ble løst av molekylære erstatning oppløsning av 2.84 Å, som viser en beta-trefoil folding motiv og en flankemanøveren alpha helix. Denne protokollen kan tilpasses for uttrykket, rensing og strukturelle karakteristikk av andre domener eller proteiner generelt.

Introduction

Ryanodine reseptorer (RyRs) er bestemt ionekanaler, som megle gjennomtrengning av Ca2 + ioner over sarcoplasmic retikulum (SR) membraner i muskelceller. Derfor spille de en viktig rolle i magnetisering sammentrekning kopling prosessen. I sin funksjonelle form, RyR samler som en homo-tetramer med en molekylær masse > 2 MDa, med hver delenhet bestående av ~ 5000 aminosyre rester. I pattedyr, finnes det tre isoformene: RyR1 - Skjelettmuskel type, Hjertemuskel type RyR2- og RyR3-overalt uttrykt i forskjellige vev1.

I insekter er det bare én type RyR, som er uttrykt i muskel- og nervøs vev2. Insekt RyR er mer lik pattedyr RyR2 med en sekvens identitet på ca 47%3. Diamide insektmidler målretting RyR av sommerfugler og Coleoptera er utviklet og markedsført av store selskaper som Bayer (flubendiamide), DuPont (chlorantraniliprole) og Syngenta (cyantraniliprole). Siden lanseringen relativt nylig har diamide insektmidler blitt en av de raskest voksende klassen av insektmidler. Foreløpig har salget av disse tre insektmidler årlig krysset 2 milliarder amerikanske dollar med en vekst på mer enn 50% siden 2009 (Agranova).

Nyere studier har rapportert utviklingen av motstand i insekter etter et par generasjoner av bruken av insektmidler4,5,6,7,8. Den motstand mutasjoner i transmembrane domenet av RyRs fra diamondback møll (DBM), Plutella xylostella (G4946E, I4790M) og de tilsvarende stillingene i tomat leafminer, Tuta reservatet (G4903E, I4746M) viser at regionen kan være involvert i diamide insektmiddel binding som denne regionen er kjent for å være kritisk for gating av channel4,8,9. Til tross for omfattende forskning på dette området forblir nøyaktig molekylære mekanismer av diamide insektmidler unnvikende. Videre er det uklart om motstand mutasjoner påvirker interaksjonene med diamides direkte eller allosterically.

Tidligere studier har rapportert strukturen i flere RyR domener pattedyrarter og strukturen i full lengde pattedyr RyR1 og RyR2 av Røntgenkrystallografi og cryo-elektronmikroskop, henholdsvis10,11, 12,13,14,15,16,17,18,19,20,21 . Men så langt ingen struktur av insekt RyR er rapportert, som forbyr oss fra å forstå molekylær vanskelighetene med funksjonen reseptor og molekylære mekanismer insektmiddel handling og utvikling av insektmiddel motstand.

I dette manuskriptet presenterer vi en generalisert protokoll for strukturelle karakterisering av N-terminal β-trefoil domene ryanodine reseptoren fra diamondback møll, en ødeleggende pest infisere cruciferous avlinger verdensomspennende22. Konstruer ble utviklet etter publiserte kanin RyR1 NTD krystall strukturer23,24og cryo-EM strukturelle modeller16,17,18,19, 20 , 21. Dette er første høyoppløselig strukturen rapportert insekt RyR, som avslører mekanismen for kanal gating og gir en viktig mal for utviklingen av artsspesifikke insektmidler ved hjelp av strukturen-basert stoff design. For strukturen forklaring ansatt vi Røntgenkrystallografi, som regnes som "gull standard' for protein proteinstrukturer på nær Atom løsning. Selv om krystallisering prosessen er uforutsigbare og arbeidsintensiv, vil denne trinnvise protokollen hjelpe forskere til å uttrykke, rense og karakterisere andre domener av insekter RyR eller noen andre proteiner generelt.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. gen kloning, Protein uttrykk og rensing

  1. PCR forsterke DNA tilsvarer protein av interesse (rester 1-205 av DBM RyR, Genbank iht. no. AFW97408) og klone i pET-28a-HMT vektor av hemorroider-uavhengig kloning (LIC)25. Denne vektoren inneholder en histidin kode, MBP tag og en TEV protease cleavage nettsted på N-terminus15.
    1. Design LIC primere for forsterkning av målet genet med LIC-kompatible 5 utvidelser:
      Videresend LIC primer:
      5' TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3
      Omvendt LIC primer:
      5' TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3
    2. Kombinere reaksjon komponentene (50 μL): 1 μL DNA maler (100 ng/μL), 1 μL frem primer (10 μM), 1 μL omvendt primer (10 μM), 0,5 μL DNA polymerase (NEB), 5 μL 10 x reaksjon buffer, 1 μL dNTP (25 mM) , 40.5 μL RNase gratis ddH2O.
      1. Plasser reaksjonsblandingen i et PCR-maskin og kjøre følgende program.
      2. Ruge på 95 ° C i 3 minutter, og deretter kjøre 30 sykluser av (95 ° C for 30 s, 58 ° C i 15 s, 72 ° C i 1 min). Inkuber ved 72 ° C i 5 min og holder på 4 ° C.
      3. Kjøre hele reaksjonen blanding (50 μL) på en 2% agarose gel og ekstra med en Gel utvinning Kit. Følg produsentens protokollen.
    3. Hemorroider-uavhengig kloning (LIC)
      1. Utføre SspI fordøyelse (60 μL): 20 μL vektor DNA (50 ng/μL), 6 μL 10 x reaksjon buffer, 4 μL SspI og 30 μL ddH2O. Incubate ved 37 ° C i 3 h. kjøre hele reaksjonen bland på 1% agarose gel og ekstra med en Gel utvinning Kit. Følg produsentens protokollen.
      2. Utføre T4 DNA Polymerase behandling av vektoren og sette inn DNA. Kombinere følgende: 5 μL vektor eller sett inn DNA (50 ng/μL), 2 μL 10 x T4 DNA Polymerase Buffer, 1 μL dGTP (25 mM) for vektor- eller 1 μL dCTP (25 mM) for sett inn DNA, 1 μL DTT (100 mM), 0.4 μL av T4 DNA Polymerase (LIC kvalifisert) , og 9,6 μL ddH2O. Incubate reaksjoner ved romtemperatur for 40 min. varme-Deaktiver enzym ved 75 ° C i 20 min.
        Merk: LIC vektor og sett inn DNA må behandles i separate reaksjoner.
      3. Utføre LIC annealing reaksjon. Kombinere følgende: 2 μL T4-behandlet sett inn DNA, 2 μL T4-behandlet LIC vektor DNA. Inkuber reaksjon ved romtemperatur for 10 min.
  2. Endre BL21 (DE3) E. coli celler med denne rekombinant plasmider.
    1. Tine kompetent celler (50 μL i mikro-sentrifuge tube) på is.
    2. Tilsett ca 1 μL (50 ng) av plasmider inn i røret. Bland celler og DNA ved forsiktig flicking røret 2 – 3 ganger. Sett røret på is 20 min.
    3. Varme sjokk ved 42 ° C for 40 s. sted røret på is igjen 2 min. legge 1 mL romtemperatur LB media til røret.
    4. Sted blanding røret i 250 rpm shaker på 37 ° C i 45 min. spre 150 – 200 µL av blandingen på utvalg platene. Snu platen opp ned og ruge over natten på 37 ° C.
  3. Velg en enkelt kolonien og kultur cellene i 100 mL 2YT medium som inneholder 50 µg/mL kanamycin på 37 ° C over natten. Neste morgen, vaksinere 1 L 2YT medium som inneholder 50 µg/mL kanamycin med 10 mL av natten kultur og ruge i 37 ° C shaker inkubator på 250 rpm, til OD600 når ~ 0,6. Deretter indusere kulturen med IPTG til en siste konsentrasjon av 0.4 mM og vokse for en annen 5 h på 30 ° C.
  4. Høste celler med sentrifugering 8000 x g i 10 min på 4 ° C, samle cellene og resuspend hver 10 g celler i 40 mL lyseringsbuffer (10 mM HEPES pH 7.4, 250 mM KCl, 10 mM β-mercaptoethanol, 25 μg/mL lysozyme, 25 μg/mL DNase 1 mM PMSF).
    1. Forstyrre det ved sonication på 65% amplituden i 8 min 1 s på og 1 s av. Fjerne celle rusk ved sentrifugering 40.000 x g i 30 min på 4 ° C. Filtrere nedbryting av passerer gjennom 0.22 μm filter og laste det inn prøven løkken.
  5. Rense fusion protein, cleave koden og rense re mål protein.
    1. Rense fusion protein bruke Ni-NTA kolonne (bindende buffer: 10 mM HEPES pH 7.4, 250 mM KCl; elueringsbufferen: 10 mM HEPES pH 7.4, 250 mM KCl, 500 mM imidazole) og rense av en rensing system, med en lineær gradient 20-250 mM imidazole.
    2. Cleave elut målet protein med TEV protease (1:50 forholdet) overnatting på 4 ° C.
    3. Rense reaksjonsblandingen cleavage ved å bruke amylose harpiks kolonne (bindende buffer: 10 mM HEPES pH 7.4, 250 mM KCl; elueringsbufferen: 10 mM HEPES pH 7.4, 250 mM KCl, 10 mM maltose) og Ni-NTA fjerne koden og TEV protease. Målet protein blir i gjennomflytsenhet brøkdel av disse to kolonnene.
    4. Dialyze prøven mot dialyse buffer (10 mM Tris-HCl pH 8,8, 50 mM KCl, 10 mM β-mercaptoethanol å redusere salt konsentrasjonen. Rense prøven på en anion exchange kolonne (bindende buffer: 10 mM Tris-HCl pH 8,8, 10 mM β-mercaptoethanol, elueringsbufferen: 10 mM Tris-HCl pH 8,8, 1 M KCl, 10 mM β-mercaptoethanol) av en lineær forløpning på 20-500 mM KCl i elueringsbufferen.
    5. Som et siste skritt inne rensningen forarbeide, konsentrere protein ved hjelp av sentrifugal konsentrator (10 kDa MWCO) og sette inn i en Superdex 200 26/600 gel-filtrering kolonne du homogenitet.
  6. Undersøke renheten av protein ved å kjøre den på en 15% SDS siden.
    Merk: Alle kolonner kjører på et protein rensing system med en bindende flow rate på 2 mL/min, og et elueringsrør strømningshastighet på 4 mL/min unntatt gel-filtrering på 1 mL/min.

2. protein forberedelse og krystallisering

  1. Konsentrere renset protein prøven til 10 mg/mL ved hjelp av sentrifugal konsentrator (10 kDa MWCO) og buffer exchange til krystallisering bufferen før lagring på-80 ° C.
  2. Utføre krystallisering screening (1:1 ratio, 200 nL av protein og 200 nL reservoaret bufferen) av sittende slippe damp diffusjon metoden på 295 K med flere krystallisering kits med en automatisert flytende håndtering robot-system i 96-brønnen format.
    Merk: Vi brukte kits fra molekylære mål og Hampton forskning og Gryphon automatisert flytende håndteringssystem.
  3. Forsegle 96-brønns krystallisering platen for å hindre fordampning og aktiverer balanse av protein slippe med reservoaret bufferen. Så holde platene i crystal inkubator på 18 ° C.
  4. Sjekk 96-brønns platene regelmessig bruk lys mikroskop for å overvåke dannelse av krystaller og vekst.
  5. For å skille protein krystaller fra salt krystaller, bruk en protein fargestoff. Legg 1 µL fargestoff til målet drop. Vent i ca 1 time og observere under mikroskop. Protein krystallene blir blå.
  6. Bruk positiv krystallisering betingelsene (1,5 M ammonium sulfate, 0.1 M Tris pH 8.0) ytterligere optimalisere krystallene bruker hengende damp-diffusjon metoden innom 24-og plater.
    1. Optimalisere pH fra 7.0 til 8,5 med 0,5 pH enhet intervall hvert trinn. Optimalisere konsentrasjon av ammonium sulfate fra 1,2 M til 1,7 M med 0.1 M intervall hvert trinn. (I vårt tilfelle betingelsen beste produserer store plate-formet krystaller var 0,1 M HEPES pH 7.0 og 1,6 M ammonium sulfate)

3. Crystal montering, røntgen datainnsamling og proteinstrukturer

  1. Montere krystaller i en cryoloop og flash-cool i flytende nitrogen bruker reservoaret løsning som inneholder 20% glyserol som cryo-protectant. Plass krystaller i unipuck for lagring og transport.
  2. Forhåndssortere protein krystaller bruker en Rigaku interne X-ray diffractor. Velg de beste med de høyeste oppløsningene for datainnsamling på synchrotron anlegg (våre datasett ble samlet inn fra BL17U1 på Shanghai Synchrotron stråling anlegget).
    1. Bruk av beamline programvare BluIce26 å montere og senter krystaller av automatisk eller manuell sentrering funksjonen. Utføre testen eksponeringer for å finne dataene samling strategi, inkludert starting vinkel, eksponeringstid, detektor avstand, bredden og tall.
    2. Samle dataset tilsvarende (vi samlet 180 rammer med 1 s eksponeringstid, 1° rammebredden og detektor avstanden på 350 mm).
  3. Indeksere, integrere og skalere datasettet bruker HKL2000 suite27. Utfør først topp søk-funksjonen finne Diffraksjon flekker, og deretter indeksere flekker og Velg gruppen rett plass. Etter toppen integrasjon, skala dataset med skikkelig feil modell og lagre .sca utdatafilen.
  4. Løse problemet fase av molekylære erstatning med Phaser28 i PHENIX29.
    1. Beregne mulig kopien antall protein molekyler i asymmetriske enheten ved Xtriage30.
    2. Se etter riktig struktur maler med høy sekvens identitet og strukturelle likhet som mål protein med kjente strukturer fra litteratur eller modellene generert av strukturen prediksjon server som Phyre231 (vi brukte kanin RyR1 NTD som Søk modell, PDB-ID 2XOA).
    3. Kjør Phaser bruker Diffraksjon datafilen, struktur malfilen og protein sekvens fil for å finne løsning.
  5. Utføre AutoBuild32 PHENIX29 å generere første modellen med utdatafilen fra Phaser og filen sekvens fra målet protein.
  6. Manuelt strukturen i den endrede eksperimentelle elektron tettheten bruker Kvakk33 og finjustert med phenix.refine34 i gjentakende sykluser.
  7. Validere den siste modellen ved hjelp av validering verktøyene i PHENIX18.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Rensing

N-terminal domenet DBM RyR ble uttrykt som en fusion protein med en hexahistidine kode, MBP koder og et TEV protease cleavage område. Vi fulgte en fem-trinns rensing strategi for å få en svært ren protein, egnet for krystallisering formålet. Først var fusion protein renset fra løselig brøkdel av celle lysate Ni-NTA kolonnen (HisTrap HP). Deretter fusion protein ble utsatt for TEV protease cleavage og hexahistidine-MBP moiety ble fjernet av amylose harpiks kolonnen etterfulgt av Ni-NTA kolonnen. Videre protein var renset anion exchange kolonnen (Q Sepharose HP) og til slutt etter gel-filtrering kolonne (Superdex 200 26/600). Siste avkastningen av renset protein fra 1 L bakteriell kultur ved hjelp 2YT media var ~ 4 mg. Renset protein viste en enkelt band på SDS-side på ~ 21 kDa (figur 1). Elueringsrør volumet fra gel-filtrering kolonne bekreftet den renset RyR NTD skal en monomer (figur 1).

Krystallisering

Første krystallisering screening i 96-brønnen plater gitt krystaller i flere forhold. Disse forholdene ble valgt for crystal optimalisering i 24 bra plater. Den mest optimale tilstanden hvor høy kvalitet plate-figur krystaller ble dannet var 0,1 M HEPES pH 7.0 og 1,6 M ammonium sulfate (figur 2).

Proteinstrukturer

Krystaller innhentet var diffracted å 2.84 Å på beamline BL17U1 på Shanghai Synchrotron stråling anlegget. Krystallen ble indeksert i plassen gruppen P61 enhet-cellen parametere en = 170.13, b = 170.13, c = 51.763 Å, α = β = 90,00 °, γ = 120 °. For proteinstrukturer, ble molekylær erstatning ansatt med kanin RyR1 NTD som søk modell i PHENIX. Ytterligere avgrensning av strukturen ble gjort i PHENIX en siste Rarbeide og Rgratis 21.63 og 24.52%, henholdsvis. Data innsamlings- og raffinement statistikken er oppført i tabell 1. Løst strukturen i DBM RyR NTD dekker rester 1-205 (PDB-ID 5Y9V) vises i Figur 3.

Figure 1
Figur 1: SDS side og gel filtrering chromatogram representerer rensing av DBM RyR NTD35. SDS side (15%) i rammemargen viser renset DBM RyR NTD som et enkelt band etter fem trinn rensing strategi. Venstre veibane viser standard protein markør (PM). Gel filtrering chromatogram får en Superdex 200 26/600 kolonne viser elueringsrør toppen på 240 mL, som tilsvarer monomerisk form av protein. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2. Krystallisering av DBM RyR NTD35Krystaller av DBM RyR NTD produsert av damp-diffusjon metoden sett under lys mikroskop. Betingelsen krystallisering var 0,1 M HEPES pH 7.0 og 1,6 M ammonium sulfate. Skala bar = 200 µm. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: Strukturen av DBM RyR NTD (PDB ID 5Y9V)35Løst struktur vises fra to visninger. Sekundær elementer er merket. Β tråder vises i lilla. Α helix og en 310 helix vises i blått. Løkker vises i hvitt. NT og Ct representerer N-Terminus og C-terminalen protein, henholdsvis. Klikk her for å se en større versjon av dette tallet.

Tabell 1: Data innsamlings- og raffinement statistikk for DBM RyR NTD krystall35. Klikk her for å laste ned denne tabell.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

I dette papiret beskriver vi fremgangsmåten for å recombinantly express, rense, utkrystallisere og bestemme strukturen i DBM RyR NTD. For krystallisering er et viktig krav å skaffe proteiner med høy løselighet, renhet og homogenitet. I vår protokollen valgte vi å bruke pET-28a-HMT vektor som inneholder en hexahistidine kode og MBP tag, begge kan utnyttes for rensing å få en høyere fold renhet. I tillegg MBP tag aids i Løseligheten av målet protein. Vi renset protein av fem sammenhengende trinn som hadde protein som var svært ren og egnet for krystallisering. Krystallisering screening ble utført med automatisert flytende håndteringssystem. Sammenlignet med tradisjonelle screening av manuell slipp, automatisert system bruker svært små mengder utvalg, sparer tid og energi. Det forbedrer også reproduserbarhet på grunn av nøyaktigheten av flytende håndtering. Krystaller var diffracted internt for screening og synchrotron for innsamling av data som det gir x-ray med høyere intensitet og mindre divergens, og dermed gir høy kvalitet. Molekylær erstatning var vårt førstevalg som ligner strukturelle maler var tilgjengelig i databasen. Alternativet vei er å bruke eksperimentelle fase, inkludert MAD, SAD, MIR, osv.

Mens løse strukturen i DBM RyR NTD, Matthews koeffisientene fra Xtriage30 foreslo at asymmetrisk enheten (ASU) mest sannsynlig inneholdt fire monomerer med 46% løsemiddel innhold, som har en sannsynlighet på 49%. Men kunne vi ikke finne den rette løsningen med fire molekyler i ASU. Senere går å se etter to, tre, fem, seks molekyler også mislyktes. Til slutt fant vi den rette løsningen med bare ett molekyl i ASU, som bare har 4% sannsynlighet og over 86% løsemiddel innhold. Høy vanninnholdet ble bekreftet når vi løste strukturen. Ekstrem høy løsemiddel innholdet finnes dermed avhengig av iboende måten som protein-pakker.

Selv om Røntgenkrystallografi er en gull-standard i protein proteinstrukturer, er proteiner med store lidelse eller fleksible regioner og noen store protein komplekser med svak affinitet utfordrende for å utkrystallisere. Protein tekniske metoder, inkludert loop-trunkering, overflaten entropi reduksjon og cross-linking, kan øke sjansen for å oppnå bedre protein krystaller. Foruten den avslørende høyoppløselig proteinstrukturer, kan Røntgenkrystallografi også brukes til å studere de protein-plantevernmidler samspill, som vil hjelpe oss på struktur-baserte plantevernmidler design. Qi et al. funnet at forskjellige familier av diamides kan binde til forskjellige områder som er forskjellige over arter36. Bruker vår strategi, kan en finne RyR strukturer fra flere arter og identifisere de unike elementene ansvarlig for den observerte species-specificity. Samlet kan denne protokollen tilpasses for uttrykket, rensing, krystallisering og struktur vilje av proteiner eller protein domener alene eller kompleks med små molekyl narkotika.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgements

Finansiering av denne forskningen ble levert av: nasjonale nøkkelen forskning og utvikling Program i Kina (2017YFD0201400, 2017YFD0201403), National natur Science Foundation i Kina (31320103922, 31230061) og prosjekt av nasjonal grunnforskning (973) Program Kina (2015CB856500, 2015CB856504). Vi er takknemlige for ansatte på beamline BL17U1 i Shanghai Synchrotron stråling anlegg (SSRF).

Materials

Name Company Catalog Number Comments
pET-28a-HMT vector This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain Novagen 69450-3CN
HisTrapHP column (5 mL) GE Healthcare 45-000-325
Amylose resin column New England Biolabs E8021S
Q Sepharose high-performance column  GE Healthcare 17-1154-01
Amicon concentrators (10 kDa MWCO) Millipore UFC901008
Superdex 200 26/600 gel-filtration column  GE Healthcare 28-9893-36
Automated liquid handling robotic system  Art Robbins Instruments Gryphon
96 Well CrystalQuick Greiner bio-one 82050-494
Uni-Puck Molecular Dimensions MD7-601
Mounted CryoLoop - 20 micron Hampton Research HR4-955
CryoWand Molecular Dimensions MD7-411
Puck dewar loading tool Molecular Dimensions MD7-607
Nano drop Thermo Scientific NanoDrop One
Crystal incubator Molecular Dimensions MD5-605
X-Ray diffractor Rigaku FRX
PCR machine Eppendorf Nexus GX2
Plasmid mini-prep kit Qiagen 27104
Gel extraction kit Qiagen 28704
SspI restriction endonuclease NEB R0132S
T4 DNA polymerase Novagen 2868713
Kanamycin Scientific Chemical 25389940
IPTG Genview 367931
HEPES Genview 7365459
β-mercaptoethanol Genview 60242
Centrifuge Thermo Scientific Sorvall LYNX 6000 
Sonnicator Scientz II-D
Protein purification system GE Healthcare Akta Pure
Light microscope Nikon SMZ745
IzIt crystal dye Hampton Research HR4-710
Electrophoresis unit Bio-Rad 1658005EDU
Shaker Incubator Zhicheng ZWYR-D2401
Index crystal screen Hampton Research HR2-144
Structure crystal screen Molecular Dimensions MD1-01
ProPlex crystal screen Molecular Dimensions MD1-38
PACT premier crystal screen Molecular Dimensions MD1-29
JCSG-plus crystal screen Molecular Dimensions MD1-37

DOWNLOAD MATERIALS LIST

References

  1. Giannini, G., Sorrentino, V. Molecular structure and tissue distribution of ryanodine receptors calcium channels. Medicinal Research Reviews. 15, (4), 313-323 (1995).
  2. Takeshima, H., et al. Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster. FEBS Letters. 337, (1), 81-87 (1994).
  3. Sattelle, D. B., Cordova, D., Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebrate Neuroscience. 8, (3), 107-119 (2008).
  4. Steinbach, D., et al. Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella. Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).
  5. Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China. Pest Management Science. 69, (5), 661-665 (2013).
  6. Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae). Journal of Economic Entomology. 108, (4), 1978-1985 (2015).
  7. Guo, L., et al. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Management Science. 70, (7), 1083-1089 (2014).
  8. Troczka, B., et al. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochemistry and Molecular Biology. 42, (11), 873-880 (2012).
  9. Roditakis, E., et al. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).
  10. Borko, L., et al. Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias. Acta Crystallographica Section D. 70, (Pt 11), 2897-2912 (2014).
  11. Sharma, P., et al. Structural determination of the phosphorylation domain of the ryanodine receptor. FEBS Journal. 279, (20), 3952-3964 (2012).
  12. Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface. Nature Communications. 4, 1506 (2013).
  13. Lau, K., Van Petegem, F. Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain. Nature Communications. 5, 5397 (2014).
  14. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  15. Lobo, P. A., Van Petegem, F. Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations. Structure. 17, (11), 1505-1514 (2009).
  16. des Georges, A., et al. Structural Basis for Gating and Activation of RyR1. Cell. 167, (1), 145-157 (2016).
  17. Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. Architecture and conformational switch mechanism of the ryanodine receptor. Nature. 517, (7532), 39-43 (2015).
  18. Peng, W., et al. Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2. Science. 354, (6310), (2016).
  19. Wei, R. S., et al. Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1. Cell Research. 26, (9), 977-994 (2016).
  20. Yan, Z., et al. Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution. Nature. 517, (7532), 50-55 (2015).
  21. Zalk, R., et al. Structure of a mammalian ryanodine receptor. Nature. 517, (7532), 44-49 (2015).
  22. Furlong, M. J., Wright, D. J., Dosdall, L. M. Diamondback moth ecology and management: problems, progress, and prospects. Annual Review of Entomology. 58, 517-541 (2013).
  23. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  24. Lobo, P. A., Van Petegem, F. Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations. Structure. 17, (11), 1505-1514 (2009).
  25. Aslanidis, C., de Jong, P. J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Research. 18, (20), 6069-6074 (1990).
  26. Stepanov, S., et al. JBluIce-EPICS control system for macromolecular crystallography. Acta Crystallographica Section D. 67, (3), 176-188 (2011).
  27. Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes. Acta Crystallographica Section D. 62, (Pt 8), 859-866 (2006).
  28. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40, (Pt 4), 658-674 (2007).
  29. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D. 66, (Pt 2), 213-221 (2010).
  30. Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation. CCP4 Newsletter. (43), 27-35 (2005).
  31. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 10, (6), 845-858 (2015).
  32. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D. 64, (Pt 1), 61-69 (2008).
  33. Emsley, P., Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallographica Section D. 60, 2126-2132 (2004).
  34. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallographica Section D. 68, (Pt 4), 352-367 (2012).
  35. Lin, L., et al. Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites. Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).
  36. Qi, S., Casida, J. E. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor. Pesticide Biochemistry and Physiology. 107, (3), 321-326 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics