Kristallstrukturen av N-terminala domänen av ryanodinreceptorn från Plutella xylostella

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

I den här artikeln beskriver vi protokoll av protein uttryck, rening, kristallisering och struktur bestämning av N-terminala domänen för ryanodinreceptorn från diamondback moth (Plutella xylostella).

Cite this Article

Copy Citation | Download Citations

Nayak, B. C., Wang, J., Lin, L., He, W., You, M., Yuchi, Z. Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella. J. Vis. Exp. (141), e58568, doi:10.3791/58568 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Utvecklingen av potenta och effektiva insektsmedel inriktning insekt ryanodine receptorer (RyRs) har varit av stort intresse i området i jordbruket skadedjursbekämpning. Hittills har flera diamide insekticider inriktning pest RyRs har kommersialiserats, som genererar omsättning om 2 miljarder US-dollar. Men förståelsen av verkningsmekanismen av RyR-targeting insekticider begränsas av bristen på strukturell information angående insekt RyR. Detta begränsar i sin tur förståelsen av insektsmedel resistensutveckling i skadedjur. Diamondback mal (DBM) är ett förödande skadedjur som förstör korsblommiga grödor i världen, som har också rapporterats att Visa motstånd mot diamide insekticider. Därför är det av stor praktisk betydelse att utveckla nya insekticider inriktning den DBM RyR, särskilt inriktning en region som skiljer sig från traditionella diamide bindningsstället. Här presenterar vi ett protokoll för att strukturellt karakterisera den N-terminala domänen av RyR från DBM. X-ray kristallstrukturen löstes genom molekylär ersätter en upplösning av 2.84 Å, som visar ett beta-klöver fällbara motiv och en kompletterande alpha helix. Detta protokoll kan anpassas för uttryck, rening och strukturell karaktärisering av andra domäner eller proteiner i allmänhet.

Introduction

Ryanodine receptorer (RyRs) är specifika jonkanaler, som medlar genomträngning av Ca2 + joner över de sarkoplasmatiska Retikulum (SR) membran i muskelcellerna. Därför, de spelar en viktig roll i excitation contractionen koppling processen. I sin funktionella form, RyR monterar som en homo-tetramer med en molekylvikt av > 2 MDa, med varje subenhet bestående av ~ 5000 aminosyra rester. Hos däggdjur finns det tre isoformer: RyR1 - skelettmuskulaturen typ, hjärtmuskulatur typ RyR2- och RyR3-ubiquitously uttryckt i olika vävnader1.

I insekter finns det endast en typ av RyR, som uttrycks i muskulös och nervös vävnad2. Insekt RyR är mer lik däggdjur RyR2 med en sekvens identitet av cirka 47%3. Diamide insekticider inriktning RyR av Lepidoptera och Coleoptera har utvecklats och marknadsförs av stora företag som Bayer (flubendiamid), DuPont (klorantraniliprol) och Syngenta (cyantraniliprole). Sedan lanseringen relativt nyligen har diamide insekticider blivit en av de snabbast växande klassen av insekticider. För närvarande har försäljningen av dessa tre insekticider årligen passerat 2 miljarder US-dollar med en tillväxttakt på mer än 50% sedan 2009 (Agranova).

Nyligen genomförda studier har rapporterat resistensutveckling hos insekter efter några generationer av användningen av dessa insektsmedel4,5,6,7,8. Resistensmutationer i domänen transmembrana av RyRs från diamondback mal (DBM), Plutella xylostella (G4946E, I4790M) och motsvarande positioner i tomat leafminer, Tuta absoluta (G4903E, I4746M) visar att regionen kan vara inblandade i diamide insektsmedel bindande eftersom denna region är känd för att vara kritiska för gating av channel4,8,9. Trots omfattande forskning på detta område fortfarande de exakta molekylära mekanismerna av diamide insekticider gäckande. Dessutom är det oklart huruvida resistensmutationer påverkar interaktionen med diamides direkt eller allosterically.

Tidigare studier har rapporterat strukturen för flera RyR domäner från däggdjursarter och struktur fullängds däggdjur RyR1 och RyR2 av röntgenkristallografi och cryo-elektronmikroskopi, respektive10,11, 12,13,14,15,16,17,18,19,20,21 . Men hittills har ingen struktur av insekt RyR har rapporterats, som förbjuder oss från att förstå funktionen receptor molekylär krångligheter samt insektsmedel molekylära verkningsmekanismer och insektsmedel resistensutveckling.

I detta manuskript presenterar vi en generaliserad protokoll för strukturella karakterisering av N-terminala β-klöver domänen för ryanodinreceptorn från diamondback mal, en destruktiv pest som infekterar korsblommiga grödor i världen22. Konstruktionen utformades enligt den publicera kanin RyR1 NTD crystal strukturer23,24och cryo-EM strukturella modeller16,17,18,19, 20 , 21. Detta är den första högupplösta strukturen som rapporterats för insekt RyR, som avslöjar mekanismen för kanal gating och ger en viktig mall för utvecklingen av artspecifika insekticider använder strukturbaserad design. För struktur klarläggande anställt vi röntgenkristallografi, som är ansedd som den 'gold standarden' för protein strukturbestämning på nära atomär upplösning. Även om kristallisation är oförutsägbar och arbetsintensivt, hjälper detta stegvisa protokoll forskare att uttrycka, rena och karakterisera andra domäner av insekt RyR eller några andra proteiner i allmänhet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. gen kloning, proteinuttryck och rening

  1. PCR förstärka DNA motsvarande protein av intresse (rester 1-205 av DBM RyR, Genbank acc. nr. AFW97408) och klon i pET-28a-HMT vektor av Ligation-oberoende kloning (LIC)25. Den här vektorn innehåller en histidin tagg, MBP-tagg och en TEV proteas klyvning webbplats vid N-terminalen15.
    1. Design LIC primers för förstärkning av målgenen med LIC-kompatibel 5' tillägg:
      Framåt LIC primer:
      5' TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3'
      Omvänd LIC primer:
      5' TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3'
    2. Kombinera de reaktion komponenterna (50 μL): 1 μL av DNA mallar (100 ng/μl), 1 μL av forward primer (10 μM), 1 μL av reverse primer (10 μM), 0,5 μL av DNA-polymeras (NEB), 5 μL 10 x reaktion buffert, 1 μL av dNTP (25 mM) , 40,5 μL av RNase gratis ddH2O.
      1. Placera reaktionsblandningen i en PCR-maskin och kör följande program.
      2. Inkubera vid 95 ° C i 3 min och sedan köra 30 cykler av (95 ° C i 30 s, 58 ° C för 15 s, 72 ° C i 1 min). Inkubera vid 72 ° C i 5 min och håll sedan vid 4 ° C.
      3. Köra den hela reaktionsblandning (50 μL) på en 2% agarosgel och extrahera med en Gel Extraction Kit. Följ tillverkarens protokollet.
    3. Ligation-oberoende kloning (LIC)
      1. Utföra SspI matsmältningen (60 μL): 20 μL av vektor DNA (50 ng/μl), 6 μL 10 x reaktion buffert, 4 μL av SspI och 30 μL av ddH2O. Inkubera vid 37 ° C i 3 h. kör hela reaktionen blanda på 1% agarosgel och extrahera med en Gel Extraction Kit. Följ tillverkarens protokollet.
      2. Utföra T4 DNA-polymeras behandling av vektorn och infoga DNA. Kombinera följande: 5 μL av vektor- eller infoga DNA (50 ng/μl), 2 μL 10 x T4 DNA-polymeras buffert, 1 μL av dGTP (25 mM) för vektor- eller 1 μL av dCTP (25 mM) för infoga DNA, 1 μL av DTT (100 mM), 0,4 μL av T4 DNA-polymeras (LIC-kvalificerad) , och 9,6 μL av ddH2O. Inkubera reaktioner i rumstemperatur i 40 min. värme-inaktivera enzym vid 75 ° C i 20 min.
        Obs: Den LIC vektor och infoga DNA måste behandlas i separata reaktioner.
      3. Utföra den LIC glödgning reaktion. Kombinera följande: 2 μL av T4-behandlade infoga DNA, 2 μL av T4-behandlade LIC vektor-DNA. Inkubera reaktion i rumstemperatur i 10 min.
  2. Omvandla BL21 (DE3) E. coli celler med detta rekombinant plasmid.
    1. Tina behöriga celler (50 μL i mikro-centrifugrör) på is.
    2. Tillsätt ungefär 1 μl (50 ng) av Plasmiden i röret. Blanda celler och DNA genom att försiktigt snärta röret 2 – 3 gånger. Placera röret på is i 20 min.
    3. Värme chock vid 42 ° C 40 s. plats röret på is igen för 2 min. Tillsätt 1 mL av rumstemperatur LB media till röret.
    4. Plats blandning röret i 250 rpm shaker vid 37 ° C för 45 min. sprida 150 – 200 µL av blandningen på val av plattorna. Vänd på plattan och inkubera över natten vid 37 ° C.
  3. Plocka en enda koloni och kultur cellerna i 100 mL 2YT medium innehållande 50 µg/mL kanamycin vid 37 ° C under natten. Nästa morgon Inokulera 1 L 2YT medium innehållande 50 µg/mL kanamycin med 10 mL övernattning kultur och inkubera i 37 ° C shaker inkubator vid 250 rpm, tills den OD600 når ~ 0,6. Därefter framkalla kulturen med IPTG till en slutlig koncentration på 0,4 mM och växa i en annan 5 h vid 30 ° C.
  4. Skörda cellerna genom centrifugering vid 8000 x g i 10 minuter vid 4 ° C, samla cellerna och resuspendera varje 10 g celler i 40 mL lyseringsbuffert (10 mM HEPES pH 7,4, 250 mM KCl, 10 mM β-merkaptoetanol, 25 μg/mL lysozym, 25 μg/mL DNAS 1 mM PMSF).
    1. Störa det av ultraljudsbehandling på 65% amplitud i 8 min med 1 s på och 1 s off. Ta bort cellfragment genom centrifugering vid 40 000 x g under 30 minuter vid 4 ° C. Filtrera supernatanten genom att passera genom 0,22 μm filter och ladda in den i provloop.
  5. Rena fusionsprotein, klyva etiketten och åter rena målproteinet.
    1. Rena proteinet fusion använder Ni-NTA kolumn (bindande buffert: 10 mM HEPES pH 7,4, 250 mM KCl; eluering buffert: 10 mM HEPES pH 7,4, 250 mM KCl, 500 mM Imidazol) och rena genom ett reningssystem, med en linjär gradient av 20 – 250 mM Imidazol.
    2. Klyva eluerade målproteinet med TEV proteas (1:50 baserat) över natten vid 4 ° C.
    3. Rena klyvning reaktionsblandningen med hjälp av amylose harts kolumn (bindande buffert: 10 mM HEPES pH 7,4, 250 mM KCl; eluering buffert: 10 mM HEPES pH 7,4, 250 mM KCl, 10 mM maltos) och Ni-NTA kolumnen ta bort taggen och TEV proteashämmare. Målproteinet blir i genomflöde fraktionen av dessa två kolumner.
    4. Dialyze provet mot dialys buffert (10 mM Tris-HCl pH 8,8, 50 mM KCl, 10 mM β-merkaptoetanol att minska saltkoncentrationen. Rena provet på en anjon Jonbytarkolonnen (bindande buffert: 10 mM Tris-HCl pH 8,8, 10 mM β-merkaptoetanol; eluering buffert: 10 mM Tris-HCl pH 8,8, 1 M KCl, 10 mM β-merkaptoetanol) av en linjär gradient av 20 – 500 mM KCl i eluering bufferten.
    5. Som ett sista steg i reningsprocessen, koncentrera sig proteinet med centrifugal koncentrator (10 kDa MWCO) och injicera i en Superdex 200 26/600 gelfiltrering kolumn att kontrollera homogenitet.
  6. Undersöka renheten av protein genom att köra det på en 15% SDS sida.
    Obs: Alla kolumner som körs på ett protein reningssystem med ett bindande flöde av 2 mL/min och en eluering flöde av 4 mL/min förutom gel-filtrering vid 1 mL/min.

2. protein förberedelse och kristallisering

  1. Koncentrera sig renat protein provet till 10 mg/mL med centrifugal koncentrator (10 kDa MWCO) och buffert exchange till kristallisation buffert innan lagring vid-80 ° C.
  2. Utföra kristallisering screening (1:1 ratio, 200 nL av protein och 200 nL reservoar buffert) av sammanträdet släpp ånga diffusion metoden på 295 K med flera kristallisering kit använda en automatiserad vätskehantering robotsystem i 96 brunnar format.
    Obs: Vi använde kit från molekylära dimensioner och Hampton forskning och Gryphon automatiserad vätskehantering system.
  3. Försegla 96 brunnar kristallisering plattan för att förhindra avdunstning och aktivera Jämviktstiden av protein droppe med reservoar bufferten. Sedan hålla plattorna i crystal inkubator vid 18 ° C.
  4. Kontrollera de 96 brunnar med jämna mellanrum med ett ljusmikroskop för att övervaka crystal bildandet och tillväxt.
  5. För att skilja proteinkristaller från saltkristaller, Använd en protein färg. Tillsätt 1 µL av färgämne till mål släppa. Vänta ca 1 h och observera under mikroskop. Proteinkristaller blir blå.
  6. Använd positiva kristallisering villkoren (1,5 M ammoniumsulfat, 0.1 M Tris pH 8,0) att ytterligare optimera kristallerna med hängande droppe vapor-diffusion metod i 24 brunnar.
    1. Optimera pH från 7,0 till 8,5 med 0,5 pH enhet intervall varje steg. Optimera koncentration av ammoniumsulfat från 1,2 M till 1,7 M med 0,1 M intervall varje steg. (I vårt fall bästa skick producerar stora plattan-formade kristaller var 0,1 M HEPES pH 7,0 och 1,6 M ammoniumsulfat)

3. Crystal montering, röntgen datainsamling och strukturbestämning

  1. Montera kristaller i en cryoloop och flash-cool i flytande kväve med reservoar lösning innehållande 20% glycerol som cryo-protectant. Placera kristallerna i unipuck för lagring och transport.
  2. Förhandsgranska proteinkristaller som använder en Rigaku interna röntgen diffractor. Välj de bästa högsta resolutioner för datainsamling på synkrotron faciliteter (vårt dataset samlats från BL17U1 på Shanghai synkrotronljuskällan).
    1. Använd programmet beamline kontroll BluIce26 att montera och centrera kristallerna genom automatisk eller manuell centrering funktion. Utföra test exponeringar för att bestämma strategin data insamling, inklusive utgångsmaterial vinkel, exponeringstid, detektor avstånd, ramens bredd och siffror.
    2. Samla dataset med detta (vi samlat 180 ramar med 1 s exponeringstid, 1° ram bredd och detektor avståndet 350 mm).
  3. Index, integrera och skala den datamängd som använder HKL2000 suite27. Först genomföra peak sökfunktionen hitta diffraktion fläckar, och sedan indexera fläckarna och markera utrymmegruppen rätt. Efter peak integration, skala datamängden med rätt fel modell och spara .sca utdatafilen.
  4. Lösa problemet fas genom molekylär ersätter med Phaser28 i PHENIX29.
    1. Beräkna antalet möjliga kopia av proteinmolekyler i enheten asymmetriska Xtriage30.
    2. Leta efter rätt struktur mallarna med hög sekvens identitet och strukturella likheten som målproteinet använder kända strukturer från litteraturen eller de modeller som genereras av struktur förutsägelse server såsom Phyre231 (vi använde kanin RyR1 NTD som en sökning modell, PDB-ID 2XOA).
    3. Kör Phaser använder diffraktion datafilen, filen template struktur och protein sequence filen för att hitta lösningen.
  5. Utföra AutoBuild32 i PHENIX29 att generera den första modellen som använder utdatafilen från Phaser och filen sekvens från målproteinet.
  6. Manuellt bygga strukturen i modifierad experimentella elektrontätheten använder sothöna33 och förfina med phenix.refine34 i iterativa cykler.
  7. Validera den slutliga modellen med hjälp av validering verktyg i PHENIX18.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Rening

Den N-terminala domänen av DBM RyR uttrycktes ett fusionsprotein med en hexahistidine-tagg, en MBP-tagg och en TEV proteas klyvning webbplats. Vi följde en fem-stegs rening strategi för att få ett mycket rent protein, lämpliga för kristallisering ändamål. Först var fusionsprotein renats från den lösliga fraktionen av cell lysate av Ni-NTA kolumn (HisTrap hk). Nästa, fusionsprotein utsattes för TEV proteas klyvning och den hexahistidine-MBP biexponentiellt togs bort av amylose harts kolumn följt av Ni-NTA kolumn. Dessutom proteinet renades av anjon Jonbytarkolonnen (Q Sepharose HP) och slutligen efter gelfiltrering kolumn (Superdex 200 26/600). Den slutliga avkastningen av renat protein från 1 L bakterieodling med 2YT media var ~ 4 mg. Det renat proteinet visade ett enda band på SDS-PAGE på ~ 21 kDa (figur 1). Elutionsvolymen från gelfiltrering kolumn bekräftade den renade RyR NTD för att vara en monomer (figur 1).

Kristallisering

Inledande kristallisering screening i 96 brunnar gav kristaller i flera villkor. Dessa villkor har valts för crystal optimering i 24 plattor. Den mest optimala villkor där hög kvalitet plattan-form kristaller bildades var 0,1 M HEPES pH 7,0 och 1,6 M ammoniumsulfat (figur 2).

Strukturbestämning

Kristaller erhålls var bombarderas till 2,84 Å på beamline BL17U1 på Shanghai synkrotronljuskällan. Kristallen indexerades i utrymmegruppen P61 med enhet-cell parametrar en = 170.13, b = 170.13, c = 51.763 Å, α = β = 90.00 °, γ = 120 °. För strukturbestämning anställdes molekylär ersättning med kanin RyR1 NTD som Sök modell i PHENIX. Ytterligare förfining av struktur skedde i PHENIX en sista Rarbeta och Rgratis 21,63 och 24.52%, respektive. Data insamling och förfining statistiken listas i tabell 1. DBM RyR NTD täcker rester 1-205 (PDB-ID 5Y9V) löst struktur visas i figur 3.

Figure 1
Figur 1: SDS-PAGE och gel filtrering kromatogram som representerar rening av DBM RyR NTD35. SDS-PAGE (15%) i infällt visar renat DBM RyR NTD som ett enda band efter de fem steg rening strategi. Vänster körfält visar standard protein markör (PM). Gel filtrering kromatogrammet erhålls med en Superdex 200 26/600 kolumn visar eluering toppen på 240 mL, vilket motsvarar monomera form av proteinet. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2. Kristallisation av DBM RyR NTD35Kristaller av DBM RyR NTD tillverkas av vapor-diffusion metod som sett under ett ljusmikroskop. Kristallisering villkoret var 0,1 M HEPES pH 7,0 och 1,6 M ammoniumsulfat. Skalstapeln = 200 µm. vänligen klicka här för att visa en större version av denna siffra.

Figure 3
Figur 3: Struktur av DBM RyR NTD (PDB ID 5Y9V)35Löst strukturen för det protein som visas från två vyer. Sekundärt strukturera element är märkta. Β delar visas i lila. Α helix och en 310 helix visas i blått. Loopar visas i vitt. NT och Ct representerar den N-terminala C-terminal av proteinet, respektive. Klicka här för att se en större version av denna siffra.

Tabell 1: Data insamling och förfining statistik för DBM RyR NTD crystal35. Vänligen klicka här för att hämta tabellen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

I detta papper beskriver vi förfarandet för att recombinantly express, rena, kristallisera och utreda strukturen av DBM RyR NTD. För kristallisering är ett viktigt krav att få proteiner med hög löslighet, renhet och homogenitet. I våra protokoll valde vi att använda pET-28a-HMT vektor eftersom det innehåller en hexahistidine-tagg och MBP tagg, som båda skulle kunna utnyttjas för rening att erhålla en högre fold renhet. Dessutom de MBP tag aids i målproteinet löslighet. Vi renat protein av fem på varandra följande steg som gett protein som var mycket ren och lämplig för kristallisering. Kristallisering screening utfördes med hjälp av automatiserad vätskehantering system. Jämfört med traditionella screening av manuell droppe inställning, automatiserat system använder mycket små volymer av provet, sparar tid och energi. Det förbättrar också reproducerbarhet på grund av riktigheten av vätskehantering. Kristaller var bombarderas internt för screening och på synkrotronljus för datainsamling eftersom det ger röntgen med högre intensitet och mindre avvikelser, vilket därmed ger högkvalitativ data. Molekylär ersättning var vårt första val som var liknande strukturell mallar finns i databasen. Det alternativa sättet är att använda experimentella fasa, inklusive MAD, SAD, MIR, etc.

Medan lösa strukturen av DBM RyR NTD, Matthews koefficienterna erhålls från Xtriage30 föreslog att asymmetriska enheten (ASU) troligtvis innehöll fyra monomerer med 46% lösningsmedel innehåll, som har en sannolikhet på 49%. Dock kunde vi inte hitta rätt lösning med fyra molekyler i ASU. Efterföljande körningar att leta efter två, tre, fem, sex molekyler också misslyckats. Till slut hittade vi rätt lösning med endast en molekyl i ASU, som bara har 4% sannolikhet och över 86% lösningsmedel innehåll. Hög vattenhalt bekräftades efter att vi löst struktur. Den extrema höga halten lösningsmedel existerar således, beroende på i vilket protein förpackningar inneboende.

Även om röntgenkristallografi är en guld-standard i protein strukturbestämning, är proteiner med stora disorder eller flexibel regioner och vissa stora proteinkomplex med svag affinitet utmanande för att kristallisera. Protein engineering metoder, inklusive loop-trunkering, yta entropi minskning och bryggbindningen, kan förbättra chansen att få bättre proteinkristaller. Förutom den avslöjande av högupplösta proteinstrukturer, kan röntgenkristallografi också användas att studera de protein-bekämpningsmedel interaktioner, som skulle hjälpa oss på struktur-baserade bekämpningsmedel design. Qi et al. fann att olika familjer av diamides kan binda till olika platser som skiljer över arter36. Använder vår strategi, du kan bestämma RyR strukturer från flera arter och identifiera de unika element som är ansvarig för den observerade species-specificity. Övergripande, detta protokoll kan anpassas för uttryck, rening, kristallisering och struktur bestämning av proteiner eller protein domäner själva eller i komplex med småmolekylära läkemedel.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgements

Finansiering för denna forskning lämnades av: nationella nyckel forskning och utveckling Program i Kina (2017YFD0201400, 2017YFD0201403), nationella natur Science Foundation of China (31320103922, 31230061) och projekt av nationell grundforskning (973) Program för Kina (2015CB856500, 2015CB856504). Vi är tacksamma till Personalen på beamline BL17U1 på Shanghai Synchrotron Radiation Facility (SSRF).

Materials

Name Company Catalog Number Comments
pET-28a-HMT vector This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain Novagen 69450-3CN
HisTrapHP column (5 mL) GE Healthcare 45-000-325
Amylose resin column New England Biolabs E8021S
Q Sepharose high-performance column  GE Healthcare 17-1154-01
Amicon concentrators (10 kDa MWCO) Millipore UFC901008
Superdex 200 26/600 gel-filtration column  GE Healthcare 28-9893-36
Automated liquid handling robotic system  Art Robbins Instruments Gryphon
96 Well CrystalQuick Greiner bio-one 82050-494
Uni-Puck Molecular Dimensions MD7-601
Mounted CryoLoop - 20 micron Hampton Research HR4-955
CryoWand Molecular Dimensions MD7-411
Puck dewar loading tool Molecular Dimensions MD7-607
Nano drop Thermo Scientific NanoDrop One
Crystal incubator Molecular Dimensions MD5-605
X-Ray diffractor Rigaku FRX
PCR machine Eppendorf Nexus GX2
Plasmid mini-prep kit Qiagen 27104
Gel extraction kit Qiagen 28704
SspI restriction endonuclease NEB R0132S
T4 DNA polymerase Novagen 2868713
Kanamycin Scientific Chemical 25389940
IPTG Genview 367931
HEPES Genview 7365459
β-mercaptoethanol Genview 60242
Centrifuge Thermo Scientific Sorvall LYNX 6000 
Sonnicator Scientz II-D
Protein purification system GE Healthcare Akta Pure
Light microscope Nikon SMZ745
IzIt crystal dye Hampton Research HR4-710
Electrophoresis unit Bio-Rad 1658005EDU
Shaker Incubator Zhicheng ZWYR-D2401
Index crystal screen Hampton Research HR2-144
Structure crystal screen Molecular Dimensions MD1-01
ProPlex crystal screen Molecular Dimensions MD1-38
PACT premier crystal screen Molecular Dimensions MD1-29
JCSG-plus crystal screen Molecular Dimensions MD1-37

DOWNLOAD MATERIALS LIST

References

  1. Giannini, G., Sorrentino, V. Molecular structure and tissue distribution of ryanodine receptors calcium channels. Medicinal Research Reviews. 15, (4), 313-323 (1995).
  2. Takeshima, H., et al. Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster. FEBS Letters. 337, (1), 81-87 (1994).
  3. Sattelle, D. B., Cordova, D., Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebrate Neuroscience. 8, (3), 107-119 (2008).
  4. Steinbach, D., et al. Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella. Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).
  5. Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China. Pest Management Science. 69, (5), 661-665 (2013).
  6. Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae). Journal of Economic Entomology. 108, (4), 1978-1985 (2015).
  7. Guo, L., et al. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Management Science. 70, (7), 1083-1089 (2014).
  8. Troczka, B., et al. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochemistry and Molecular Biology. 42, (11), 873-880 (2012).
  9. Roditakis, E., et al. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).
  10. Borko, L., et al. Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias. Acta Crystallographica Section D. 70, (Pt 11), 2897-2912 (2014).
  11. Sharma, P., et al. Structural determination of the phosphorylation domain of the ryanodine receptor. FEBS Journal. 279, (20), 3952-3964 (2012).
  12. Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface. Nature Communications. 4, 1506 (2013).
  13. Lau, K., Van Petegem, F. Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain. Nature Communications. 5, 5397 (2014).
  14. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  15. Lobo, P. A., Van Petegem, F. Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations. Structure. 17, (11), 1505-1514 (2009).
  16. des Georges, A., et al. Structural Basis for Gating and Activation of RyR1. Cell. 167, (1), 145-157 (2016).
  17. Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. Architecture and conformational switch mechanism of the ryanodine receptor. Nature. 517, (7532), 39-43 (2015).
  18. Peng, W., et al. Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2. Science. 354, (6310), (2016).
  19. Wei, R. S., et al. Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1. Cell Research. 26, (9), 977-994 (2016).
  20. Yan, Z., et al. Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution. Nature. 517, (7532), 50-55 (2015).
  21. Zalk, R., et al. Structure of a mammalian ryanodine receptor. Nature. 517, (7532), 44-49 (2015).
  22. Furlong, M. J., Wright, D. J., Dosdall, L. M. Diamondback moth ecology and management: problems, progress, and prospects. Annual Review of Entomology. 58, 517-541 (2013).
  23. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  24. Lobo, P. A., Van Petegem, F. Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations. Structure. 17, (11), 1505-1514 (2009).
  25. Aslanidis, C., de Jong, P. J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Research. 18, (20), 6069-6074 (1990).
  26. Stepanov, S., et al. JBluIce-EPICS control system for macromolecular crystallography. Acta Crystallographica Section D. 67, (3), 176-188 (2011).
  27. Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes. Acta Crystallographica Section D. 62, (Pt 8), 859-866 (2006).
  28. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40, (Pt 4), 658-674 (2007).
  29. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D. 66, (Pt 2), 213-221 (2010).
  30. Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation. CCP4 Newsletter. (43), 27-35 (2005).
  31. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 10, (6), 845-858 (2015).
  32. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D. 64, (Pt 1), 61-69 (2008).
  33. Emsley, P., Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallographica Section D. 60, 2126-2132 (2004).
  34. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallographica Section D. 68, (Pt 4), 352-367 (2012).
  35. Lin, L., et al. Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites. Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).
  36. Qi, S., Casida, J. E. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor. Pesticide Biochemistry and Physiology. 107, (3), 321-326 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics