Enkelt celle mikro-aspiration som en alternativ strategi for fluorescens-aktiverede celle sortering for Giant virus blanding adskillelse

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her beskriver vi en enkelt celle mikro-aspiration metode til adskillelse af inficerede amoebae. For at adskille virale subpopulationer i Vermamoeba vermiformis inficeret af Faustovira og ukendte gigantiske vira, vi udviklede protokollen nedenfor og viste sin evne til at adskille to lav-overflod roman Giant vira.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Sahmi-Bounsiar, D., Boratto, P. V., Oliveira, G. P., Bou Khalil, J. Y., La Scola, B., Andreani, J. Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation. J. Vis. Exp. (152), e60148, doi:10.3791/60148 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Under amøbe-samkulturprocessen kan mere end én virus isoleres i en enkelt brønd. Vi har tidligere løst dette problem ved slutpunkts fortynding og/eller fluorescens aktiveret celle sortering (FACS) anvendt på den virale population. Men, når virus i blandingen har lignende morfologiske egenskaber og en af de vira multiplicerer langsomt, tilstedeværelsen af to vira opdages på stadiet af genom samling og vira kan ikke adskilles for yderligere karakterisering. For at løse dette problem, vi udviklet en enkelt celle mikro-aspiration procedure, der giver mulighed for adskillelse og kloning af meget lignende vira. I det nuværende arbejde præsenterer vi, hvordan denne alternative strategi tillod os at adskille de små virale subpopulationer af Clandestinovirus ST1 og Usurpativirus LCD7, gigantiske vira, der vokser langsomt og ikke fører til amoebal lysis i forhold til den lytiske og hurtigtvoksende Faustovirus. Renheds kontrol blev vurderet ved specifik genforstærkning, og der blev fremstillet vira til yderligere karakterisering.

Introduction

Nukleocytoplasmic store DNA-vira (ncldv) er yderst forskelligartede, defineret af fire familier, der inficerer eukaryoter1. De første beskrevne vira med genomer over 300 KBP var Phydcodnaviridae, herunder paramecium Bursaria chlorella virus 1 PBCV12. Isolationen og den første beskrivelse af Mimivirus, viste, at størrelsen af vira fordoblet i forhold til både størrelsen af partiklen (450 nm) og længden af genomet (1,2 MB)3. Siden da, mange gigantiske vira er blevet beskrevet, normalt isoleret ved hjælp af en amøbe Co-kultur procedure. Flere gigantiske vira med forskellige morfologier og genetisk indhold kan isoleres fra Acanthamoeba Sp. celler, herunder Marseillevira, Pandoraviruser, Pithovira, Mollivirus, Cedratvira, Pacmanvirus, tupanvirus, og for nylig Medusavirus4,5,6,7,8,9,10,11,12, 13,14,15,16,17. Parallelt hermed tillod isoleringen af vermamoeba vermiformen isolation og beskrivelse af de gigantiske vira faustovirus, kaumoebavirus og orpheovirus18,19,20. Andre gigantiske vira blev isoleret med deres vært protists, såsom cafeteria roenbergensis21, aureococcus anophagefferens22, chrysochromulina ericina23, og Bodo saltans 24. Alle disse isoleringer var resultatet af et stigende antal hold, der arbejder på isolation, og indførelsen af strategi opdateringer med høj dataoverførselshastighed25,26,27,28, såsom forbedring af co-kultur systemet med anvendelse af strømnings cytometri.

I 2016 brugte vi en strategi, der knytter Co-Culture og flow flowcytometri til at isolere gigantiske vira27. Denne strategi blev udviklet for at øge antallet af prøver inokuleret, at sprede protister anvendes som celle understøtninger, og til hurtigt at detektere lysis af celle støtte. Systemet blev opdateret ved at tilføje et supplerende trin for at undgå foreløbig molekylær biologi identifikation og hurtig påvisning af en ukendt viral population som i tilfælde af Pacmanvirus29. Koblings flow cytometri til celle sortering tilladt til adskillelse af en blanding af Mimivirus og Cedratvirus A1130. Men vi stødte senere på begrænsningerne ved adskillelse og påvisning af disse virale delpopulationer ved flow cytometri. Efter sekvensering, da vi samlet genomer af Faustovirus ST125 og FAUSTOVIRUS LCD7 (ikke offentliggjorte data), vi overraskende fundet i hver forsamling to supplerende genomer af to nye vira ikke er identificeret i offentlige genomdata baser. Imidlertid viste hverken strømnings cytometri eller transmissions elektronisk mikroskopi (TEM), at amoebaerne var inficeret med to forskellige vira, Clandestinovirus ST1 og Usurpativirus LCD7. Vi designede specifikke PCR-systemer til at forstærke Faustovirus, Usurpativirus og Clandestinovirus markører baseret på deres genomer; vores formål var at have PCR-baserede systemer, der muliggør verifikation af renheden af de vira, der adskilles. Men, end-punkt fortynding og flow cytometri undladt at adskille dem. Isolationen af denne enkelt virale befolkning var vanskelig, fordi hverken morfologien eller replikerende elementer af Clandestinovirus og Usurpativirus populationer er blevet karakteriseret. Vi opdagede kun én viral population ved flow cytometri på grund af overlapning af de to populationer (testet efter den effektive adskillelse). Vi forsøgte at adskille dem ved hjælp af en enkelt partikel sortering på 96-brønd plader, men vi observerer ikke nogen cytopatiske effekter, og vi opdagede hverken Clandestinovirus eller Usurpativirus ved PCR amplifikation. Endelig var det kun kombinationen af slutpunkt fortynding efterfulgt af enkelt amøbe mikro-aspiration, der gjorde det muligt adskillelse af disse to low-overflod Giant vira fra faustovira. Denne metode til adskillelse er genstand for denne artikel.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. amøbe kultur

  1. Brug Vermamoeba vermiformis (stamme CDC19) som en celle støtte.
  2. Der tilsættes 30 ml protease-peptone-gærekstrakt-glukose medium (PYG) (tabel 1) og 3 ml af amobers i en koncentration på 1 x 106 celler/ml i en 75 cm2 -celle dyrknings kolbe.
  3. Vedligehold kulturen ved 28 °C.
  4. Efter 48 h, kvantificere amobers ved hjælp af tælle slides.
  5. For at skylle, høst cellerne i en koncentration på 1 x 106 celler/ml og pellet amobers ved centrifugering ved 720 x g i 10 min. Fjern supernatanten og Genoptag pellet i det passende volumen af sult mediet for at opnå 1 x 106 celler/ml (tabel 1).

2. formering af bestanden virus i Amoebae

Bemærk: Før fortynding er det vigtigt at kulturen bestanden prøve for at opnå nok frisk kultur, derefter gå videre til filtrering.

  1. Brug 1 x 106 amøbe kultur i sult medium.
  2. Inokulere blandingen af vira udstedt fra stamopløsningen (Faustovirus/Usurpativirus LCD7 eller Faustovirus/Clandestinovirus ST1) efter Co-kultur processen på celle støtte ved en mangfoldighed af infektion (MOI) af 0,01.
    Bemærk: Den MOI er vigtigt at reducere den overflod af den store virale befolkning og antallet af inficerede celler.
  3. Inkubér ved 30 °C, indtil cytopatisk effekt (CPE) induceres, såsom amoebal afrunding eller lysis, ca. 10 til 14 timer efter infektion.
  4. Saml mediet og filtratet gennem et 5 μm filter for at fjerne cellulær snavs.

3. fortynding af slutpunkt

  1. Udfør en seriel fortynding (10-1 til 10-11) af den virale prøve i sulte mediet (tabel 1).
  2. 2 mL 1 x 106 vermamoeba vermiformis i hver Petri skål med 100 μl af blandingen inoculum.
  3. Petri skålene placeres i en forseglbar plastikpose ved 30 °C.
  4. Begynd at observere Petri skåle med inverteret Optisk mikroskopi ved 6 h post infektion og tjek celle morfologi hver 4 til 8 h.
  5. Ved udseendet af den cytopatiske effekt karakteriseret ved afrunding celler, begynde den enkelt celle mikro-aspiration proces.

4. enkelt celle mikro-aspiration

  1. Forbered værten.
    Bemærk:
    denne forberedelse er lavet til frigivelse af inficerede enkeltceller til en frisk celle støtte.
    1. Amobers behandles i kulturen med en antimikrobiel agens, der indeholder 10 μg/ml vancomycin, 10 μg/ml imipenem, 20 μg/ml ciprofloxacin, 20 μg/ml doxycyclin og 20 μg/ml voriconazol. Denne blanding bruges til at undgå bakteriel og svampe forurening.
      Bemærk: Proceduren finder sted på en bænk uden for den mikrobiologiske sikkerheds Station. Tilsæt 2 ml amobers koncentreret ved 1 x 106 celler/ml hver i 15 Petri skåle. Ved amøbe tilslutning inkubatér kulturen ved 30 °C i 30 minutter.
  2. Vælg den Petri skål, der anvendes til mikro-aspiration fra grænse fortynding efterfølgende kriterier: 1) fravær af synlig kontaminering med svampe-og bakterie midler, 2) tegn på cytopatisk virkning af amobers på grund af vira, og 3) prelysis og afrundings fase af amobers (for at undgå aspiration af virale partikler).
  3. Indstil en arbejdsstation med følgende materialer (Se figur 1a, B):
    Micromanipulator, som tillader mikrokapillær positionering;
    Manuel kontrol tryk anordning, der anvendes til at aspirere og frigive cellerne i mikrokapillær;
    Inverteret mikroskop;
    Plug and Play motormoduler;
    Kamera
    Computer modul til at visualisere manipulation og tage billeder.
  4. Vælg et mikrokapillær (Se figur 1C).
    Bemærk: Størrelsen af cellerne, deformation og vedhæftning af deres membraner til overfladerne, og den cellulære motilitet kan påvirke den glatte fremskridt af mikro-aspiration. Mikrokapillær diameter kan præcist vælges og tilpasses til specifikke celletyper afhængigt af deres størrelse og metoder til aspiration. En mikrokapillar på 20 μm indvendig diameter blev anvendt til at aspirere en afrunding amøbe (diameter ~ 10 μm). Dette giver mulighed for vedligeholdelse af en intern position og en nem frigivelse af cellen.
  5. Monter systemet.
    1. Fastgør betjeningsvinklen på gribe systemet på Det motoriserede modul ved 45 °.
    2. Udfør en dobbelt installation, først på gribe systemet og derefter på mikrokapillær.
    3. Fokuser på cellerne efter at have kørt et par dråber olie gennem mikrokapillær.
      Bemærk: Den mineralske olie med biologisk kompatibilitet leveres af enheden.
    4. Komplet montering efter producentens anbefalinger.
  6. Klon celler (Se figur 2A, B).
    Bemærk:
    denne fremgangsmåde svarer til den, der er beskrevet af Fröhlich og König31.
    1. Petri skålen, der indeholder 2 ml inficeret amobers, placeres under mikroskopet.
    2. Fokuser først på cellerne, og derefter på mikrokapillær nedsænket i kulturen.
    3. Vælg en afrundet enkelt celle og bringe mikrokapillær tættere på micromanipulator.
    4. Udøve blødt aspiration med manuel tryk kontrol på cellen, tager det inde i mikrokapillær. Fjern den enkelte celle fra den første prøve og slip den i den cellulære støtte, og Inkuber den derefter ved 30 °C.
    5. Udfør daglige observationer med et inverteret optisk mikroskop for at observere cellernes udseende og for at overvåge fremkomsten af den cytopatiske effekt.

5. PCR-screening

Bemærk: Efter trin 4 er en systematisk screening af PCR afgørende for at bekræfte adskillelsen. I både Usurpativirus/Faustovirus og Clandestinovirus/Faustovirus blev designet og anvendelsen af de specifikke primer-og sonde systemer udført ved hjælp af primer-BLAST online32 (tabel 2).

  1. Udtrække DNA fra en del af de positive kultur prøver (dvs. hvor en cytopatisk effekt observeres) ved hjælp af et automatiseret ekstraktions system i henhold til fabrikantens protokol.
  2. Brug passende konstrueret primere.
    Bemærk: Her har vi designet primere til at forstærke kerne gener kommenteret som RpB2 (faustovirus), LCD7 Major kapsid protein (usurpatvirus) og mindre kapsid protein (clandestinovirus)
  3. Udfør standard PCR ved hjælp af en termo cycler.
    1. Udfør 20 μL PCR-reaktioner med 50 μM af hver primer (tabel 2), 1X Master Mix og RNase frit vand.
    2. Aktiver Taq-DNA-Polymerase i 5 min ved 95 °C, og følg derefter med 45 cyklusser af 10 s denaturering ved 95 °C, Udglødning af primere for 30 s ved 58 °C og forlængelse for 30 s ved 72 °C.
  4. Kør PCR-produkterne på en 1,5% agopstået gel, plet med DNA-gel bejdspen (tabel over materialer), og Visualiser med UV.

6. virus produktion og-rensning

  1. Sæt resten af Petri skål kulturen tilbage i en lille kolbe.
  2. Til virus fremstilling forberedes 15 kolber på 145 cm2, indeholdende 40 ml Vermamoeba vermiformis i sulte mediet og 5 ml af den isolerede virus, der allerede er overført fra Petri skålen til små kolber.
  3. Behandl med samme antibiotiske og svampedræbende blanding, der anvendes i trin 4,1.
  4. Inkubere ved 30 °C. Overhold hver dag med inverteret Optisk mikroskopi.
  5. Efter den komplette infektion, pool alle kolber. Brug et 0,45 μm filter til at eliminere snavs.
  6. Ultracentrifuge alle supernatanter ved 50.000 x g for 45 min.
  7. Efter centrifugering fjernes supernatanten fra hvert rør ved aspiration og resuspension af pellet i 1 mL fosfat bufferet saltvand (PBS).
  8. Rense virus produceret ved hjælp af 25% saccharose (27,5 g saccharose i 100 mL PBS, steriliseret ved filtrering).
  9. 8 mL saccharose og 2 mL viral suspension centrifugeres ved 80.000 x g i 30 min. resuspension af viral pellet i 1 ml PBS. Opbevares ved-80 °C.

7. negativ farvning og transmission elektronmikroskopi

Bemærk: Bou Khalil et al. tidligere offentliggjort denne protokol27.

  1. 5 μL af lysis-supernatanten indlades på det glødetafladede gitter. Lad den ligge i ca. 20 minutter ved stuetemperatur.
    Bemærk: Glow-udledning giver os mulighed for at opnå en hydrofile gitter ved plasma applikation.
  2. Tør gitteret forsigtigt og deponere et lille fald på 1% ammonium molybdat på det i 10 s. Lad gitteret tørre i 5 minutter.
  3. Fortsæt til elektronmikroskopi observationer ved 200 keV.

8. karakterisering af Clandestinovirus ST1 og Usurpativirus LCD7

  1. Karakterisere rene populationer af clandestinovirus ST1 og usurpativirus LCD7 ved hjælp af genom sekventering, genom samling, Bioinformatik analyser, og undersøgelse af deres replikerende cyklus, som vi har gjort for andre vira10,20, 29.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Enkelt celle mikro-aspiration er en micromanipulation proces optimeret i dette manuskript (figur 1). Denne teknik muliggør opsamling af en afrundet, inficeret amøbe (figur 2a) og dens frigivelse i en ny plade, der indeholder uinficeret amobers (figur 2). Det er en funktionel prototype, der gælder for Co-kultur-systemet og har med succes isoleret ikke-lytiske gigantiske vira. Denne fremgangsmåde blev brugt for første gang inden for gigantiske vira og gjorde det muligt at isolere to nye low-overflod gigantiske vira. Vi hedder den nye vira Clandestinovirus ST1 og Usurpativirus LCD7, der var i lav overflod i forhold til den høje forekomst af Faustovira. For at analysere den virale tilstedeværelse i hver plade efter mikro-Aspirations proceduren, anvendte vi PCR på de 15 mikro-aspirationer. Vi observerede ren Usurpativirus (tilstedeværelse af Usurpativirus LCD7 [+] og fravær af Faustovirus [–]) kun i klon 7 (figur 3). Renheden af klonen blev bekræftet af PCR med specifikke protokoller rettet mod Clandestinovirus ST1 og Usurpativirus LCD7 (tabel 2). Elektronmikroskopi afslørede forekomsten af clandestinovirus ST1 og usurpativirus LCD7 (figur 4), som har en typisk icosahedral morfologi uden fibriller og et icosahedral kapsid på ca. 250 nm. Efter bekræftelsen af produktions renheden blev den klonale virus fremstillet og renset for hele genom-sekvensering og yderligere karakterisering, især transmissions elektronisk mikroskopi (TEM) for multiplikations cyklus undersøgelser. Vi bekræftede overlapning af populationer (Faustovirus/Novel virus) ved flow cytometri (figur 5).

Figure 1
Figur 1: materialer til micromanipulation. (A) faktisk opsætning af arbejdsstationen. (B) skematisk illustration af arbejdsstationens komponenter. C) skematisk illustration af mikrokapillær. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: trin i mikro-aspiration. (A) enkelt celle isolations procedure (zoom x40). (B) skematisk illustration af de forskellige trin i enkelt celle aspiration: 1) lokalisering af cellen. 2) aspiration af cellen. 3) frigivelse trin. De sorte pile viser mikrokapillær og de hvide viser den enkelte celle. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: PCR-screening og-bekræftelse. Screening PCR af mikro-aspirationer udført for Usurpativirus LCD7 og Faustovirus. Tilstedeværelse af Usurpativirus LCD7 DNA (+) og fravær af Faustovirus DNA (–) observeret for klon 7 efter mikro-aspiration procedure. Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: negativ farvnings Mikrograf. Negativ farvning af viral suspension, viser ren Clandestinovirus ST1 (A) og Usurpativirus LCD7 (B). Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5: repræsentative Gate plots. A) overlejring af hver enkelt viral population,dertidligere har været plettet med fluorescerende molekyle sonder for virus DNA-mærkning (efter tidligere beskrevet protokol26,30). Den venstre del af billedet viser Super positionen af fem stammer af Faustovirus (mørkegrøn, lysegrøn, orange, rød og blå). Til højre ses super positionen af Faustovirus ST1 og Clandestinovirus ST1 (lys lilla og mørk lilla). B) tilstedeværelsen af to virale befolkningsgrupper af Faustovirus og Usurpativirus i samme port som faustovirus (til venstre).  En prik plot af ren Usurpativirus viser den samme port defineret tidligere for Faustovirus (højre). Venligst klik her for at se en større version af dette tal.

PYG sammensætning Mængder
Proteose pepton 20 g
Gær ekstrakt 20 g
MgSO4· 7h2O 0,980 g
CaCl2 0,059 g
Citrat natrium. Dinatriumphosphatdihydrat 1 g
Fe (NH4) 2 (so4) 2 x 6h2O 0,02 g
Glukose 18 g
Destilleret vand 1 L
Justér pH ved 6,8 med HCl eller KOH
Autoklave 15 min ved 121 °C
Hungersnød medium mængder
Gær ekstrakt 2 g
Glukose 18 g
Fe (NH4) 2 (so4) 2 x 6h2O 0,02 g
PAS (detaljeret nedenfor) 1 L
PAS Solution A mængder
KH2po4 0,136 g
Na2HPO4 0,142 g
PAS Solution B mængder
MgSO4· 7h2O 4,0 mg
CaCl2· 2H2O 4,0 mg
Nacl 0,120 g
10 mL hver af opløsning A og B tilsættes til 1 L destilleret vand.

Tabel 1: sammensætning af kultur medier.

Virus Target Målgenet Foward primer (5-> 3) Omvendt primer (5-> 3)
Faustovirus RpB2 RpB2 CWCAATCHGCYGATACHGGTGA TGATTWGCYAATGGNGCYGC
Usurpatvirus LCD7 Major kapsid-gen Større kapsid-gen GGGCAAGAAGCTCCAAGCTA GGGTTGAGGAGGAGTCAACG
Clandestinovirus ST1 Minor kapsid-genet Mindre kapsid-gen AAAATGAACGCGTTGGAGGC ACCGGCGAATGTTCCTATGG

Tabel 2: Primmer-sekvenser, der anvendes til PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Varigheden af enkelt cellens mikroaspirations håndtering og dens gode funktion er operatør afhængig. De forskellige trin i forsøget kræver præcision. Brugen af micromanipulation komponenter af arbejdsstationen skal være under konstant kontrol ved at observere processen med mikro-aspiration og frigivelse af cellen. Opfølgningen ved mikroskopisk observation er nødvendig for opsamling og overførsel af en celle. En erfaren operatør kan tage 1 til 2 timer at isolere 10 celler og genover føre dem en efter en afhængigt af den overflod af vira, der skal isoleres. Antallet af manipulationer kan variere. Vi anbefaler at begynde med 10 manipulationer. Ved definition kender vi ikke de iboende egenskaber ved den ukendte virus. Således, brug og udvikling af forskellige strategier for isolation er nødvendige for at optimere succesen med at adskille disse vira.

Mikro-Aspirations processen udføres under usterile forhold (på en bænk uden for den mikrobiologiske sikkerheds Station) og dermed begrænser dens anvendelse og forhindrer dens anvendelse til undersøgelse af humane patogener. Derfor er brugen af en blanding af antibiotika og svampemidler til at begrænse forurenende stoffer obligatorisk. En anden begrænsning af metoden er, at den kun kan udføres på mikroorganismer, der er observerbare ved let mikroskopi, hvor micromanipulation-komponenterne blev monteret, hvilket begrebsmæssigt eliminerer ethvert arbejde på mikroorganismer, som ikke kan observeres af lys Mikroskopi. Men vi var i stand til at adskille gigantiske vira på omkring 200 Nm, som forbliver usynlige under det lette mikroskop ved hjælp af en indirekte strategi, der består af adskillelse og kloning de inficerede værter.

Udviklingen af en enkelt celle mikro-aspiration for amoebal Capture er en del af udviklingen af befolkningen-sortering metoder. Enkelt celle mikro-aspiration tillod os at isolere to nye gigantiske vira, Clandestinovirus ST1 og Usurpativirus LCD7, med karakteristika karakteristisk fra Faustovira. De meget lignende morfologiske egenskaber af både Clandestinovirus ST1 og Usurpativirus LCD7 til Faustovirus LCD7 og deres forskel på replikation viser grænsen af FACS, som normalt anvendes i Giant vira sortering. Den repræsenteres ved super positionen af to virale populationer, Clandestinovirus ST1 og Faustovirus ST1 (figur 5A) og også ved påvisning af usupartivirus LCD7 og faustovirus LCD7. Men med denne nye metode, hele manipulation er under visuel kontrol med omhyggelig overvågning af cellen og dens integritet selv efter dens frigivelse. Brugen af flow flowcytometri til direkte sortere inficerede amobers kunne være en alternativ løsning til indirekte sortere nye vira. Denne metode er normalt efterfulgt af screeningen af pladen for at detektere cytopatiske virkninger eller lysis. Tilstedeværelsen af ikke-lytiske vira i blandingen kunne udgøre en grænse for amoebal sortering. Dette blev imidlertid ikke undersøgt i forbindelse med udarbejdelsen af denne protokol og for disse to nye isoleringer.

Ud over anvendelsen af micromanipulation i positionering og opbevaring af celler i almindelighed og oocytter for ICSI sperm injektion (ICSI)33, enkelt celle mikro-aspiration har vist sig at være en praktisk metode til isolering af enkelt prokaryotiske celler, som kan observeres under et optisk mikroskop31. Andre applikationer kan testes, herunder celle sortering på et morfologisk grundlag for at have forskellige rene prøver fra en blandet udsnit af mikroorganismer. Den observerbare adskillelse af mikroorganismer kan forestillede sig ved hjælp af den ovenfor beskrevne strategi.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Alle forfattere har intet at afsløre.

Acknowledgments

Forfatterne vil gerne takke både Jean-Pierre Baudoin og Olivier Mbarek for deres råd og Claire Andréani for hendes hjælp i engelske rettelser og modifikationer. Dette arbejde blev støttet af et tilskud fra den franske stat, der forvaltes af det nationale forskningsagentur under programmet "Investissements d'avenir (investeringer for fremtiden)" med referencen ANR-10-IAHU-03 (Méditerranée-infektion) og af Région Provence Alpes Côte d'Azur og europæisk finansiering af FEDER PRIMI.

Materials

Name Company Catalog Number Comments
Agarose Standard Euromedex Unkown Standard PCR
AmpliTaq Gold 360 Master Mix Applied Biosystems 4398876 Standard PCR
CellTram 4r Oil Eppendorf 5196000030 Control the cells during the microaspiration process
Corning cell culture flasks 150 cm2 Sigma-aldrich CLS430825 Culture
Corning cell culture flasks 25 cm2 Sigma-aldrich CLS430639 Culture
Corning cell culture flasks 75 cm2 Sigma-aldrich CLS430641 Culture
DFC 425C camera LEICA Unkown Observation/Monitoring
Eclipse TE2000-S Inverted Microscope Nikon Unkown Observation/Monitoring
EZ1 advanced XL Quiagen 9001874 DNA extraction
Glasstic Slide 10 with Counting Grids Kova International 87144E Cell count
Mastercycler nexus Eppendorf 6331000017 Standard PCR
Microcapillary 20 µm Eppendorf 5175 107.004 Microaspiration and release of cells
Micromanipulator InjectMan NI2 Eppendorf 631-0210 Microcapillary positioning
Nuclease-Free Water ThermoFischer AM9920 Standard PCR
Optima XPN Ultracentrifuge BECKMAN COULTER A94469 Virus purification
Petri dish 35 mm Ibidi 81158 Culture/observation
Sterile syringe filters 5 µm Sigma-aldrich SLSV025LS Filtration
SYBR green Type I Invitrogen unknown Fluorescent molecular probes/flow cytometry
SYBR Safe Invitrogen S33102 Standard PCR; DNA gel stain
Tecnai G20 FEI Unkown Electron microscopy
Type 70 Ti Fixed-Angle Titanium Rotor BECKMAN COULTER 337922 Virus purification
Ultra-Clear Tube, 25 x 89 mm2 BECKMAN COULTER 344058 Virus purification

DOWNLOAD MATERIALS LIST

References

  1. Iyer, L. M., Aravind, L., Koonin, E. V. Common Origin of Four Diverse Families of Large Eukaryotic DNA Viruses. Journal of Virology. 75, (23), 11720-11734 (2001).
  2. Li, Y., et al. Analysis of 74 kb of DNA located at the right end of the 330-kb chlorella virus PBCV-1 genome. Virology. 237, (2), 360-377 (1997).
  3. Scola, B. L. A Giant Virus in Amoebae. Science. 299, (5615), 2033 (2003).
  4. Philippe, N., et al. Pandoraviruses: amoeba viruses with genomes up to 2.5 Mb reaching that of parasitic eukaryotes. Science. 341, (6143), 281-286 (2013).
  5. Antwerpen, M. H., et al. Whole-genome sequencing of a pandoravirus isolated from keratitis-inducing acanthamoeba. Genome Announcements. 3, (2), 00136-00215 (2015).
  6. Legendre, M., et al. Thirty-thousand-year-old distant relative of giant icosahedral DNA viruses with a pandoravirus morphology. Proceedings of the National Academy of Sciences of the United States of America. 111, (11), 4274-4279 (2014).
  7. Legendre, M., et al. In-depth study of Mollivirus sibericum, a new 30,000-y-old giant virus infecting Acanthamoeba. Proceedings of the National Academy of Sciences of the United States of America. 112, (38), 5327-5335 (2015).
  8. Legendre, M., et al. Diversity and evolution of the emerging Pandoraviridae family. Nature Communications. 9, (1), 2285 (2018).
  9. Aherfi, S., et al. A Large Open Pangenome and a Small Core Genome for Giant Pandoraviruses. Frontiers in Microbiology. 9, 166 (2018).
  10. Andreani, J., et al. Cedratvirus, a Double-Cork Structured Giant Virus, is a Distant Relative of Pithoviruses. Viruses. 8, (11), 300 (2016).
  11. Rodrigues, R. A. L., et al. Morphologic and genomic analyses of new isolates reveal a second lineage of cedratviruses. Journal of Virology. 00372 (2018).
  12. Bertelli, C., et al. Cedratvirus lausannensis- digging into Pithoviridaediversity. Environmental Microbiology. (2017).
  13. Levasseur, A., et al. Comparison of a modern and fossil Pithovirus reveals its genetic conservation and evolution. Genome Biology and Evolution. (2016).
  14. Dornas, F. P., et al. A Brazilian Marseillevirus Is the Founding Member of a Lineage in Family Marseilleviridae. Viruses. 8, (3), 76 (2016).
  15. Yoshikawa, G., Blanc-Mathieu, R., et al. Medusavirus, a novel large DNA virus discovered from hot spring water. Journal of Virology. (2019).
  16. Legendre, M., et al. Pandoravirus Celtis Illustrates the Microevolution Processes at Work in the Giant Pandoraviridae Genomes. Frontiers in Microbiology. 10, 430 (2019).
  17. Abrahão, J., et al. Tailed giant Tupanvirus possesses the most complete translational apparatus of the known virosphere. Nature Communications. 9, (1), 749 (2018).
  18. Reteno, D. G., et al. Faustovirus, an asfarvirus-related new lineage of giant viruses infecting amoebae. Journal of Virology. 89, (13), 6585-6594 (2015).
  19. Bajrai, L., et al. Kaumoebavirus, a New Virus That Clusters with Faustoviruses and Asfarviridae. Viruses. 8, (12), 278 (2016).
  20. Andreani, J., et al. Orpheovirus IHUMI-LCC2: A New Virus among the Giant Viruses. Frontiers in Microbiology. 8, 779 (2018).
  21. Fischer, M. G., Allen, M. J., Wilson, W. H., Suttle, C. A. Giant virus with a remarkable complement of genes infects marine zooplankton. Proceedings of the National Academy of Sciences of the United States of America. 107, (45), 19508-19513 (2010).
  22. Moniruzzaman, M., et al. Genome of brown tide virus (AaV), the little giant of the Megaviridae, elucidates NCLDV genome expansion and host-virus coevolution. Virology. 466-467, 60-70 (2014).
  23. Gallot-Lavallée, L., Blanc, G., Claverie, J. -M. Comparative genomics of Chrysochromulina Ericina Virus (CeV) and other microalgae-infecting large DNA viruses highlight their intricate evolutionary relationship with the established Mimiviridae family. Journal of Virology. (2017).
  24. Deeg, C. M., Chow, C. -E. T., Suttle, C. A. The kinetoplastid-infecting Bodo saltans virus (BsV), a window into the most abundant giant viruses in the sea. eLife. 7, 235 (2018).
  25. Boughalmi, M., et al. High-throughput isolation of giant viruses of the Mimiviridae and Marseilleviridae families in the Tunisian environment. Environmental Microbiology. 15, (7), 2000-2007 (2013).
  26. Khalil, J. Y. B., et al. High-Throughput Isolation of Giant Viruses in Liquid Medium Using Automated Flow Cytometry and Fluorescence Staining. Frontiers in Microbiology. 7, (120), 26 (2016).
  27. Bou Khalil, J. Y., Andreani, J., Raoult, D., La Scola, B. A Rapid Strategy for the Isolation of New Faustoviruses from Environmental Samples Using Vermamoeba vermiformis. Journal of Visualized Experiments : JoVE. (112), e54104 (2016).
  28. Khalil, J. Y. B., Andreani, J., La Scola, B. Updating strategies for isolating and discovering giant viruses. Current Opinion in Microbiology. 31, 80-87 (2016).
  29. Andreani, J., et al. Pacmanvirus, a new giant icosahedral virus at the crossroads between Asfarviridae and Faustoviruses. Journal of Virology. (2017).
  30. Khalil, J. Y. B., et al. Flow Cytometry Sorting to Separate Viable Giant Viruses from Amoeba Co-culture Supernatants. Frontiers in Cellular and Infection Microbiology. 6, 17722 (2017).
  31. Fröhlich, J., König, H. New techniques for isolation of single prokaryotic cells. FEMS Microbiology Reviews. 24, (5), 567-572 (2000).
  32. Ye, J., et al. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics. 13, (1), 134 (2012).
  33. Kimura, Y., Yanagimachi, R. Intracytoplasmic sperm injection in the mouse. Biology of Reproduction. 52, (4), 709-720 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics