N 맨끝 도메인의 Ryanodine 수용 체 이용한 배 xylostella 에서 결정 구조

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

이 문서에서는, 우리는 다이아몬드 나 방 (이용한 배 xylostella)에서 ryanodine 수용 체의 N 맨끝 도메인의 단백질 식, 정화, 결정 화 및 구조 결정의 프로토콜 설명합니다.

Cite this Article

Copy Citation | Download Citations

Nayak, B. C., Wang, J., Lin, L., He, W., You, M., Yuchi, Z. Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella. J. Vis. Exp. (141), e58568, doi:10.3791/58568 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

곤충 ryanodine 수용 체 (RyRs)를 대상으로 하는 강력 하 고 효율적인 살충제의 개발 농업 해충의 영역에 큰 관심의 되었습니다. 까지, 몇몇 diamide 살충제 RyRs 상용화 되었습니다 해충을 대상으로는 2 십억 미국 달러의 연간 수익을 생성 합니다. 그러나 RyR 타겟팅 살충제의 행동의 모드의 이해 구조 정보 곤충 RyR의 부족에 의해 제한 된다. 이 차례로 해충에 살충제 저항 개발의 이해를 제한합니다. 다이아몬드 나 방 (DBM) diamide 살충제에 저항을 표시를 보고도 전세계, 십자화과 작물 파괴 엄청난 해충 이다. 그러므로, DBM RyR, 특히 전통적인 diamide 바인딩 사이트에서 다른 영역을 대상으로 타겟팅 새로운 살충제를 개발 하는 실용적인 중요성의 이다. 여기, 선물이 구조적 특성 DBM에서 RyR의 N 맨끝 도메인 프로토콜. X 선 결정 구조 분자 교체는 해상도에 의해 해결 되었다 Å는 2.84의 베타-개미 자리의 접는 모티브와 측면에 서 알파 나선 보여줍니다. 이 프로토콜은 일반적으로 식, 정화와 다른 도메인 또는 단백질의 구조적 특성에 대 한 적응 될 수 있다.

Introduction

Ryanodine 수용 체 (RyRs)은 근육 세포에 sarcoplasmic 그물 (SR) 세포 막에 걸쳐 캘리포니아2 + 이온의 투과 중재 하는 특정 이온 채널입니다. 따라서, 그들은 흥분 수축 연결 과정에서에서 중요 한 역할을 재생 합니다. 기능 형태의 RyR의 분자 질량을 가진 호모 tetramer로 조립 > ~ 5000 아미노산 잔류물의 구성 하는 각 소 단위와 2 MDa. 포유류에서 3 개의 isoforms는: RyR1 골격 근육 형, RyR2-심장 근육 유형 및 RyR3-다른 조직1편 표현.

곤충에는 근육과 신경 조직2에서 표현 RyR의 한 유형이 있다.입니다. 곤충 RyR 비슷합니다 더 약 47%의 시퀀스 id 가진 포유류 RyR23. 타겟팅 RyR의 나비목과 딱정벌레목 Diamide 살충제를 개발 하 고 바이엘 (flubendiamide), 듀 폰 (chlorantraniliprole) 및 Syngenta (cyantraniliprole) 같은 주요 기업에 의해 판매 되었습니다. 비교적 최근 출시 이후, diamide 살충제 살충제의 급성장 클래스 중 하나가 되고있다. 현재, 매년 이러한 세 가지 살충제의 판매는 2009 (Agranova) 이후 50% 이상의 성장 율을 가진 2 십억 미국 달러를 넘어 있다.

최근 연구 결과 이러한 살충제4,,56,,78의 사용의 몇 세대 후에 곤충 저항 개발을 보고 있다. 저항 막 횡단 영역에서의 변이 RyRs 다이아몬드 나 방 (DBM), 이용한 배 xylostella (G4946E, I4790M)와 토마토 leafminer에 해당 위치에서 Tuta absoluta (G4903E, I4746M) 표시 하는 지역 로이 지역 채널4,,89의 게이팅에 대 한 중요 한 것으로 알려져 있다 diamide 살충제 바인딩에 참여 수 있습니다. 이 지역에 광범위 한 연구에도 불구 하 고 diamide 살충제의 정확한 분자 메커니즘 애매 남아 있습니다. 또한, 그것은 하지 분명 여부 저항 돌연변이 영향을 diamides와의 상호 작용 또는 allosterically입니다.

포유류 종에서 여러 RyR 도메인의 구조와 전장 포유류 RyR1 및 RyR2의 구조 엑스레이 결정학 그리고 cryo 전자 현미경 검사 법, 각각10,11에 의해 이전 연구 보고가 12,13,14,15,,1617,18,19,20,21 . 하지만 지금까지, 아니 구조 곤충 RyR의 보고 되었습니다,이 이해는 분자의 복잡 한 수용 체 기능 뿐만 아니라 살충제 행동의 분자 메커니즘 및 살충제 저항의 개발에서 우리를 금지.

이 원고에서 선물이 다이아몬드 나 방, 파괴적인 해충 감염 십자화과 작물 전세계22에서 ryanodine 수용 체의 N 맨끝 β-개미 자리의 도메인의 구조적 특성에 대 한 일반화 된 프로토콜. 게시 된 토끼 RyR1 NTD 크리스탈 구조23,24및 곳을 알아내는-그들 구조 모델16,17,,1819, 는 구조 설계 되었다 20 , 21. 이것은 최초의 고해상도 구조 곤충 RyR 채널 게이팅 메커니즘을 밝혀 고 구조 기반 약물 설계를 사용 하 여 종의 살충제의 개발에 대 한 중요 한 서식 파일을 제공 합니다에 대 한 보고. 구조 설명, 우리 사용 엑스레이 결정학, 원자 해상도 근처에서 단백질 구조 결심을 위한 ' 골드 표준 '으로 간주 됩니다. 결정 화 과정은 예측할 수 없는 노동 집약, 비록이 단계별 프로토콜 표현, 정화 및 곤충 RyR 또는 다른 단백질의 다른 도메인의 일반적 특성 연구를 도울 것 이다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. 유전자 복제, 단백질 표정과 정화

  1. PCR 증폭 관심사의 단백질에 해당 하는 DNA (DBM RyR, 은행의 잔류물 1-205 없음 acc.. AFW97408) 및 결 찰 독립적인 복제 (LIC)25애완 동물-28a-HMT 벡터에 클론. 이 벡터 포함 히스티딘 태그, MBP 태그와 N-말단에 TEV protease 분열 사이트15.
    1. LIC 호환 5' 확장명을 가진 대상 유전자의 증폭에 대 한 디자인 LIC 뇌관:
      LIC 뇌관을 전달:
      5 ' 3' TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG
      역방향 LIC 뇌관:
      5 ' 3' TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC
    2. 결합 반응 구성 요소 (50 μ): DNA 템플릿 (100 ng/μ), 앞으로 뇌관 (10 μ M), 역방향 뇌관 (10 μ M), DNA 중 합 효소 (코), 10 x 반응의 5 μ의 0.5 μ의 1 μ의 1 μ 1 μ 버퍼, dNTP (25 mM)의 1 μ RNase의 40.5 μ 무료 ddH2o.
      1. PCR 기계에 반응 혼합물을 놓고 다음 프로그램을 실행 합니다.
      2. 3 분 동안 95 ° C에서 품 어와 다음의 30 주기 실행 (95 ° C 30에 대 한 s, 58 ° C 15에 대 한 s, 1 분에 72 ° C). 5 분 동안 72 ° C에서 품 어와 다음 4 ° c.에서 개최
      3. 2 %agarose 젤에 전체 반응 혼합 (50 μ)을 실행 하 고 젤 추출 키트와 함께 추출. 제조 업체의 프로토콜을 따릅니다.
    3. 결 찰 독립적인 복제 (LIC)
      1. SspI 소화 (60 μ)를 수행: 벡터 DNA의 20 μ (50 ng/μ), 반응 버퍼, SspI, 4 μ 그리고 ddH2오 품 전체 반응 실행 3 h. 위해 37 ° C에서 30 μ x 10의 6 μ 1 %agarose 젤에 혼합 하 고 젤 추출 키트와 함께 추출. 제조 업체의 프로토콜을 따릅니다.
      2. 벡터의 T4 DNA 중 합 효소 처리를 수행 하 고 DNA를 삽입 합니다. 다음 결합: 벡터 또는 삽입 DNA의 5 μ (50 ng/μ), 10 x T4 DNA 중 합 효소 버퍼, 벡터 또는 삽입 dna, DTT (100 m m), 0.4 μ의 T4 DNA 중 합 효소 (LIC 한정)의 1 μ dCTP (25 m m)의 1 μ에 대 한 dGTP (25 m m)의 1 μ의 2 μ 그리고 20 분 동안 75 ° C에서 40 분 열 비활성화 효소에 대 한 실 온에서 ddH2오 품 반응의 9.6 μ.
        참고: LIC 벡터 및 삽입 DNA는 별도 반응에서 처리 되어야 합니다.
      3. LIC 반응 어 닐 링을 수행 합니다. 다음 결합: T4 치료 삽입 DNA, LIC T4 치료의 2 μ의 2 μ 벡터 DNA. 10 분 동안 실내 온도에 반응을 품 어.
  2. 변환 BL21 (DE3) E. 콜라 이 재조합 플라스 미드와 셀.
    1. 유능한 세포 (마이크로 원심 튜브에서 50 μ) 얼음에 녹여
    2. 추가 약 1 μ (50 기) 튜브에 플라스 미드의. 부드럽게 터치 튜브 2-3 번 하 여 세포와 DNA를 혼합. 20 분 동안 얼음에 튜브를 놓습니다.
    3. 다시 2 분 추가 1 mL 튜브에 실내 온도 파운드 미디어에 대 한 얼음에 튜브 40 s. 위 42 ° C에서 충격을 열.
    4. 장소는 250 rpm 흔드는 37 ° C에서 45 분에 혼합 튜브 150-200 µ L 선택 접시에 혼합물의 확산. 접시를 반전 하 고 37 ° c.에서 밤새 품 어
  3. 단일 식민지와 문화 100 mL 2YT 매체 하룻밤 37 ° C에서 50 µ g/mL 대를 포함 하는 셀 선택 합니다. 다음날 아침, 접종 1 L 2YT 매체의 숙박 문화 10 mL와 함께 50 µ g/mL 대를 포함 하 고 OD600 ~ 0.6에 도달할 때까지 250 rpm에서 37 ° C 흔드는 인큐베이터에서 품 어. 그 후 0.4 m m의 최종 농도에 IPTG로 문화를 유도 하 고 또 다른 5 h 30 ° c.에 대 한 성장
  4. 4 ° C에서 10 분 동안 8000 x g 에서 원심 분리 하 여 세포를 수확, 셀을 수집 하 고 모든 10 g 셀 40 mL 세포의 용 해 버퍼 (10 mM HEPES pH 7.4, 250 m m KCl, 10mm β-mercaptoethanol, 25 μ g/mL lysozyme, 25 μ g/mL DNase resuspend 1 밀리미터 PMSF).
    1. 1 8 분 65% 진폭에서 쥡니다에 의해 방해 s에서 및 1 s. 4 ° c.에 30 분 동안 40000 x g 에서 원심 분리에 의해 세포 파편을 제거 0.22 μ m 필터를 통해 전달 하 여는 상쾌한 필터 및 샘플 루프에 그것을 로드.
  5. 융해 단백질 정화, 태그를 쪼개 고 다시 대상 단백질 정화.
    1. Ni NTA 열을 사용 하 여 융해 단백질 정화 (바인딩 버퍼: 10 mM HEPES pH 7.4, 250 m m KCl; 차입 버퍼: 10 mM HEPES pH 7.4, 250 m KCl, 500mm 이미 m) 20-250 m m 이미의 선형 그라데이션으로 정화 시스템에 의해 정화.
    2. TEV protease와 eluted 대상 단백질을 쪼개 다 (1시 50분 비율) 4 ° c.에서 하룻밤
    3. Amylose 수 지 열을 사용 하 여 분열 반응 혼합물을 정화 (바인딩 버퍼: 10 mM HEPES pH 7.4, 250 m m KCl; 차입 버퍼: 10 mM HEPES pH 7.4, 250 m m KCl, 10mm 糖)과 Ni NTA 열 태그 및 TEV protease 제거 하. 대상 단백질이 두 열 흐름을 통해 일부 있을 것입니다.
    4. 투 석 버퍼 (10 mM Tris HCl 산도 8.8, 50 m KCl, 10mm β-mercaptoethanol을 소금 농도 줄이기 위해 m에 대 한 샘플 dialyze. 음이온 교환 칼럼에 샘플을 정화 (바인딩 버퍼: 10 mM Tris HCl pH 8.8, 10 m m β-mercaptoethanol; 차입 버퍼: 10 mM Tris HCl pH 8.8, 1 M KCl, 10mm β-mercaptoethanol) 차입 버퍼에 20-500 m m KCl의 선형 그라데이션에 의해.
    5. 정화 과정에서 마지막 단계로, 원심 집중 (10 kDa MWCO) 장치를 사용 하 여 단백질을 집중 하 고는 동질성을 확인 하는 Superdex 200 26/600 젤 여과 열을 삽입 합니다.
  6. 15 %SDS 페이지에 그것을 실행 하 여 단백질의 순도 확인 합니다.
    참고: 모든 열 바인딩 유량 2 mL/min, 및 4 mL/min 1 mL/min에서 젤 여과 제외에 차입 유량 단백질 정화 시스템에서 실행 됩니다.

2. 단백질 준비 및 결정 화

  1. 순화 된 단백질 샘플 10 mg/ml-80 ° c.에 저장 하기 전에 원심 집중 (10 kDa MWCO) 및 결정 화 버퍼를 버퍼 exchange를 사용 하 여 집중
  2. 결정 화 심사 수행 (1:1 비율, 200 단백질 및 200의 nL 저수지 버퍼의 nL) 기에 의해 드롭 증기 확산 방법 96 잘 형태로 로봇 시스템을 처리 하는 자동화 된 액체를 사용 하 여 여러 결정 화 장비 295 K에서.
    참고: 우리 분자 크기와 햄튼 연구에서 키트를 사용 하 고 Gryphon 자동 액체 처리 시스템.
  3. 증발을 방지 하기 위해 활성화 단백질 드롭 저수지 버퍼의 평형 96 잘 결정 화 접시를 봉인. 다음 18 ° c.에 크리스탈 인큐베이터에 접시를 유지
  4. 96 잘 접시 크리스탈 형성 및 성장 모니터링 하 가벼운 현미경을 사용 하 여 주기적으로 확인 합니다.
  5. 소금 결정에서 단백질 결정을 차별화, 단백질 염료를 사용 합니다. 대상 드롭 염료의 1 µ L를 추가 합니다. 약 1 시간 기다립니다 고 현미경 관찰 합니다. 단백질 결정 블루 돌 것 이다.
  6. 긍정적인 결정 화 조건 (황산 암모늄 1.5 M, 0.1 m M Tris pH 8.0)를 사용 하 여 교수형을 사용 하 여 결정을 더욱 최적화 증기 확산 방법 24-잘 접시에 놓습니다.
    1. PH 7.0에서 0.5 pH 단위 간격 8.5 모든 단계를 최적화 합니다. 모든 단계 0.1 M 간격 1.2 M에서 1.7 m 황산 암모늄의 농도 최적화 합니다. (우리의 경우 대형 접시 모양의 크리스탈 생산 최고의 조건이 0.1 m M HEPES pH 7.0 및 1.6 M 황산 암모늄)

3. 크리스탈 장착, x-선 데이터 수집 및 구조 결정

  1. cryoloop에서 결정과 플래시-멋진 곳을 알아내는-막는으로 20% 글리세롤을 포함 된 저수지 솔루션을 사용 하 여 액체 질소에 탑재 합니다. 저장과 수송에 대 한 unipuck에 크리스탈을 놓습니다.
  2. 전 단백질 결정 리가 사내 x 선 diffractor를 사용 하 여 화면. (우리의 데이터 집합 상해 싱크 로트 론 방사선 시설에서 BL17U1에서 수집 된) 싱크 로트 론 시설에서 데이터 컬렉션에 대 한 높은 해상도 함께 최고의 것 들을 선택 하십시오.
    1. BluIce26 beamline 제어 소프트웨어를 사용 하 여 탑재 하 고 자동 또는 수동 중심 기능에 의해 결정 가운데. 시작 각도, 노출 시간, 검출기 거리, 프레임 너비와 숫자를 포함 하 여 데이터 수집 전략을 결정 하기 위해 테스트 노출 수행 합니다.
    2. 따라서 데이터 집합을 수집 (우리가 수집 1 s 노출 시간, 1 ° 프레임 폭 350 mm의 발견자 거리와 180 프레임).
  3. 색인, 통합 및 HKL2000 스위트27을 사용 하 여 데이터 집합을 확장. 먼저 찾을 회절 반점, 피크 검색 기능을 수행 하 고 관광 명소 다음 색인 오른쪽 공간 그룹을 선택 합니다. 피크 통합 후 적절 한 오류 모델과 데이터 집합을 확장 하 고 출력.sca 파일을 저장 합니다.
  4. 분자 교체 피닉스29페이저28 을 사용 하 여 위상 문제를 해결.
    1. Xtriage30여 비대칭 단위에서 단백질 분자의 가능한 복사본 수를 계산 합니다.
    2. 문학 또는 Phyre231 같은 구조 예측 서버에 의해 생성 된 모델에서 알려진된 구조를 사용 하 여 대상 단백질으로 정체성과 구조적 유사성을 높은 시퀀스와 적절 한 구조 서식 파일에 대 한 보고 (토끼 RyR1 NTD 사용으로 검색 모델, PDB ID 2XOA).
    3. 페이저는 해결책을 찾기 위해 회절 데이터 파일, 서식 파일 구조 파일 및 단백질 시퀀스 파일을 사용 하 여 실행 합니다.
  5. 빌드32 피닉스29 페이저에서 출력 파일에서 대상 단백질 시퀀스 파일을 사용 하 여 초기 모델을 생성 하기 위해 수행 합니다.
  6. 수동으로 쿳33 를 사용 하 여 수정 된 실험적인 전자 밀도에 구조를 구축 하 고 반복 되는 주기에서 phenix.refine34 를 사용 하 여 수정.
  7. 피닉스18에서 유효성 검사 도구를 사용 하 여 최종 모델을 확인 합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

정화

DBM RyR의 N 맨끝 도메인 TEV protease 분열 사이트, MBP 태그와 hexahistidine 태그 융합 단백질으로 표현 했다. 우리는 매우 순수한 단백질 결정 화 목적에 적합을 얻기 위해 5 단계 정화 전략을 따 랐 다. 처음에, 융해 단백질 Ni NTA 열 (HP HisTrap)에 의해 세포 lysate의 녹는 분수에서 순화 했다. 다음으로, TEV protease 분열 융해 단백질은 대상 하 고 hexahistidine MBP moiety amylose 수 지 열 Ni NTA 열 뒤에 의해 삭제 되었습니다. 또한, 단백질 음이온 교환 열 (Q Sepharose HP)에 의해 순화 되었다 그리고 마지막으로 젤 여과 열 (Superdex 200 26/600). 2YT 미디어를 사용 하 여 1 L 세균성 문화에서 순화 된 단백질의 최종 수익률 ~ 4 mg을 했다. 순화 된 단백질 SDS-PAGE ~ 21 kDa (그림 1)에서 단일 밴드를 보여주었다. 젤 여과 열에서 차입 볼륨 단위체 (그림 1) 되도록 순화 RyR NTD 확인.

결정 화

초기 결정 화 96 잘 접시 상영 나왔고 여러 조건에서 결정. 이러한 조건 24 잘 플레이트에 크리스탈 최적화 선택 했다. 높은 품질 접시 모양 결정 형성 되었다 가장 최적의 조건 pH 7.0 및 1.6 M 황산 암모늄 0.1 M HEPES (그림 2) 했다.

구조 결정

크리스탈 얻은 2.84 Å beamline BL17U1 상해 싱크 로트 론 방사선 시설에서에 diffracted 이었다. 크리스털 공간 그룹 P6에에서 색인은1 단위 세포 매개 변수는 = 170.13, b 170.13, c = 51.763 Å, α = β = 90.00 °, γ = = 120 °. 구조 결정에 대 한 분자 대체 토끼 RyR1 NTD 피닉스에서 검색 모델로 사용 하 여 고용 했다. 구조의 더 구체화가 이루어졌다 피닉스 최종 R 및 R무료 21.63 24.52%, 각각. 데이터 수집 및 상세 통계 표 1에 나열 됩니다. DBM RyR NTD 잔류물 1-205 (PDB ID 5Y9V) 취재의 해결된 구조는 그림 3에 표시 됩니다.

Figure 1
그림 1: SDS 페이지와 겔 여과 크로마 DBM RyR NTD35의 정화 대표. SDS 페이지 (15%)에 삽입 후 5 단계 정화 전략 단일 밴드 순화 DBM RyR NTD 보여줍니다. 왼쪽된 차선 표준 단백질 마커 (오후)을 보여 줍니다. Superdex 200 26/600 열을 사용 하 여 얻은 겔 여과 크로마 240 mL, 해당 단백질의 단위체 형태 하에서 차입 피크를 보여준다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2입니다. DBM의 결정 화 RyR NTD35가벼운 현미경 아래에서 본 크리스탈 DBM RyR NTD 증기 확산 방법에 의해 생산. 결정 화 조건 0.1 M HEPES pH 7.0 및 1.6 M 염화 황산 염 이었다. 눈금 막대 = 200 µ m. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: DBM RyR NTD의 구조 (PDB 5Y9V ID)35두 보기에서 표시 된 단백질의 구조를 해결. 이차 구조 요소 레이블이 지정 됩니다. Β 물가 자주색으로 표시 됩니다. Α 나선 및 310 나선 파란색으로 표시 됩니다. 루프는 흰색으로 표시 됩니다. Nt 및 Ct는 N 맨끝 및 단백질의 C-터미널에 각각 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

표 1: DBM RyR NTD 크리스탈35에 대 한 데이터 수집 및 상세 통계. 이 테이블을 다운로드 하려면 여기를 클릭 하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

이 문서에서 우리는 recombinantly 익스프레스, 정화, 구체화 및 DBM RyR NTD의 구조를 결정 하는 절차를 설명 합니다. 결정 화에 대 한 중요 한 요구 사항이 높은 용 해도, 순도와 균질 단백질을 얻을 것입니다. 우리의 프로토콜에서 우리는 hexahistidine 태그와 MBP, 둘 다 더 높은 배 순도를 정화에 대 한 활용 될 수 포함 되어 애완 동물-28a-HMT 벡터를 사용 하기로 결정 했다. 또한,는 MBP 태그 에이즈 대상 단백질의 용 해도에. 우리는 매우 순수 하 고 결정 화를 위해 적당 한 단백질이 나왔고 5 연속 단계에 의해 단백질 정화. 결정 화 심사 자동된 액체 처리 시스템을 사용 하 여 수행 되었다. 수동 드롭 설정 하 여 전통적인 심사에 비해, 자동화 시스템 매우 작은 양의 샘플을 사용 하 여, 시간 및 에너지를 절약 한다. 그것은 또한 액체 처리의 정확도 때문에 재현성을 향상 시킵니다. 결정 했다 diffracted 자체 심사 및 데이터 수집에 대 한 싱크 로트 론에서 높은 강도 가진 x 선 및 더 적은 발산 제공 함으로써 고품질 데이터를 항복. 분자 교체 비슷한 구조 서식 파일 데이터베이스에서 사용할 수 있었던 우리의 첫 번째 선택 했다. 다른 방법은 실험 단계적, 매드, 슬픈, 미르, 을 포함 하 여 사용 하는

비대칭 단위 (ASU)는 대부분 콘텐츠 46% 용 매와 4 개의 단위체 포함 된 제안 해결 DBM RyR NTD, Xtriage30 에서 얻은 매튜 계수의 구조는 49%의 확률은. 그러나, 우리가 찾을 수 없습니다 4 분자와 적합 한 솔루션 애리조나 주립대에. 2, 3, 5, 6 분자에 대 한 보고 후속 실행은 또한 실패 했다. 결국 우리는 애리조나 주립대, 4% 확률 및 이상 86% 용 콘텐츠만이에서 하나의 분자와 적합 한 솔루션을 발견. 우리는 구조를 해결 하는 후 높은 함량 확인 됐다. 따라서, 극단적인 높은 용 콘텐츠는 단백질 팩에 내장 방식에 따라 존재지 않습니다.

X 선 결정학은 단백질 구조 결심에 골드 표준, 비록 큰 장애 또는 유연한 영역 단백질과 약한 선호도와 일부 큰 단백질 복합물 구체화 하 도전입니다. 루프-자르기를 포함 하 여 단백질 공학 방법 표면 엔트로피 감소 및 교차 연결, 더 나은 단백질 결정을 얻기의 기회를 향상 시킬 수 있습니다. 고해상도 단백질 구조의 공개 외 엑스레이 결정학 구조 기반 농약 디자인에 우리에 게 도움이 될 단백질 농약 상호 작용을 공부 하도 사용할 수 있습니다. 제나라 연구진이 발견 diamides의 다른 가족 종36에서 다르다 고유 사이트에 바인딩할 수 있습니다. 우리의 전략을 사용 하 여, 여러 종에서 RyR 구조를 결정 하 고 관찰 된 species-specificity에 대 한 책임 독특한 요소를 식별 수 있습니다 하나. 전반적으로,이 프로토콜 자체로 또는 작은 분자 약물과 복잡 한 단백질 또는 단백질 도메인의 식, 정화, 결정 화 및 구조 확인을 위해 적용할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 없다.

Acknowledgements

이 연구에 의해 제공 된에 대 한 자금: 국가 주요 연구 개발 프로그램의 (2017YFD0201400, 2017YFD0201403), 국립 자연 과학 재단의 중국 (31320103922, 31230061)와 중국의 프로젝트의 국가 기초 연구 (973) 프로그램 중국 (2015CB856500, 2015CB856504)입니다. 우리는 beamline BL17U1 상해 싱크 로트 론 방사선 시설 (SSRF)에서 직원에 게 감사입니다.

Materials

Name Company Catalog Number Comments
pET-28a-HMT vector This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain Novagen 69450-3CN
HisTrapHP column (5 mL) GE Healthcare 45-000-325
Amylose resin column New England Biolabs E8021S
Q Sepharose high-performance column  GE Healthcare 17-1154-01
Amicon concentrators (10 kDa MWCO) Millipore UFC901008
Superdex 200 26/600 gel-filtration column  GE Healthcare 28-9893-36
Automated liquid handling robotic system  Art Robbins Instruments Gryphon
96 Well CrystalQuick Greiner bio-one 82050-494
Uni-Puck Molecular Dimensions MD7-601
Mounted CryoLoop - 20 micron Hampton Research HR4-955
CryoWand Molecular Dimensions MD7-411
Puck dewar loading tool Molecular Dimensions MD7-607
Nano drop Thermo Scientific NanoDrop One
Crystal incubator Molecular Dimensions MD5-605
X-Ray diffractor Rigaku FRX
PCR machine Eppendorf Nexus GX2
Plasmid mini-prep kit Qiagen 27104
Gel extraction kit Qiagen 28704
SspI restriction endonuclease NEB R0132S
T4 DNA polymerase Novagen 2868713
Kanamycin Scientific Chemical 25389940
IPTG Genview 367931
HEPES Genview 7365459
β-mercaptoethanol Genview 60242
Centrifuge Thermo Scientific Sorvall LYNX 6000 
Sonnicator Scientz II-D
Protein purification system GE Healthcare Akta Pure
Light microscope Nikon SMZ745
IzIt crystal dye Hampton Research HR4-710
Electrophoresis unit Bio-Rad 1658005EDU
Shaker Incubator Zhicheng ZWYR-D2401
Index crystal screen Hampton Research HR2-144
Structure crystal screen Molecular Dimensions MD1-01
ProPlex crystal screen Molecular Dimensions MD1-38
PACT premier crystal screen Molecular Dimensions MD1-29
JCSG-plus crystal screen Molecular Dimensions MD1-37

DOWNLOAD MATERIALS LIST

References

  1. Giannini, G., Sorrentino, V. Molecular structure and tissue distribution of ryanodine receptors calcium channels. Medicinal Research Reviews. 15, (4), 313-323 (1995).
  2. Takeshima, H., et al. Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster. FEBS Letters. 337, (1), 81-87 (1994).
  3. Sattelle, D. B., Cordova, D., Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebrate Neuroscience. 8, (3), 107-119 (2008).
  4. Steinbach, D., et al. Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella. Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).
  5. Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China. Pest Management Science. 69, (5), 661-665 (2013).
  6. Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae). Journal of Economic Entomology. 108, (4), 1978-1985 (2015).
  7. Guo, L., et al. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Management Science. 70, (7), 1083-1089 (2014).
  8. Troczka, B., et al. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochemistry and Molecular Biology. 42, (11), 873-880 (2012).
  9. Roditakis, E., et al. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).
  10. Borko, L., et al. Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias. Acta Crystallographica Section D. 70, (Pt 11), 2897-2912 (2014).
  11. Sharma, P., et al. Structural determination of the phosphorylation domain of the ryanodine receptor. FEBS Journal. 279, (20), 3952-3964 (2012).
  12. Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface. Nature Communications. 4, 1506 (2013).
  13. Lau, K., Van Petegem, F. Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain. Nature Communications. 5, 5397 (2014).
  14. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  15. Lobo, P. A., Van Petegem, F. Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations. Structure. 17, (11), 1505-1514 (2009).
  16. des Georges, A., et al. Structural Basis for Gating and Activation of RyR1. Cell. 167, (1), 145-157 (2016).
  17. Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. Architecture and conformational switch mechanism of the ryanodine receptor. Nature. 517, (7532), 39-43 (2015).
  18. Peng, W., et al. Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2. Science. 354, (6310), (2016).
  19. Wei, R. S., et al. Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1. Cell Research. 26, (9), 977-994 (2016).
  20. Yan, Z., et al. Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution. Nature. 517, (7532), 50-55 (2015).
  21. Zalk, R., et al. Structure of a mammalian ryanodine receptor. Nature. 517, (7532), 44-49 (2015).
  22. Furlong, M. J., Wright, D. J., Dosdall, L. M. Diamondback moth ecology and management: problems, progress, and prospects. Annual Review of Entomology. 58, 517-541 (2013).
  23. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  24. Lobo, P. A., Van Petegem, F. Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations. Structure. 17, (11), 1505-1514 (2009).
  25. Aslanidis, C., de Jong, P. J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Research. 18, (20), 6069-6074 (1990).
  26. Stepanov, S., et al. JBluIce-EPICS control system for macromolecular crystallography. Acta Crystallographica Section D. 67, (3), 176-188 (2011).
  27. Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes. Acta Crystallographica Section D. 62, (Pt 8), 859-866 (2006).
  28. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40, (Pt 4), 658-674 (2007).
  29. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D. 66, (Pt 2), 213-221 (2010).
  30. Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation. CCP4 Newsletter. (43), 27-35 (2005).
  31. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 10, (6), 845-858 (2015).
  32. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D. 64, (Pt 1), 61-69 (2008).
  33. Emsley, P., Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallographica Section D. 60, 2126-2132 (2004).
  34. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallographica Section D. 68, (Pt 4), 352-367 (2012).
  35. Lin, L., et al. Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites. Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).
  36. Qi, S., Casida, J. E. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor. Pesticide Biochemistry and Physiology. 107, (3), 321-326 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics