Estrutura cristalina do domínio N-terminal do Ryanodine Receptor de Plutella plutella

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Neste artigo, descrevemos os protocolos de determinação de estrutura, purificação, cristalização e expressão da proteína do domínio N-terminal do receptor de ryanodine do diamondback moth (Plutella plutella).

Cite this Article

Copy Citation | Download Citations

Nayak, B. C., Wang, J., Lin, L., He, W., You, M., Yuchi, Z. Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella. J. Vis. Exp. (141), e58568, doi:10.3791/58568 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Desenvolvimento de inseticidas potentes e eficientes como alvo receptores ryanodine inseto (RyRs) tem sido de grande interesse na área de controle de pragas agrícolas. Até à data, vários insecticidas de diamido visando pragas que ryrs ter sido comercializados, que geram receita anual de 2 bilhões de dólares. Mas a compreensão do modo de ação de inseticidas RyR-direcionamento é limitada pela falta de informações estruturais sobre inseto RyR. Isto por sua vez restringe a compreensão do desenvolvimento da resistência de inseticida em pragas. O diamondback moth (DBM) é uma praga devastadora destruindo crucíferas culturas em todo o mundo, que também tem sido relatada para mostrar resistência aos inseticidas de diamido. Portanto, é de grande importância prática para desenvolver novas inseticidas visando o RyR DBM, especialmente visando uma região diferente do local de ligação do diamido tradicional. Aqui, apresentamos um protocolo para caracterizar estruturalmente o domínio N-terminal do RyR da DBM. A estrutura de cristal de raio-x foi resolvida por substituição molecular em uma resolução de 2.84 Å, que mostra um motivo de dobramento de beta-trevo e uma acompanhamento alfa-hélice. Este protocolo pode ser adaptado para a expressão, purificação e caracterização estrutural de proteínas ou outros domínios em geral.

Introduction

Ryanodine receptors (RyRs) são canais de íon específico, que mediam a permeação dos íons de Ca2 + através das membranas do retículo sarcoplasmático (RS) em células musculares. Portanto, eles jogam um papel importante na processo de acoplamento excitação contração. Na sua forma funcional, RyR monta como um homo-tetrâmero com uma massa molecular de > 2 MDa, com cada subunidade composto por resíduos de aminoácidos ~ 5000. Em mamíferos, existem três isoformas: RyR1 - tipo de músculo esquelético, RyR2 - tipo de músculo cardíaco e RyR3-ubiquitously expressa em tecidos diferentes1.

Em insetos, há apenas um tipo de RyR, que é expresso no tecido muscular e nervoso2. Inseto RyR é mais semelhante a mamíferos RyR2 com uma identidade de sequência de cerca de 47%3. Inseticidas de diamido segmentação RyR de Lepidoptera e Coleoptera foram desenvolvidas e comercializadas por grandes empresas como Bayer (flubendiamida), DuPont (chlorantraniliprole) e Syngenta (cyantraniliprole). Desde o seu lançamento relativamente recente, diamido inseticidas tornaram-se uma das classe mais rápido crescimento de inseticidas. Atualmente, as vendas destes três inseticidas anualmente cruzaram 2 bilhões dólares americanos com uma taxa de crescimento de mais de 50% desde 2009 (Agranova).

Estudos recentes têm relatado o desenvolvimento de resistência em insetos, depois de algumas gerações de uso destes inseticidas4,5,6,7,8. As resistência mutações no domínio transmembrana de RyRs do diamondback moth (DBM), Plutella plutella (G4946E, I4790M) e as posições correspondentes em Minador do tomate, Tuta absoluta (G4903E, I4746M) mostram que a região pode ser envolvido na ligação de inseticida de diamido como esta região é conhecida por ser crítico para retenção do canal4,8,9. Apesar de inúmeras pesquisas nesta área, os mecanismos moleculares exatos de diamido inseticidas permanecem indescritíveis. Além disso, não está claro se as mutações de resistência afetam as interações com diamides diretamente ou qual alostericamente.

Estudos anteriores relataram a estrutura de vários domínios RyR de espécies de mamíferos e a estrutura de completos mamíferos RyR1 e RyR2 por cristalografia de raios x e microscopia cryo-elétron, respectivamente10,11, 12,13,14,15,16,17,18,19,20,21 . Mas até agora, nenhuma estrutura de insecto RyR foi relatada, que nos proíbe de compreender os meandros moleculares da função do receptor, bem como os mecanismos moleculares de ação inseticida e desenvolvimento de resistência de inseticida.

Este manuscrito, apresentamos um protocolo de generalizadas para caracterização estrutural de domínio de β-trevo N-terminal do receptor de ryanodine do diamondback moth, uma praga destrutivo infectando crucíferos culturas no mundo22. A construção foi projetada de acordo com o coelho publicado RyR1 NTD cristal estruturas23,24e o cryo-EM modelos estruturais16,17,18,19, 20 , 21. esta é a primeira estrutura de alta resolução, relatada por inseto RyR, que revela o mecanismo de retenção de canal e fornece um modelo importante para o desenvolvimento de inseticidas espécie-específicos usando drogas baseada em estrutura de design. Para a elucidação da estrutura, utilizamos a cristalografia de raios x, que é considerada como o "padrão ouro" para a determinação da estrutura da proteína em perto de resolução atômica. Embora o processo de cristalização é imprevisível e trabalho intensivo, este protocolo passo a passo ajudará pesquisadores a express, purificar e caracterizar outros domínios de inseto RyR ou qualquer outras proteínas em geral.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Gene clonagem e expressão de proteínas purificação

  1. PCR amplificar DNA correspondente à proteína de interesse (resíduos 1-205 de DBM RyR, Genbank ACC. n. AFW97408) e clone em vetor de animal de estimação-28a-HMT por clonagem independente de ligadura (LIC)25. Este vetor contém uma marca de histidina, tag MBP e um local de clivagem de protease TEV no N-terminal15.
    1. Projeto LIC primers para amplificação do gene alvo com extensões 5' LIC-compatível com:
      Encaminhar a cartilha LIC:
      5' TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3'
      Cartilha LIC inversa:
      5' TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3'
    2. Combinar os componentes da reação (50 μL): 1 μL de modelos de DNA (100 ng/μL), 1 μL de primer para a frente (10 μM), 1 μL de primer reverso (10 μM), 0,5 μL de DNA polimerase (NEB), 5 μL de reação 10x buffer, 1 μL de dNTP (25 mM) , 40.5 μL de RNase free ddH2O.
      1. Coloque a mistura de reação em uma máquina PCR e executar o programa a seguir.
      2. Incubar a 95 ° C por 3 min, e em seguida, executar 30 ciclos de (95 ° C por 30 s, 58 ° C, por 15 s, 72 ° C por 1 min). Incubar a 72 ° C por 5 min e em seguida, mantenha a 4 ° C.
      3. Executar a mistura de reação inteira (50 μL) em um gel de agarose 2% e extrair com um Kit de extração do Gel. Siga o protocolo do fabricante.
    3. Independente de ligadura da clonagem (LIC)
      1. Realizar a digestão SspI (60 μL): 20 μL de DNA de vetor (50 ng/μL), 6 μL de 10 x 30 μL de DDQ2O. Incubar a 37 ° C por 3 h. executar a reação inteira, 4 μL de SspI e amortecedor da reação misturar em gel de agarose 1% e extrair com um Kit de extração do Gel. Siga o protocolo do fabricante.
      2. Realizar o tratamento T4 DNA Polymerase do vetor e inserir DNA. Combinar o seguinte: 5 μL de DNA vetor ou insert (50 ng/μL), 2 μL de tampão, DNA polimerase 10 x T4, 1 μL de dGTP (25 mM) para vector ou 1 μL do dCTP (25 mM) para inserir DNA, 1 μL de TDT (100 mM), 0,4 μL de T4 DNA Polymerase (LIC-qualificado) e 9.6 μL de DDQ2O. Incubar as reacções à temperatura ambiente por 40 min. calor-inativar enzimas a 75 ° C por 20 min.
        Nota: O vetor LIC e inserir DNA devem ser tratadas em reações distintas.
      3. Execute o recozimento reação LIC. Combinar o seguinte: 2 μL de T4-tratados inserir DNA, 2 μL de T4-tratados LIC vector DNA. Incube a reação à temperatura ambiente por 10 min.
  2. Transformar BL21 (DE3) Escherichia coli células com este plasmídeo recombinante.
    1. Descongele as células competentes (50 μL em microtubo) no gelo.
    2. Adicionar aproximadamente 1 μL (50 ng) do plasmídeo no tubo. Misture as células e DNA por sacudir suavemente o tubo 2 – 3 vezes. Coloca o tubo no gelo por 20 min.
    3. Calor choque a 42 ° C por 40 s. lugar do tubo no gelo novamente por 2 min. adicionar 1 mL de temperatura LB mídia ao tubo.
    4. Lugar do tubo de mistura no shaker 250 rpm a 37 ° C por 45 min. espalhar a 150-200 µ l da mistura nas chapas de seleção. Inverter a placa e incubar durante uma noite a 37 ° C.
  3. Escolha uma única colônia e cultura de células em 100 mL de meio de 2YT contendo 50 canamicina µ g/mL a 37 ° C durante a noite. Na manhã seguinte, inocular meio 2YT de 1L contendo 50 canamicina µ g/mL com 10ml de cultura durante a noite e incubar em incubadora de abanador de 37 ° C a 250 rpm, até que o OD600 atinge ~ 0.6. Posteriormente, induzir a cultura com IPTG para uma concentração final de 0,4 mM e crescer para outro h 5 a 30 ° C.
  4. Recolher as células por centrifugação a 8.000 x g durante 10 minutos a 4 ° C, recolher as células e ressuspender todas as células de 10g em 40 mL de tampão de lise (10 mM HEPES pH 7,4, 250 mM KCl, 10mm β-Mercaptoetanol, 25 lisozima μg/mL, 25 μg/mL DNase 1 mM PMSF).
    1. Interrompê-lo por sonication em amplitude de 65% para 8 min com 1 s s no e 1 fora. Remova os restos de células por centrifugação a 40.000 x g durante 30 min a 4 ° C. Filtrar o sobrenadante, passando através de filtro de 0,22 μm e carregá-lo para o loop de amostra.
  5. Purificar a proteína de fusão, cleave a tag e re-purificar a proteína do alvo.
    1. Purificar a proteína de fusão usando coluna Ni-NTA (tampão de ligação: 10 mM HEPES pH 7,4, 250 mM KCl; tampão de eluição: pH HEPES 10mm 7.4, 250 mM KCl, imidazol 500mm) e purificar através de um sistema de purificação, com um gradiente linear de imidazol 20 – 250 mM.
    2. Cleave a proteína alvo eluted com protease do PEV (01:50 ratio) durante a noite a 4 ° C.
    3. Purificar a mistura de reação de clivagem, usando a coluna de resina de amilose (tampão de ligação: 10 mM HEPES pH 7,4, 250 mM KCl; tampão de eluição: pH HEPES 10mm 7.4, 250 mM KCl, maltose 10 mM) e Ni-NTA coluna para remover a tag e protease TEV. A proteína do alvo será na fração de escoamento dessas duas colunas.
    4. Dialize a amostra contra tampão de diálise (10 mM Tris-HCl pH 8.8, 50 mM KCl, 10mm β-Mercaptoetanol para reduzir a concentração de sal. Purificar a amostra em uma coluna de troca de ânion (tampão de ligação: 10 mM Tris-HCl pH 8.8, 10 mM β-Mercaptoetanol; tampão de eluição: pH 10 mM Tris-HCl 8.8, 1 M de KCl, 10mm β-Mercaptoetanol) por um gradiente linear de 20 – 500 mM KCl no buffer de eluição.
    5. Como um passo final no processo de purificação, concentrar a proteína usando o concentrador centrífugo (10 kDa MWCO) e injetar em uma coluna de gel filtração Superdex 200 26/600 para verificar a homogeneidade.
  6. Examine a pureza da proteína, executando-o em um SDS 15% página.
    Nota: Todas as colunas estão executando em um sistema de purificação de proteínas com uma taxa de fluxo de ligação de 2 mL/min e uma taxa de fluxo de eluição de 4 mL/min, exceto gel-filtração em 1 mL/min.

2. cristalização e preparação de proteína

  1. Concentrar a amostra de proteína purificada para 10 mg/mL, utilizando centrífuga concentrador (10 kDa MWCO) e troca de buffer de buffer de cristalização antes de armazenar a-80 ° C.
  2. Realizar triagem de cristalização (proporção de 1:1, 200 nL de proteína e 200 nL de tampão do reservatório) por sessão soltar método de difusão de vapor a 295 K com vários kits de cristalização usando um líquido automatizado sistema robótico em um formato de 96 poços de manipulação.
    Nota: Nós usamos kits da investigação Molecular de dimensões e Hampton e o Gryphon automatizado sistema de manipulação de líquidos.
  3. A placa de 96 poços cristalização para evitar a evaporação e habilitar o equilibrio da gota da proteína com o tampão do reservatório do selo. Em seguida, manter as placas na incubadora de cristal a 18 ° C.
  4. Verifique as placas de 96 poços, periodicamente, usando um microscópio de luz para monitorar o crescimento e a formação de cristais.
  5. Para diferenciar os cristais de proteínas de cristais de sal, use uma tintura de proteína. Adicione 1 µ l de corante para soltar o alvo. Esperar cerca de 1h e observar sob microscópio. Os cristais de proteína ficará azuis.
  6. Usar as condições de cristalização positivo (sulfato de amônio de 1,5 M, 0,1 M Tris pH 8.0) para otimizar ainda mais os cristais usando suspensão cair método de difusão de vapor em placas de 24 poços.
    1. Otimize o pH de 7,0 a 8,5 com intervalo de unidade de pH 0,5 cada passo. Otimize a concentração de sulfato de amónio de 1,2 M de 1,7 M, com intervalo de 0,1 M cada passo. (No nosso caso a melhor condição de produzir grandes cristais em forma de placa foi 0,1 M HEPES pH 7.0 e 1.6 M sulfato de amônio)

3. cristal montagem, raio-x coleta de dados e determinação da estrutura

  1. Monte os cristais em um cryoloop e flash-cool em nitrogênio líquido usando reservatório solução contendo 20% de glicerol como crio-protetor. Coloque os cristais em unipuck para armazenamento e transporte.
  2. Pre-tela usando um difratômetro in-house diffractor de raio-x de cristais de proteína. Escolha os melhores com as resoluções mais altos para coleta de dados nas instalações do síncrotron (o nosso dataset foi colhido em BL17U1 nas instalações de radiação síncrotron de Shanghai).
    1. Use o software de controle de trajetória BluIce26 para montar e centralizar os cristais da função centragem automática ou manual. Realize exposições de teste para determinar a estratégia de coleta de dados, incluindo o início, ângulo, tempo de exposição, distância do detector, largura da moldura e números.
    2. Recolher o dataset em conformidade (recolhemos 180 frames com 1 s tempo de exposição, largura da moldura de 1° e a distância de detector de 350mm).
  3. Índice, integrar e dimensionar o dataset usando o HKL2000 suíte27. Primeiro, realizar a função de busca de pico para encontrar os pontos de difração e então os pontos de índice e selecione o grupo de certo espaço. Após a integração de pico, dimensionar o conjunto de dados com o modelo de erro apropriado e salvar o arquivo de saída .sca.
  4. Resolva o problema da fase por substituição molecular usando Phaser28 em PHENIX29.
    1. Calcule o número de cópia possível de moléculas de proteína na unidade assimétrica por Xtriage30.
    2. Olhe para os modelos de estrutura apropriada com alta identidade e estrutural similaridades como a proteína do alvo usando estruturas conhecidas da literatura ou os modelos gerados pelo servidor de predição de estrutura como Phyre231 (usamos coelho RyR1 NTD como um modelo de pesquisa, PDB ID 2XOA).
    3. Execute Phaser usando o arquivo de dados de difração, o arquivo de modelo de estrutura e o arquivo de sequência de proteínas para encontrar a solução.
  5. Execute AutoBuild32 no PHENIX29 para gerar o modelo inicial usando o arquivo de saída de Phaser e o arquivo de sequência da proteína alvo.
  6. Construir a estrutura para a densidade de elétron experimental modificados usando Coot33 e refinar usando phenix.refine34 em ciclos iterativos manualmente.
  7. Valide o modelo final usando as ferramentas de validação no PHENIX18.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Purificação

O domínio N-terminal da DBM RyR foi expressa como uma proteína de fusão com uma marca de hexahistidine, uma marca MBP e um local de clivagem de protease TEV. Nós seguimos uma estratégia de purificação de cinco etapas para obter uma proteína altamente pura, adequada para efeito de cristalização. Em primeiro lugar, a proteína de fusão foi purificada da fracção solúvel de lisado celular por coluna Ni-NTA (HisTrap HP). Em seguida, a proteína de fusão foi submetida a clivagem de protease TEV e a fracção hexahistidine-MBP foi removida pela coluna de resina de amilose seguido por coluna Ni-NTA. Além disso, a proteína foi purificada por coluna de troca de ânion (Q Sepharose HP) e finalmente pela coluna de gel filtração (Superdex 200 26/600). O rendimento final da proteína purificada de cultura bacteriana de 1L usando mídia 2YT era ~ 4 mg. A proteína purificada mostrou uma única banda em SDS-PAGE no ~ 21 kDa (Figura 1). O volume de eluição da coluna de gel filtração confirmou o NTD RyR purificada para ser um monômero (Figura 1).

Cristalização

Cristalização de inicial de triagem em placas de 96 poços produziu cristais em várias condições. Estas condições foram selecionadas para a otimização de cristal em 24 placas bem. A condição mais ideal onde formaram-se cristais de alta qualidade placa-forma foi 0,1 M HEPES pH 7.0 e 1.6 M sulfato de amónio (Figura 2).

Determinação da estrutura

Cristais obtidos foi difratada para 2,84 Å na trajetória BL17U1 nas instalações de radiação síncrotron de Xangai. O cristal foi indexado no grupo espaço P61 com parâmetros de cela unitária uma = 170.13, b = 170.13, c = 51.763 Å, α = β = 90,00 °, γ = 120 °. Para determinação de estrutura, substituição molecular foi empregada usando coelho RyR1 NTD como um modelo de pesquisa em PHENIX. Aperfeiçoamento da estrutura foi feito em PHENIX um final Rtrabalhar e Rlivre de 21.63 e 24.52%, respectivamente. As estatísticas de coleta e refinamento de dados estão listadas na tabela 1. A estrutura resolvida do DBM RyR NTD cobrindo os resíduos 1-205 (5Y9V PDB ID) é mostrada na Figura 3.

Figure 1
Figura 1: SDS-PAGE e gel cromatograma de filtração, representando a purificação da DBM RyR NTD35. SDS PAGE (15%) na inserção mostra purificada DBM RyR NTD como uma única banda, após os cinco passo estratégia de purificação. Na faixa da esquerda mostra a proteína padrão (PM). O cromatograma de filtração de gel obtido usando uma coluna de Superdex 200 26/600 mostra o pico de eluição em 240 mL, que corresponde ao formulário da proteína monomérico. Clique aqui para ver uma versão maior desta figura.

Figure 2
Figura 2. Cristalização de DBM RyR NTD35Cristais de DBM RyR NTD produzido pelo método de difusão de vapor, como pode ser visto sob um microscópio de luz. A condição de cristalização foi 0,1 M HEPES pH 7.0 e 1.6 M sulfato de amônio. Barra de escala = 200 µm. clique aqui para ver uma versão maior desta figura.

Figure 3
Figura 3: Estrutura de DBM RyR NTD (PDB ID 5Y9V)35Resolvido a estrutura da proteína mostrada de dois modos de exibição. Elementos de estrutura secundária são rotulados. Vertentes β são mostrados em roxo. Α-hélice e uma hélice de10 3 são mostrados em azul. Laços são mostrados em branco. NT e Ct representam o N-terminal e C-terminal da proteína, respectivamente. Clique aqui para ver uma versão maior desta figura.

Tabela 1: estatísticas de coleta e refinamento de dados para o DBM RyR NTD cristal35. Clique aqui para baixar esta tabela.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Neste artigo, descrevemos o procedimento para expressar recombinantes, purificar, cristalizar e determinar a estrutura de DBM RyR NTD. Para cristalização, um requisito crucial é a obtenção de proteínas com homogeneidade, pureza e alta solubilidade. Em nosso protocolo, escolhemos usar pET-28a-HMT vetor que contém uma marca de hexahistidine e MBP, ambos os quais poderiam ser utilizados para a purificação obter uma maior pureza de dobra. Além disso, as aids marca MBP na solubilidade da proteína alvo. Nós purificado da proteína por cinco etapas consecutivas que rendeu a proteína que foi altamente puro e apropriado para a cristalização. Rastreio de cristalização foi realizado utilizando líquido automatizado sistema de manipulação. Comparado à análise tradicional pela configuração manual gota, sistema automatizado usa muito pequenos volumes de amostra, economiza tempo e energia. Ela também aumenta a reprodutibilidade devido à precisão de manipulação de líquidos. Cristais eram difratados internamente para rastreio e no Síncrotron para coleta de dados como ele fornece o raio-x com maior intensidade e menos divergência, desse modo, produzindo dados de alta qualidade. Substituição molecular foi nossa primeira escolha como modelos estruturais similares estavam disponíveis no banco de dados. A maneira alternativa é usar a fase experimental, incluindo MAD, SAD, MIR, etc.

Enquanto resolver a estrutura do DBM RyR NTD, os coeficientes de Matthews, obtidos a partir de Xtriage30 sugeriu que a unidade assimétrica (ASU) provavelmente continha quatro monômeros com 46% solvente de conteúdo, que tem uma probabilidade de 49%. No entanto, nós não poderíamos encontrar a solução certa com quatro moléculas em ASU. Execuções subsequentes para procurar em dois, três, cinco, seis moléculas também falharam. Eventualmente, nós encontramos a solução certa, com apenas uma molécula em ASU, que tem apenas 4% de probabilidade e mais 86% de teor de solvente. O alto teor de água foi confirmado depois resolvemos a estrutura. Assim, o alto teor de solvente extremo existir dependendo da maneira intrínseca em quais pacotes de proteína.

Apesar de cristalografia de raios x é um padrão-ouro na determinação da estrutura da proteína, proteínas com grande desordem ou regiões flexíveis e alguns grandes complexos de proteínas com afinidade fraca estão desafiando a se cristalizar. Entropia de superfície de métodos de engenharia de proteína, incluindo loop-truncamento, redução e cross-linking, pode melhorar a chance de obter melhores cristais de proteínas. A revelação de estruturas de proteínas de alta resolução, além de cristalografia de raios x também pode ser usado para estudar as interações da proteína-pesticidas, que iria nos ajudar na concepção de pesticidas baseados em estrutura. QI et al encontraram que diferentes famílias de diamides podem ligar para locais distintos que são diferentes em espécie36. Usando nossa estratégia, um pode determinar as estruturas de RyR de múltiplas espécies e identificar os elementos únicos responsáveis para o species-specificity observado. Em geral, este protocolo pode ser adaptado para determinação de estrutura, purificação, cristalização e expressão de proteínas ou domínios da proteína por si próprios ou em complexo com drogas pequena molécula.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada para divulgar.

Acknowledgements

Financiamento para esta pesquisa foi fornecida por: nacional chave de pesquisa e desenvolvimento programa de China (2017YFD0201400, 2017YFD0201403), nacional natureza Science Foundation da China (31320103922, 31230061) e projeto de pesquisa básica nacional (973) programa de China (2015CB856500, 2015CB856504). Somos gratos ao pessoal sobre a trajetória de BL17U1 em instalações de radiação síncrotron de Shanghai (SSRF).

Materials

Name Company Catalog Number Comments
pET-28a-HMT vector This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain Novagen 69450-3CN
HisTrapHP column (5 mL) GE Healthcare 45-000-325
Amylose resin column New England Biolabs E8021S
Q Sepharose high-performance column  GE Healthcare 17-1154-01
Amicon concentrators (10 kDa MWCO) Millipore UFC901008
Superdex 200 26/600 gel-filtration column  GE Healthcare 28-9893-36
Automated liquid handling robotic system  Art Robbins Instruments Gryphon
96 Well CrystalQuick Greiner bio-one 82050-494
Uni-Puck Molecular Dimensions MD7-601
Mounted CryoLoop - 20 micron Hampton Research HR4-955
CryoWand Molecular Dimensions MD7-411
Puck dewar loading tool Molecular Dimensions MD7-607
Nano drop Thermo Scientific NanoDrop One
Crystal incubator Molecular Dimensions MD5-605
X-Ray diffractor Rigaku FRX
PCR machine Eppendorf Nexus GX2
Plasmid mini-prep kit Qiagen 27104
Gel extraction kit Qiagen 28704
SspI restriction endonuclease NEB R0132S
T4 DNA polymerase Novagen 2868713
Kanamycin Scientific Chemical 25389940
IPTG Genview 367931
HEPES Genview 7365459
β-mercaptoethanol Genview 60242
Centrifuge Thermo Scientific Sorvall LYNX 6000 
Sonnicator Scientz II-D
Protein purification system GE Healthcare Akta Pure
Light microscope Nikon SMZ745
IzIt crystal dye Hampton Research HR4-710
Electrophoresis unit Bio-Rad 1658005EDU
Shaker Incubator Zhicheng ZWYR-D2401
Index crystal screen Hampton Research HR2-144
Structure crystal screen Molecular Dimensions MD1-01
ProPlex crystal screen Molecular Dimensions MD1-38
PACT premier crystal screen Molecular Dimensions MD1-29
JCSG-plus crystal screen Molecular Dimensions MD1-37

DOWNLOAD MATERIALS LIST

References

  1. Giannini, G., Sorrentino, V. Molecular structure and tissue distribution of ryanodine receptors calcium channels. Medicinal Research Reviews. 15, (4), 313-323 (1995).
  2. Takeshima, H., et al. Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster. FEBS Letters. 337, (1), 81-87 (1994).
  3. Sattelle, D. B., Cordova, D., Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebrate Neuroscience. 8, (3), 107-119 (2008).
  4. Steinbach, D., et al. Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella. Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).
  5. Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China. Pest Management Science. 69, (5), 661-665 (2013).
  6. Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae). Journal of Economic Entomology. 108, (4), 1978-1985 (2015).
  7. Guo, L., et al. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Management Science. 70, (7), 1083-1089 (2014).
  8. Troczka, B., et al. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochemistry and Molecular Biology. 42, (11), 873-880 (2012).
  9. Roditakis, E., et al. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).
  10. Borko, L., et al. Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias. Acta Crystallographica Section D. 70, (Pt 11), 2897-2912 (2014).
  11. Sharma, P., et al. Structural determination of the phosphorylation domain of the ryanodine receptor. FEBS Journal. 279, (20), 3952-3964 (2012).
  12. Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface. Nature Communications. 4, 1506 (2013).
  13. Lau, K., Van Petegem, F. Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain. Nature Communications. 5, 5397 (2014).
  14. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  15. Lobo, P. A., Van Petegem, F. Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations. Structure. 17, (11), 1505-1514 (2009).
  16. des Georges, A., et al. Structural Basis for Gating and Activation of RyR1. Cell. 167, (1), 145-157 (2016).
  17. Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. Architecture and conformational switch mechanism of the ryanodine receptor. Nature. 517, (7532), 39-43 (2015).
  18. Peng, W., et al. Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2. Science. 354, (6310), (2016).
  19. Wei, R. S., et al. Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1. Cell Research. 26, (9), 977-994 (2016).
  20. Yan, Z., et al. Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution. Nature. 517, (7532), 50-55 (2015).
  21. Zalk, R., et al. Structure of a mammalian ryanodine receptor. Nature. 517, (7532), 44-49 (2015).
  22. Furlong, M. J., Wright, D. J., Dosdall, L. M. Diamondback moth ecology and management: problems, progress, and prospects. Annual Review of Entomology. 58, 517-541 (2013).
  23. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  24. Lobo, P. A., Van Petegem, F. Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations. Structure. 17, (11), 1505-1514 (2009).
  25. Aslanidis, C., de Jong, P. J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Research. 18, (20), 6069-6074 (1990).
  26. Stepanov, S., et al. JBluIce-EPICS control system for macromolecular crystallography. Acta Crystallographica Section D. 67, (3), 176-188 (2011).
  27. Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes. Acta Crystallographica Section D. 62, (Pt 8), 859-866 (2006).
  28. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40, (Pt 4), 658-674 (2007).
  29. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D. 66, (Pt 2), 213-221 (2010).
  30. Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation. CCP4 Newsletter. (43), 27-35 (2005).
  31. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 10, (6), 845-858 (2015).
  32. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D. 64, (Pt 1), 61-69 (2008).
  33. Emsley, P., Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallographica Section D. 60, 2126-2132 (2004).
  34. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallographica Section D. 68, (Pt 4), 352-367 (2012).
  35. Lin, L., et al. Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites. Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).
  36. Qi, S., Casida, J. E. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor. Pesticide Biochemistry and Physiology. 107, (3), 321-326 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics