Structure cristalline du domaine N-terminal du récepteur à la Ryanodine de Plutella xylostella

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dans cet article, nous décrivons les protocoles de détermination d’expression, purification, la cristallisation et la structure de la protéine du domaine N-terminal du récepteur à la ryanodine de teigne des crucifères (Plutella xylostella).

Cite this Article

Copy Citation | Download Citations

Nayak, B. C., Wang, J., Lin, L., He, W., You, M., Yuchi, Z. Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella. J. Vis. Exp. (141), e58568, doi:10.3791/58568 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Développement des insecticides puissants et efficaces ciblant les récepteurs de la ryanodine insectes (RyRs) a été d’un grand intérêt dans le domaine de la lutte contre les parasites agricoles. A ce jour, plusieurs diamide insecticides ciblant les ravageurs que ryrs ont été commercialisés, qui génèrent un revenu annuel de 2 milliards de dollars US. Mais la compréhension du mode d’action des insecticides RyR ciblage est limitée par le manque d’informations structurelles concernant les insectes RyR. Ceci limite à leur tour comprendre le développement de la résistance aux insecticides de ravageurs. La teigne des crucifères (DBM) est un ravageur dévastatrice, détruisant les crucifères cultivées dans le monde entier, qui a également été signalé à montrer aux diamide insecticides. Par conséquent, il est d’une grande importance pratique pour développer de nouveaux insecticides ciblant le RyR DBM, ciblant plus particulièrement une région différente de l’accepteur diamide traditionnels. Nous présentons ici un protocole afin de caractériser structurellement le domaine N-terminal de RyR de DBM. La structure cristalline a été résolue par le remplacement moléculaire à une résolution de 2,84 Å, qui montre un motif de bêta-trefoil pliable et une accompagnement hélice alpha. Ce protocole peut être adapté pour l’expression, de purification et de caractérisation structurale des autres domaines ou des protéines en général.

Introduction

Récepteurs de la ryanodine (RyRs) sont des canaux ioniques spécifiques qui négocient la pénétration des ions Ca2 + à travers les membranes du réticulum sarcoplasmique (RS) dans les cellules musculaires. Par conséquent, ils jouent un rôle important dans l’excitation contraction processus de couplage. Dans sa forme fonctionnelle, RyR assemble comme un homo-tétramère ayant une masse moléculaire de > 2 MDa, avec chaque sous-unité comportant des résidus d’acides aminés ~ 5000. Chez les mammifères, il existe trois isoformes : RyR1 - type de muscle squelettique, le muscle cardiaque type de RyR2 - et RyR3-ubiquitaire exprimés dans différents tissus1.

Chez les insectes, il y a qu’un seul type de RyR, qui s’exprime dans le tissu musculaire et nerveuse2. RyR insecte est plus proche de mammifères RyR2 avec une identité de séquence d’environ 47 %3. Diamide insecticides ciblant RyR de lépidoptères et coléoptères ont été développés et commercialisés par grandes entreprises telles que Bayer (flubendiamide), DuPont (chlorantraniliprole) et Syngenta (cyantraniliprole). Depuis sa création relativement récente, diamide insecticides sont devenus un de la classe plus forte croissance d’insecticides. Actuellement, les ventes de ces trois insecticides par an ont franchi les 2 milliards de dollars avec un taux de croissance de plus de 50 % depuis 2009 (Agranova).

Des études récentes ont signalé l’apparition d’une résistance chez les insectes après quelques générations d’utilisation de ces insecticides4,5,6,7,8. Les mutations de résistance dans le domaine transmembranaire de RyRs de la teigne des crucifères (DBM), Plutella xylostella (G4946E, I4790M) et aux emplacements correspondants à la mineuse de la tomate, Tuta absoluta (G4903E, I4746M) montrent que la région pourraient être impliqués dans la liaison de diamide insecticides comme cette région est connue pour être critique pour le processus de blocage du canal4,8,9. Malgré des recherches approfondies dans ce domaine, les mécanismes moléculaires exacts de diamide insecticides demeurent insaisissables. En outre, on ignore si les mutations de résistance influent sur les interactions avec les diamides directement ou de façon allostérique.

Des études antérieures ont révélé la structure de plusieurs domaines de RyR d’espèces de mammifères et la structure de RyR1 mammifères pleine longueur et RyR2 par cristallographie aux rayons x et microscopie de cryo-électronique, respectivement10,11, 12,13,14,15,16,17,18,19,20,21 . Mais jusqu’ici, aucune structure d’insecte RyR n’a été signalée, qui nous interdit de saisir la complexité moléculaire de la fonction des récepteurs ainsi que les mécanismes moléculaires d’action insecticide et le développement de la résistance aux insecticides.

Dans ce manuscrit, nous présentons un protocole généralisé pour la caractérisation du domaine β-trefoil N-terminale du récepteur à la ryanodine de la teigne des crucifères, un ravageur qui infectent les crucifères cultivées dans le monde entier22. La construction a été conçue selon le lapin publiées RyR1 NTD crystal structures23,24et la cryo-EM modèles structuraux16,17,18,19, 20 , 21. il s’agit de la première structure à haute résolution pour insecte RyR, qui révèle le mécanisme de blocage du canal et fournit un modèle important pour le développement des insecticides spécifiques à l’aide de conception de médicaments basée sur la structure. Pour l’élucidation de la structure, nous avons utilisé la cristallographie aux rayons x, qui est considérée comme le « gold standard » pour la détermination de structure de protéine à près de résolution atomique. Bien que le processus de cristallisation est imprévisible et demande beaucoup de travail, le présent protocole étape par étape aidera les chercheurs à exprimer, de purifier et de caractériser les autres domaines d’insecte RyR ou tout autres protéines en général.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. clonage de gènes, Expression de la protéine et de Purification

  1. PCR amplification ADN correspondant à la protéine d’intérêt (résidus 1-205 de DBM RyR, Genbank ACC. no. AFW97408) et le clone en pET-28 a-HMT vecteur de clonage de ligature indépendante (LIC)25. Ce vecteur contient une étiquette histidine, tag MBP et un site de clivage de protéase TEV à l’extrémité N-terminale15.
    1. Concevoir des amorces LIC pour l’amplification du gène cible avec extensions 5' LIC-compatibles :
      Notions fondamentales de la LIC vers l’avant :
      5' TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3'
      Notions fondamentales de la LIC inverse :
      5' TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3'
    2. Combiner les éléments de réaction (50 μL) : 1 μL de matrices d’ADN (100 ng/μL), 1 μL d’apprêt avant (10 μM), 1 μL d’apprêt inverse (10 μM), 0,5 μL de l’ADN polymérase (NEB), 5 μL de réaction 10 x buffer, 1 μL de dNTP (25 mM) , 40,5 μL de RNase libre ddH2O.
      1. Placer le mélange réactionnel dans une machine PCR et exécuter le programme suivant.
      2. Incuber à 95 ° C pendant 3 min, et puis exécutez 30 cycles de (95 ° C pendant 30 s, 58 ° C pendant 15 s, 72 ° C pendant 1 min). Incuber à 72 ° C pendant 5 min et puis maintenez à 4 ° C.
      3. Exécuter le mélange toute réaction (50 μL) sur un gel d’agarose à 2 % et extraire avec un Kit d’Extraction de Gel. Suivre le protocole du fabricant.
    3. Clonage de ligature indépendante (LIC)
      1. Effectuer la digestion SspI (60 μL) : 20 μL de vecteur ADN (50 ng/μl), 6 μL de 10 x tampon de réaction, 4 μL de SspI et 30 μL de ddH2O. Incuber à 37 ° C pendant 3 h exécuter la réaction toute mélanger sur gel d’agarose à 1 % et extraire avec un Kit d’Extraction de Gel. Suivre le protocole du fabricant.
      2. Effectuer un traitement T4 ADN polymérase du vecteur et insérer l’ADN. Combinez ce qui suit : 5 μL d’ADN vecteur ou insert (50 ng/μl), 2 μL de tampon de l’ADN polymérase 10 x T4, 1 μL de dGTP (25 mM) pour les vecteurs ou/et 1 μL de dCTP (25 mM) pour l’insert d’ADN, 1 μL de TNT (100 mM), 0,4 μL de T4 ADN polymérase (LIC-qualifié) et 9,6 μL de ddH2O. Incuber réactions à température ambiante pendant 40 min. chaleur-inactiver les enzymes à 75 ° C pendant 20 min.
        Remarque : Le vecteur LIC et insérer l’ADN doivent être traités dans les réactions distinctes.
      3. Effectuer la LIC recuit de réaction. Combinez ce qui suit : 2 μL d’ADN insert imprégnées de T4, 2 μL de LIC traités T4 vecteur ADN. Incubez la réaction à température ambiante pendant 10 min.
  2. Transformer BL21 (DE3) e. coli cellules avec ce plasmide recombinant.
    1. Décongelez les cellules compétentes (50 μL en micro-centrifuge tube) sur la glace.
    2. Ajouter environ 1 μL (50 ng) du plasmide dans le tube. Mélanger les cellules et l’ADN de chiquenaude doucement le tube de 2 à 3 fois. Placer le tube sur la glace pendant 20 min.
    3. Chauffer choc à 42 ° C pendant 40 s. Place le tube sur la glace à nouveau pendant 2 min. Ajouter 1 mL de température ambiante LB médias au tube.
    4. Placer le mélange dans le shaker 250 tr/min à 37 ° C pendant 45 min. diffuser 150 – 200 µL du mélange sur les plaques de sélection. Retournez la plaque et incuber une nuit à 37 ° C.
  3. Choisir une seule colonie et la culture des cellules dans un milieu de 2YT de 100 mL contenant 50 kanamycine µg/mL à 37 ° C pendant la nuit. Le lendemain matin, inoculer 1 L 2YT milieu contenant 50 kanamycine µg/mL avec 10 mL d’une culture et incuber à 37 ° C un incubateur shaker à 250 tr/min, jusqu'à ce que l' OD600 atteint 0,6 ~. Par la suite induire la culture avec l’IPTG à une concentration finale de 0,4 mM et se développer pendant un autre 5 h à 30 ° C.
  4. Récolter les cellules par centrifugation à 8 000 x g pendant 10 min à 4 ° C, de recueillir les cellules et de resuspendre chaque cellules de 10 g dans 40 mL de tampon de lyse (10 mM HEPES pH 7,4, KCl 250 mM, 10 mM β-mercaptoéthanol, lysozyme du 25 μg/mL, 25 μg/mL DNase PMSF 1 mM).
    1. Il perturber par sonication à 65 % amplitude pendant 8 min avec 1 s s 1 sur off. Enlever les débris de cellules par centrifugation à 40 000 x g pendant 30 min à 4 ° C. Filtrer le liquide surnageant en passant par 0,22 μm filtre et chargez-le dans la boucle d’échantillonnage.
  5. Purifier la protéine de fusion, Cliver la balise et re-purifier la protéine cible.
    1. Purifier la protéine de fusion à l’aide de colonne Ni-NTA (tampon de liaison : 10 mM HEPES pH 7,4, 250 mM KCl ; tampon d’élution : 10 millimètres HEPES pH 7,4, KCl, imidazole de 500 mM à 250 mM) et purifier par un système de purification, avec un dégradé linéaire de l’imidazole de 20 à 250 mM.
    2. Fendre la protéine éluée cible avec la protéase TEV (01:50 ratio) durant la nuit à 4 ° C.
    3. Purifier le mélange réactionnel de clivage à l’aide de la colonne de résine d’amylose (tampon de liaison : 10 mM HEPES pH 7,4, 250 mM KCl ; tampon d’élution : 10 millimètres HEPES pH 7,4, KCl, maltose de 10 mM à 250 mM) et Ni-NTA colonne pour supprimer la balise et la protéase TEV. La protéine cible sera la fraction intermédiaire de ces deux colonnes.
    4. Dialyser l’échantillon contre tampon de dialyse (10 mM Tris-HCl pH 8,8, 50 mM KCl, 10 mM β-mercaptoéthanol pour réduire la concentration de sel. Purifier l’échantillon sur une colonne échangeuse d’anion (tampon de liaison : 10 mM Tris-HCl pH 8,8, 10 mM β-mercaptoéthanol ; tampon d’élution : pH 10 mM Tris-HCl 8.8, KCl, 10 mM β-mercaptoéthanol 1 M) par un dégradé linéaire de 20 à 500 mM KCl dans le tampon d’élution.
    5. Comme dernière étape dans le processus de purification, concentrer la protéine à l’aide de concentrateur centrifuge (10 kDa MWCO) et injecter dans une colonne de gel filtration Superdex 200 26/600 pour vérifier l’homogénéité.
  6. Examiner la pureté de la protéine en l’exécutant sur une PAGE de la SDD 15 %.
    Remarque : Toutes les colonnes sont en cours d’exécution sur un système de purification de protéine avec un débit de liaison de 2 mL/min et une vitesse d’écoulement d’élution de 4 mL/min, à l’exception de la gel-filtration à 1 mL/min.

2. cristallisation et préparation de protéines

  1. Concentrer l’échantillon protéique purifié à 10 mg/mL à l’aide de concentrateur centrifuge (10 kDa MWCO) et l’échange tampon tampon de cristallisation avant de le stocker à-80 ° C.
  2. Effectuer le dépistage de la cristallisation (ratio 1:1, 200 nL de protéine et 200 nL de tampon de réservoir) par la séance abandonner la méthode de diffusion de vapeur à 295 K avec plusieurs kits de cristallisation à l’aide d’un liquide automatisé système robotisé dans un format 96 puits de manutention.
    Remarque : Nous avons utilisé des kits de recherche Dimensions moléculaires et Hampton et le Gryphon automatisé système de manipulation de liquides.
  3. Sceller la plaque 96 puits cristallisation pour éviter l’évaporation et de permettre à l’équilibration de la baisse de la protéine avec le tampon de réservoir. Alors gardez les plaques dans l’incubateur de cristal à 18 ° C.
  4. Vérifier les plaques de 96 puits périodiquement à l’aide d’un microscope optique pour surveiller la croissance et la formation de cristaux.
  5. Pour différencier les cristaux protéiques de cristaux de sel, utiliser un colorant de la protéine. Ajouter 1 µL de colorant à la chute de la cible. Attendre environ 1 h et observer au microscope. Les cristaux de protéines seront allume en bleus.
  6. Utiliser les conditions de cristallisation positive (sulfate d’ammonium 1,5 M, 0,1 M Tris pH 8,0) pour optimiser les cristaux à l’aide de pendaison abandonner la méthode de diffusion de la vapeur en plaques 24 puits.
    1. Optimiser le pH de 7.0 à 8.5 avec intervalle d’unité pH 0,5 chaque étape. Optimiser la concentration de sulfate d’ammonium de 1,2 M à 1,7 M avec intervalle 0,1 M chaque étape. (Dans notre cas, le meilleur état produisant de gros cristaux en forme de plaque était de 0,1 M HEPES pH 7.0 et 1,6 M sulfate d’ammonium)

3. cristal montage, collecte de données de rayons x et la détermination de la Structure

  1. Monter les cristaux dans un cryoloop et flash-cool dans l’azote liquide avec réservoir solution contenant 20 % de glycérol comme cryo-protecteur. Placer les cristaux dans unipuck pour rangement et transport.
  2. Présélection des cristaux de protéine à l’aide d’un diffractor de rayons x interne Rigaku. Choisir les meilleurs des résolutions plus élevées pour la collecte de données dans les installations de rayonnement synchrotron (notre dataset a prélevé la BL17U1 à Shanghai Synchrotron Radiation Facility).
    1. Utilisez le logiciel de contrôle de source de rayonnement BluIce26 pour monter et centrer les cristaux en fonction de centrage automatique ou manuelle. Effectuer le test expositions afin de déterminer la stratégie de collecte de données, y compris départ angle, durée d’exposition, distance détecteur, largeur du cadre et numéros.
    2. Collecter des données en conséquence (nous avons recueilli 180 cadres avec 1 s de temps de l’exposition, largeur du cadre 1° et la distance détecteur de 350 mm).
  3. Index, intégrer et mettre à l’échelle le dataset à l’aide de HKL2000 suite27. Tout d’abord effectuer la fonction de recherche de pointe pour trouver les taches de diffraction et l’index puis les taches et sélectionnez le groupe de droite espace. Après intégration de pointe, à l’échelle du dataset avec le modèle d’erreur approprié et enregistrez le fichier .sca de sortie.
  4. Résoudre le problème de la phase de remplacement moléculaire à l’aide de Phaser28 PHENIX29.
    1. Calculer le nombre de copies possibles des molécules de protéine dans l’unité asymétrique par Xtriage,30.
    2. Recherchez les modèles de structure adéquate avec la similarité des séquences haute identité et structurels comme la protéine cible à l’aide de structures connues de la littérature ou les modèles générés par serveur de prédiction de structure tels que Phyre231 (lapin RyR1 NTD, nous avons utilisé comme un modèle de recherche, PDB ID 2XOA).
    3. Exécutez le Phaser en utilisant le fichier de données de diffraction, le fichier de structure du modèle et le fichier de séquence protéique pour trouver la solution.
  5. Effectuer AutoBuild32 PHENIX29 pour générer le modèle initial en utilisant le fichier de sortie du Phaser et le fichier de la séquence de la protéine cible.
  6. Intégrer la structure de la densité d’électrons expérimental mis à jour le moyen de Foulque33 et affiner à l’aide de phenix.refine34 cycles itératifs manuellement.
  7. Valider le modèle final en utilisant les outils de validation en PHENIX18.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Purification

Le domaine N-terminal de DBM RyR a été exprimé d’une protéine de fusion avec une balise de protéine, une balise MBP et un site de clivage de protéase TEV. Nous avons suivi une stratégie en cinq étapes de purification pour obtenir une protéine très pure, appropriée pour usage de cristallisation. Dans un premier temps, la protéine de fusion a été purifiée de la fraction soluble du lysat cellulaire par colonne Ni-NTA (HP HisTrap). Ensuite, la protéine de fusion a été soumise à un clivage protéase TEV et la portion de protéine-MBP a été supprimée par colonne de résine d’amylose suivie de colonne Ni-NTA. De plus, la protéine a été purifiée par colonne échangeuse d’anion (Q Sépharose HP) et enfin par une colonne de gel filtration (Superdex 200 26/600). Le rendement final de protéine purifiée de culture bactérienne 1 L en utilisant les médias 2YT a ~ 4 mg. La protéine purifiée a montré une seule bande sur SDS-PAGE à ~ 21 kDa (Figure 1). Le volume d’élution de la colonne de filtration sur gel confirmé le NTD RyR purifiée pour être un monomère (Figure 1).

Cristallisation

Cristallisation première projection en plaques 96 puits a produit cristaux dans plusieurs conditions. Ces conditions ont été sélectionnées pour l’optimisation de cristal dans 24 plaques bien. La condition optimale où se forment des cristaux de haute qualité plaque-forme a 0,1 M HEPES pH 7.0 et 1,6 M sulfate d’ammonium (Figure 2).

Détermination de la structure

Cristaux obtenus est diffractée à 2,84 Å sur beamline BL17U1 à Shanghai Synchrotron Radiation Facility. Le cristal a été indexé dans le groupe d’espace P61 avec les paramètres de la maille unitaire a = 170.13, b = 170.13, c = 51.763 Å, α = β = 90,00 ° et γ = 120 °. Pour la détermination de la structure, remplacement moléculaire travaillait à l’aide de lapin RyR1 NTD comme un modèle de recherche en PHENIX. Affinement de la structure a été fait en PHENIX à une finale Rtravailler et Rlibre 21.63 et 24,52 %, respectivement. Les statistiques de collection et le raffinement de données sont répertoriées dans le tableau 1. La structure résolue de DBM RyR NTD couvrant les résidus 1-205 (PDB ID 5Y9V) est illustrée à la Figure 3.

Figure 1
Figure 1 : chromatogramme de filtration SDS-PAGE et gel représentant purification de DBM RyR NTD35. SDS PAGE (15 %) dans l’encart montre purifiée DBM RyR NTD comme une bande unique après que les cinq étape stratégie de purification. La voie de gauche montre le marqueur protéique standard (PM). Le chromatogramme de filtration gel obtenu à l’aide d’une colonne de Superdex 200 26/600 montre le pic d’élution à 240 mL, ce qui correspond à la forme monomère de la protéine. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2. Cristallisation de DBM RyR NTD35Cristaux de DBM RyR NTD produites par la méthode de diffusion de la vapeur comme on le voit sous un microscope optique. La condition de cristallisation est 0,1 M HEPES pH 7.0 et 1,6 M sulfate d’ammonium. Echelle = 200 µm. s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Structure de DBM RyR NTD (PDB ID 5Y9V)35Résolu la structure de la protéine illustrée de deux points de vue. Éléments de structure secondaire sont étiquetés. Brins β apparaissent en violet. Hélices α et une hélice de10 3 sont indiquées en bleu. Boucles apparaissent en blanc. NT et Ct représentent le N-terminal et C-terminale de la protéine, respectivement. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Tableau 1 : données statistiques de collection et de raffinement pour le DBM RyR NTD cristal35. S’il vous plaît cliquez ici pour télécharger ce tableau.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Dans cet article, nous décrivons la procédure pour l’inoculation express, purifier, cristalliser et déterminer la structure de DBM RyR NTD. De cristallisation, une condition essentielle est d’obtenir des protéines avec l’homogénéité, la pureté et la solubilité élevée. Dans notre protocole, nous avons choisi d’utiliser TEP-28 a-HMT vecteur car il contient une protéine balise et la balise MBP, qui pourraient être utilisés pour la purification obtenir une pureté supérieure de pli. En outre, le MBP tag sida dans la solubilité de la protéine cible. Nous avons purifié la protéine par cinq étapes consécutives qui a produit la protéine qui était très pur et adapté pour la cristallisation. Dépistage de la cristallisation a effectué un liquide automatique, système de manutention. Par rapport au dépistage traditionnel par réglage manuel baisse, système automatisé utilise de très petits volumes d’échantillon, permet d’économiser temps et énergie. Il améliore également la reproductibilité en raison de la précision de la manipulation de liquides. Cristaux est diffractés interne au dépistage et au synchrotron de collecte de données car il fournit aux rayons x avec une intensité plus élevée et moins divergence, réduisant ainsi à des données de haute qualité. Remplacement moléculaire a été notre premier choix comme modèles structurels semblables n’étaient disponibles dans la base de données. L’autre façon est d’utiliser progressif expérimental, y compris les MAD, SAD, MIR, etc.

Alors que la résolution de la structure de DBM RyR NTD, les coefficients de Matthews obtenus de Xtriage30 a suggéré que l’unité asymétrique (ASU) contenait probablement quatre monomères avec 46 % de teneur en solvant, qui a une probabilité de 49 %. Cependant, nous n’avons trouvé la bonne solution avec quatre molécules dans ASU. Les exécutions suivantes de chercher deux, trois, cinq, six molécules ont aussi échoué. Finalement nous avons trouvé la bonne solution avec seulement une molécule ASU, qui n’a que 4 % de probabilité et plus 86 % teneur en solvant. La forte teneur en eau a été confirmée après que nous avons résolu la structure. Ainsi, la forte teneur en solvant extrême existe selon la manière intrinsèque dans les packs de protéine.

Bien que la diffractométrie de rayons x est un étalon-or dans la détermination de structure de protéine, protéines avec grand désordre ou régions flexibles et certains complexes de grosse protéine avec une faible affinité sont difficiles à se cristalliser. Méthodes ingénieries des protéines, y compris boucle-troncature, surface entropie réduction et réticulation, pourrait améliorer les chances d’obtenir des cristaux de protéines mieux. Sans compter que la révélation des structures protéiques de haute résolution, diffraction des rayons x permet également d’étudier les interactions de protéine-pesticides, qui nous aiderait sur conception basée sur la structure des pesticides. Qi et coll. ont trouvé que les différentes familles de diamides pourraient se lient aux sites distincts qui sont différentes à travers des espèces36. À l’aide de notre stratégie, on peut déterminer les structures de RyR de multiples espèces et identifier les éléments uniques responsables de la spécificité observée. Dans l’ensemble, ce protocole peut être adapté pour détermination expression, purification, la cristallisation et la structure des protéines ou de domaines protéiques par eux-mêmes ou en complexe avec des médicaments à petites molécules.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgements

Le financement de cette recherche a été fournie par : National Key Research et Development Programme of China (2017YFD0201400, 2017YFD0201403), Nature Science Fondation nationale de Chine (31320103922, 31230061) et projet de recherche fondamentale National (973) programme de Chine (2015CB856500, 2015CB856504). Nous sommes reconnaissants envers le personnel sur la ligne de faisceau BL17U1 à Shanghai Synchrotron Radiation Facility (SSRF).

Materials

Name Company Catalog Number Comments
pET-28a-HMT vector This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain Novagen 69450-3CN
HisTrapHP column (5 mL) GE Healthcare 45-000-325
Amylose resin column New England Biolabs E8021S
Q Sepharose high-performance column  GE Healthcare 17-1154-01
Amicon concentrators (10 kDa MWCO) Millipore UFC901008
Superdex 200 26/600 gel-filtration column  GE Healthcare 28-9893-36
Automated liquid handling robotic system  Art Robbins Instruments Gryphon
96 Well CrystalQuick Greiner bio-one 82050-494
Uni-Puck Molecular Dimensions MD7-601
Mounted CryoLoop - 20 micron Hampton Research HR4-955
CryoWand Molecular Dimensions MD7-411
Puck dewar loading tool Molecular Dimensions MD7-607
Nano drop Thermo Scientific NanoDrop One
Crystal incubator Molecular Dimensions MD5-605
X-Ray diffractor Rigaku FRX
PCR machine Eppendorf Nexus GX2
Plasmid mini-prep kit Qiagen 27104
Gel extraction kit Qiagen 28704
SspI restriction endonuclease NEB R0132S
T4 DNA polymerase Novagen 2868713
Kanamycin Scientific Chemical 25389940
IPTG Genview 367931
HEPES Genview 7365459
β-mercaptoethanol Genview 60242
Centrifuge Thermo Scientific Sorvall LYNX 6000 
Sonnicator Scientz II-D
Protein purification system GE Healthcare Akta Pure
Light microscope Nikon SMZ745
IzIt crystal dye Hampton Research HR4-710
Electrophoresis unit Bio-Rad 1658005EDU
Shaker Incubator Zhicheng ZWYR-D2401
Index crystal screen Hampton Research HR2-144
Structure crystal screen Molecular Dimensions MD1-01
ProPlex crystal screen Molecular Dimensions MD1-38
PACT premier crystal screen Molecular Dimensions MD1-29
JCSG-plus crystal screen Molecular Dimensions MD1-37

DOWNLOAD MATERIALS LIST

References

  1. Giannini, G., Sorrentino, V. Molecular structure and tissue distribution of ryanodine receptors calcium channels. Medicinal Research Reviews. 15, (4), 313-323 (1995).
  2. Takeshima, H., et al. Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster. FEBS Letters. 337, (1), 81-87 (1994).
  3. Sattelle, D. B., Cordova, D., Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebrate Neuroscience. 8, (3), 107-119 (2008).
  4. Steinbach, D., et al. Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella. Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).
  5. Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China. Pest Management Science. 69, (5), 661-665 (2013).
  6. Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae). Journal of Economic Entomology. 108, (4), 1978-1985 (2015).
  7. Guo, L., et al. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Management Science. 70, (7), 1083-1089 (2014).
  8. Troczka, B., et al. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochemistry and Molecular Biology. 42, (11), 873-880 (2012).
  9. Roditakis, E., et al. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).
  10. Borko, L., et al. Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias. Acta Crystallographica Section D. 70, (Pt 11), 2897-2912 (2014).
  11. Sharma, P., et al. Structural determination of the phosphorylation domain of the ryanodine receptor. FEBS Journal. 279, (20), 3952-3964 (2012).
  12. Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface. Nature Communications. 4, 1506 (2013).
  13. Lau, K., Van Petegem, F. Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain. Nature Communications. 5, 5397 (2014).
  14. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  15. Lobo, P. A., Van Petegem, F. Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations. Structure. 17, (11), 1505-1514 (2009).
  16. des Georges, A., et al. Structural Basis for Gating and Activation of RyR1. Cell. 167, (1), 145-157 (2016).
  17. Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. Architecture and conformational switch mechanism of the ryanodine receptor. Nature. 517, (7532), 39-43 (2015).
  18. Peng, W., et al. Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2. Science. 354, (6310), (2016).
  19. Wei, R. S., et al. Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1. Cell Research. 26, (9), 977-994 (2016).
  20. Yan, Z., et al. Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution. Nature. 517, (7532), 50-55 (2015).
  21. Zalk, R., et al. Structure of a mammalian ryanodine receptor. Nature. 517, (7532), 44-49 (2015).
  22. Furlong, M. J., Wright, D. J., Dosdall, L. M. Diamondback moth ecology and management: problems, progress, and prospects. Annual Review of Entomology. 58, 517-541 (2013).
  23. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  24. Lobo, P. A., Van Petegem, F. Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations. Structure. 17, (11), 1505-1514 (2009).
  25. Aslanidis, C., de Jong, P. J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Research. 18, (20), 6069-6074 (1990).
  26. Stepanov, S., et al. JBluIce-EPICS control system for macromolecular crystallography. Acta Crystallographica Section D. 67, (3), 176-188 (2011).
  27. Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes. Acta Crystallographica Section D. 62, (Pt 8), 859-866 (2006).
  28. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40, (Pt 4), 658-674 (2007).
  29. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D. 66, (Pt 2), 213-221 (2010).
  30. Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation. CCP4 Newsletter. (43), 27-35 (2005).
  31. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 10, (6), 845-858 (2015).
  32. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D. 64, (Pt 1), 61-69 (2008).
  33. Emsley, P., Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallographica Section D. 60, 2126-2132 (2004).
  34. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallographica Section D. 68, (Pt 4), 352-367 (2012).
  35. Lin, L., et al. Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites. Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).
  36. Qi, S., Casida, J. E. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor. Pesticide Biochemistry and Physiology. 107, (3), 321-326 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics