बैक्टीरियल विल्ट रोग के सरल आनुवंशिक विश्लेषण के लिए राल्स्टोनिया सोलनेसेरम के साथ टीका के बाद टमाटर रूट परिवर्तन

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

यहां, हम बैक्टीरियल मुरझानी रोग के अध्ययन के लिए सीधा आनुवंशिक विश्लेषण करने के लिए राल्स्टोनिया सोलनसेरम के साथ टीका के बाद टमाटर जड़ परिवर्तन के लिए एक बहुमुखी विधि प्रस्तुत करते हैं।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

राल्सोनिया सोलनसेरम एक विनाशकारी मिट्टी जनित संवहनी रोगजनक है जो पौधों की प्रजातियों की एक बड़ी श्रृंखला को संक्रमित कर सकता है, जिससे कृषि के लिए एक महत्वपूर्ण खतरा पैदा होता है। हालांकि, रालिस्टोनिया मॉडल को अरबीडोप्सिसमें स्यूडोमोनास सिरिंगा जैसे बैक्टीरियल प्लांट रोगजनकों से जुड़े अन्य मॉडलों की तुलना में काफी कम रोजाना किया जाता है। राल्सोनिया और फसल पौधों के बीच बातचीत को समझने के लिए लक्षित अनुसंधान बैक्टीरियल मुरझाना रोग के खिलाफ लड़ने के लिए टिकाऊ समाधान विकसित करने के लिए आवश्यक है, लेकिन वर्तमान में देशी मेजबान पौधों में बातचीत के विभिन्न घटकों की विशेषता के लिए सीधा प्रयोगात्मक परख की कमी से रुकावट है । इस परिदृश्य में, हमने राल्स्टोनियाके प्राकृतिक मेजबान टमाटर के राल्स्टोनिया संक्रमण का आनुवंशिक विश्लेषण करने के लिए एक विधि विकसित की है। यह विधि एग्रोबैक्टीरियम राइजोजीन-टमाटरकी जड़ों के मध्यस्थता परिवर्तन पर आधारित है, जिसके बाद राल्स्टोनिया मिट्टी-परिणामी पौधों के टीका को भीग रहा है, जिसमें ब्याज के निर्माण को व्यक्त करने वाली परिवर्तित जड़ें होती हैं। रूट परिवर्तन परख की बहुमुखी प्रतिभा या तो जीन अतिअभिव्यक्ति या जीन RNAi द्वारा मध्यस्थता मुंह बंद करने की अनुमति देता है । अवधारणा के सबूत के रूप में, हमने इस विधि का उपयोग यह दिखाने के लिए किया कि टमाटर की जड़ों में एसएलसीईएसए6 की RNAi-मध्यस्थता ने राल्स्टोनियाके प्रतिरोध को प्रदान किया। यहां, हम इस विधि का विस्तार से वर्णन करते हैं, जिससे आनुवंशिक दृष्टिकोण अपेक्षाकृत कम समय में और उपकरणों और पौधों के विकास की जगह की छोटी आवश्यकताओं के साथ बैक्टीरियल मुरझाने वाली बीमारी को समझने में सक्षम होते हैं।

Introduction

बैक्टीरियल मुरझानी रोग का कारण एजेंट राल्स्टोनिया सोलासेरम,दुनिया भर में वितरण के साथ एक विनाशकारी मिट्टी जनित संवहनी रोगजनक है जो आलू, टमाटर, तंबाकू, केला, काली मिर्च और बैंगन सहित पौधों की प्रजातियों की एक बड़ी श्रृंखला को संक्रमित कर सकता है, अन्य के बीच1,2राल्सोनिया के कारण उपज नुकसान टमाटर, आलू या केले में उत्पादन के 80-90% तक पहुंच सकता है, खेती, जलवायु, मिट्टी और अन्य कारकों के आधार पर3. हालांकि, राल्स्टोनिया मॉडल बैक्टीरियल प्लांट रोगजनकों से जुड़े अन्य मॉडलों की तुलना में काफी कम है, जैसे स्यूडोमोनास सिरिंगया या Xanthomonas spp। इसके अतिरिक्त, संयंत्र-माइक्रोब इंटरैक्शन में अधिकांश अध्ययन मॉडल संयंत्र अरबीडोप्सिस थैलियानापर केंद्रित हैं। हालांकि इन मॉडलों का उपयोग कर अनुसंधान काफी हद तक संयंत्र बैक्टीरिया बातचीत की हमारी समझ में योगदान दिया है, वे वर्तमान आवश्यकता को संबोधित करने के लिए फसल पौधों में इन बातचीत को समझने नहीं है । राल्सोनिया और फसल पौधों के बीच बातचीत को समझने के लिए लक्षित अनुसंधान बैक्टीरियल मुरझाना रोग के खिलाफ लड़ने के लिए टिकाऊ समाधान विकसित करने के लिए आवश्यक है, लेकिन वर्तमान में बातचीत के विभिन्न घटकों की विशेषता के लिए सीधा प्रयोगात्मक परख की कमी से रुकावट है । विशेष रूप से, टमाटर, राल्सोनियाके लिए एक प्राकृतिक मेजबान, दुनिया भर में दूसरी सबसे महत्वपूर्ण सब्जी फसल है और बैक्टीरियल मुरझाना रोग सहित4रोगों की अधिकता से प्रभावित है । इस काम में हमने टमाटर के राल्स्टोनिया संक्रमण का जेनेटिक एनालिसिस करने की आसान विधि विकसित की है। यह विधि एग्रोबैक्टीरियम राइजोजीनपर आधारित है - टमाटर की जड़ों के मध्यस्थता परिवर्तन, चयन मार्कर5के रूप में DsRed फ्लोरेसेंस का उपयोग करके, इसके बाद राल्स्तोनिया मिट्टी-परिणामी पौधों के टीका को भीग रहा है, जिसमें रुचि के निर्माण को व्यक्त करने वाली परिवर्तित जड़ें होती हैं। रूट परिवर्तन परख की बहुमुखी प्रतिभा या तो जीन अतिअभिव्यक्ति या जीन RNAi द्वारा मध्यस्थता मुंह बंद करने की अनुमति देता है ।

इस विधि की संभावित सीमा में गैर-परिवर्तित जड़ों के अवशिष्ट विकास होते हैं। यह उन मामलों में विशेष रूप से महत्वपूर्ण है जहां प्लाज्मिड का उपयोग एक रिपोर्टर जीन का अभाव है जो परिवर्तित जड़ों के चयन की अनुमति देता है। इस समस्या को हल करने के लिए, हमने एंटीबायोटिक चयन के आधार पर एक वैकल्पिक विधि विकसित की है, जो स्वस्थ एंटीबायोटिक प्रतिरोधी परिवर्तित जड़ों के विकास की अनुमति देते हुए गैर-परिवर्तित जड़ों के विकास को रोकती है । चूंकि ए राइजोजीन शूटिंग के परिवर्तन को प्रेरित नहीं करता है, इसलिए वे एंटीबायोटिक के लिए अतिसंवेदनशील होते हैं, और इसलिए, उन्हें एंटीबायोटिक युक्त माध्यम से अलग रखा जाना चाहिए।

हालांकि राल्सटोनिया के खिलाफ पौधों का प्रतिरोध अच्छी तरह से नहीं समझा जाता है, लेकिन कई रिपोर्टों में बैक्टीरियल मुरझानेवाले प्रतिरोध कोबढ़ाने के लिए सेल वॉल परिवर्तन से जुड़े हैं6,7,,8,,9। यह सुझाव दिया गया है कि ये सेल दीवार परिवर्तन संवहनी विकास को प्रभावित करते हैं, जो पौधे10के अंदर राल्स्टोनिया की जीवनशैली के लिए एक आवश्यक पहलू है। अरबिडोप्सिस थैलियाना में सेल्यूलोज सिंथासिस सीईएसए4, सीईएसए7 और सीईएसए8 को एन्कोडिंग करने वाले जीन में उत्परिवर्तनों को माध्यमिक कोशिका दीवार अखंडता को ख़राब करने के लिए दिखाया गया है, जिससे राल्स्टोनियाका प्रतिरोध बढ़ा है, जो एबीए सिग्नलिंग8से जुड़ा हुआ प्रतीत होता है । इसलिए, हमारी विधि के लिए अवधारणा के प्रमाण के रूप में, हमने एसएलसीईएसए6 (Solyc02g072240),एक माध्यमिक कोशिका-दीवार सेल्यूलोज सिंथाज़, और AtCESA8 (At4g18780)के ऑर्थोलॉग के RNAi-मध्यस्थता जीन सिलेक्ट िंग का प्रदर्शन किया। बाद में मिट्टी-Ralstonia के साथ भीग टीका से पता चला है कि मुंह बंद SlCESA6 बैक्टीरियल मुरझाना लक्षणों के लिए प्रतिरोध बढ़ाया, सुझाव है कि सेल की दीवार-राल्सोनिया के लिए प्रतिरोध मध्यस्थता की संभावना टमाटर में संरक्षित है, और हमारी विधि को मान्य करने के लिए टमाटर की जड़ों में जीवाणु मुरझाना प्रतिरोध के आनुवंशिक विश्लेषण ले । Ralstonia यहां, हम इस विधि का विस्तार से वर्णन करते हैं, जिससे आनुवंशिक दृष्टिकोण अपेक्षाकृत कम समय में और उपकरणों और पौधों के विकास की जगह की छोटी आवश्यकताओं के साथ बैक्टीरियल मुरझाने वाली बीमारी को समझने में सक्षम होते हैं।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

नोट: इस विधि के महत्वपूर्ण भागों में विट्रो में पौधों की सामग्री को संभालना शामिल है, और इसलिए इन सभी प्रक्रियाओं के दौरान बाँझ स्थितियों को रखना महत्वपूर्ण है, जिसमें DsRed फ्लोरेसेंस का दृश्य शामिल है। सभी परिवर्तन प्रक्रिया के दौरान, टमाटर रोपण 25−28 डिग्री सेल्सियस और 16 एच/8 एच लाइट/डार्क (130 माइक्रोमोल फोटॉन्स एम-2एस-1 लाइट) पर बढ़ता है। गैस एक्सचेंज और वाष्पीकरण की सुविधा के लिए प्लेटों को माइक्रोपोर टेप से सील कर दिया जाता है।

1. टमाटर के पौधों और एग्रोबैक्टीरियम राइजोजीन की तैयारी

  1. टमाटर के बीजों को स्टरलाइज करें(सोलनम लाइकोपर्शीकम सीवी मनीमेकर, एलए2706, टोमैटो जेनेटिक्स रिसोर्स सेंटर, टीजीआरसी) 5% (v/v) सोडियम हाइपोक्लोराइट के साथ 5 मिन के लिए। 4-5 बार आसुत बाँझ पानी के साथ धोएं और अंकुरण को सुविधाजनक बनाने के लिए रात भर बाँझ पानी में धीरे-धीरे मिलाते हुए बीजों को रखें।
  2. टमाटर के बीजों को आधी ताकत मुरुशिगे और स्कूग (आधा एमएस) मीडियम में बिना सुक्रोज (२.२१ जी/एल एमएस, 8% w/v आगर) में ट्रांसफर करें । बीज ों को तीन दिनों तक 25−28 डिग्री सेल्सियस पर अंधेरे में रखें(चित्रा 1ए)।
    नोट: प्रत्येक निर्माण के लिए आमतौर पर लगभग 40 बीजों की आवश्यकता होती है।
  3. ऑटोक्लेव 8.5 सेमी2 स्क्वायर फिल्टर पेपर। वर्ग फिल्टर कागजात 9 सेमी2 वर्ग पेट्री व्यंजन के अंदर रखें जिसमें 1/2 एमएस माध्यम (कागज को आगर के शीर्ष पर रखें) और प्रत्येक प्लेट पर छह अंकुरित टमाटर के बीज रखें(चित्रा 1बी)। माइक्रोपोर टेप के साथ प्लेट को सील करें और अंकुरित बीजों को 3−4 दिनों के लिए 25−28 डिग्री सेल्सियस पर इनक्यूबेट करें।
  4. पौधे परिवर्तन से दो दिन पहले 28 डिग्री सेल्सियस पर ठोस एलबी माध्यम (उचित एंटीबायोटिक दवाओं के साथ) में एग्रोबैक्टीरियम राइजोजीन MSU440 बढ़ाएं।
    नोट: ए राइजोजीन डॉ जुआन एंटोनियो लोपेज़ रेज़, ईईजेड-सीएसआईसी, ग्रेनेडा, स्पेन द्वारा प्रदान किया जाता है। इस लेख में वर्णित प्रयोग में, pK7GWIWG2_II-RedRoot युक्त ए राइजोजीन:: CESA6 या एक खाली वेक्टर, नियंत्रण के रूप में, इस्तेमाल किया गया । pK7GWIWG2_II-RedRoot एक रिपोर्टर जीन, DsRed, अरबीdopsis थैलियाना सर्वव्यापी प्रमोटर(pAtUBQ10)द्वारा संचालित होता है, और स्पेक्ट्नोमाइसिन (५० μg/mL) के लिए प्रतिरोध प्रदान करता है । जीन अतिअभिव्यक्ति के लिए अन्य वेक्टर का उपयोग करना संभव है, जैसा कि5से पहले बताया गया है। इस काम में, SlCESA6 silencing के लिए विशिष्ट टुकड़ा का प्रवर्धन रिवर्स ट्रांसक्रिप्शन (आरटी) पीसीआर द्वारा टमाटर(एस लाइकोपीर्सिकम सीवी मनीमेकर) से अलग आरएनए का उपयोग करके प्राप्त किया गया था और पी-ईएनटीआर/डी-टोप्पो वेक्टर(टेबल 1)में लिगेट किया गया था । बाद में, SlCESA6-RNAi टुकड़ा pK7GWIWG2_II-RedRoot बाइनरी वेक्टर में क्लोन किया गया था ।

2. पौधे परिवर्तन और चयन

  1. बाँझ स्केलपेल का उपयोग करके, रेडिकल और टमाटर रोपण के हाइपोकोटाइल के नीचे(चित्रा 1सी, डी)काट ें।
  2. प्लास्टिक टिप्स या स्केलपेल ब्लेड का उपयोग करके एलबी माध्यम की सतह से हार्वेस्ट ए राइज़ोजीन बायोमास और बैक्टीरियल बायोमास(चित्रा 1ई)में कट टमाटर रोपण को ध्यान से डुबोएं।
  3. ए राइजोजीनके साथ टीका के बाद, टमाटर के रोपण को उच्च आर्द्रता रखने और जीवित रहने और नए रूट विकास की सुविधा प्रदान करने के लिए 2 सेमी x 4 सेमी अर्ध-परिपत्र फिल्टर पेपर(चित्रा 1एफ)के साथ कवर करें।
  4. बदल टमाटर रोपण को 6-7 दिनों के लिए स्टोर करें। फिर, नई उभरती बालों वाली जड़ों(चित्रा 1जी, एच;इस कदम पर, जड़ों को अभी तक नहीं बदल रहे हैं) को काटने के लिए एक बाँझ स्केलपेल का उपयोग करें और रोपण को नई बालों वाली जड़ों का उत्पादन करने की अनुमति दें।
  5. एक बार नई बालों वाली जड़ों की दूसरी पीढ़ी दिखाई देती है(चित्रा 1I),रोपण के शीर्ष पर फिल्टर पेपर को हटा दें, और प्लेट को माइक्रोपोर टेप के साथ फिर से सील करें।
    नोट: इस बिंदु पर, परिवर्तन वेक्टर में DsRed फ्लोरोसेंट मार्कर की उपस्थिति नई जड़ों में परिवर्तन दक्षता की कल्पना करने की अनुमति देता है।
  6. DsRed फ्लोरेसेंस की कल्पना करने के लिए, वीवो इमेजिंग(चित्रा 1जे)में पौधे के लिए स्टीरियोमाइक्रोस्कोप या किसी अन्य उपकरण का उपयोग करें। सकारात्मक (लाल फ्लोरेसेंस) को चिह्नित करें और जड़ों को बदल दिया और बाँझ स्केलपेल का उपयोग करके नकारात्मक गैर-परिवर्तित जड़ों (कोई लाल फ्लोरेसेंस) को हटा दें।
  7. मुख्य जड़(चित्रा 1K)के रूप में बदल जड़ के विकास को सुविधाजनक बनाने के लिए, 1/2 एमएस माध्यम युक्त एक नई प्लेट के लिए लाल फ्लोरेसेंस दिखारोपण का हस्तांतरण करें । रोपण रखें जो बाद के समय बिंदुओं में फ्लोरोसेंट जड़ों(चित्रा 1एल)के उद्भव की जांच करने के लिए एक ही प्लेट में लाल फ्लोरेसेंस नहीं दिखाते हैं।
  8. एंटीबायोटिक चयन के आधार पर वैकल्पिक विधि
    1. 2.5 कदम के लिए वैकल्पिक, उचित एंटीबायोटिक के साथ 1/2 एमएस माध्यम युक्त आधा भरा 9 सेमी2 वर्ग प्लेटें तैयार करें। तैयारी प्रक्रिया के दौरान प्लेटों को लगभग 5° झुकाएं ताकि मध्यम(चित्रा 2ए)के बिना खाली जगह उत्पन्न की जा सके, जिससे शूटिंग एंटीबायोटिक के संपर्क से बचने के लिए विकसित हो सके।
    2. चरण 2.6 का विकल्प, पहले गैर-परिवर्तित बालों वाली जड़ों को काटने के बाद उभरा (चरण 2.4), उचित आकार(चित्रा 2बी)के साथ फिल्टर पेपर का उपयोग करके आधी भरी प्लेटों में जड़ों के बिना रोपण स्थानांतरित करें।
      नोट: सकारात्मक नियंत्रण के रूप में, एक ही एंटीबायोटिक प्रतिरोध और एक रिपोर्टर जीन युक्त प्लाज्मिड के साथ कई रोपण को बदलने की सिफारिश की जाती है (इस प्रोटोकॉल में, pK7GWIWG2_II-RedRoot; kanamycin ५० μg/mL) ।
    3. 2.7 कदम के लिए वैकल्पिक, रोपण नई बालों वाली जड़ों को विकसित करने दें और उन जड़ों को काट दें जो फिल्टर सैंडविच पेपर्स की सतह के साथ सीधे संपर्क में नहीं हैं, क्योंकि ये जड़ें एंटीबायोटिक चयन से बच सकती हैं।
      नोट: एंटीबायोटिक प्रभाव के कारण, जड़ विकास एंटीबायोटिक दवाओं के बिना प्लेटों की तुलना में धीमा हो सकता है। नई बदल बालों वाली जड़ें आधी भरी प्लेटों (चरण 2.8.2)(चित्रा 2सी-ई)को जड़ों के बिना रोपण स्थानांतरित करने के बाद 14−18 दिनों के भीतर दिखाई देती हैं।
  9. रोपण को 2 सेमी x 4 सेमी सेमी सेमी-सर्कल फिल्टर पेपर के साथ कवर करें, प्लेट को सील करें और उन्हें नई बालों वाली जड़ों को विकसित करने के लिए रोपण को इनक्यूबेट करें।
    नोट: एंटीबायोटिक दवाओं का उपयोग कर ए राइजोजीन को खत्म करना आवश्यक नहीं है। एमएस माध्यम के शीर्ष पर फिल्टर पेपर और सुक्रोज की कमी प्लेट5पर ए राइजोजीन के प्रसार को रोकती है ।
  10. पहले रूट चयन के पांच-सात दिन बाद नई परिवर्तित जड़ों का चयन करने और गैर-परिवर्तित जड़ों को हटाने के लिए चयन प्रक्रिया दोहराएं । 1/2 एमएस माध्यम युक्त एक नई प्लेट में बदल जड़ों युक्त रोपण हस्तांतरण ।

3. टीका बर्तन के लिए स्थानांतरण

  1. टीका बर्तन तैयार करें जहां जड़ों की सतह बैक्टीरियल इनोकुलम के संपर्क में आ जाएगी: टीका बर्तन को पानी से भिगोएं, किसी भी अतिरिक्त पानी को बंद करें, और उन्हें प्लास्टिक रोपण ट्रे में रखें। चुनिंदा रोपण को चिमटी(चित्रा 3ए)का उपयोग करके टीका बर्तन में परिवर्तित जड़ों के साथ स्थानांतरित करें।
  2. ट्रे को प्लास्टिक की चादर या पारदर्शी ढक्कन से ढककर 25−28 डिग्री सेल्सियस और 65% आर्द्रता (16 एच/8 एच लाइट/डार्क; 130 माइक्रोमोल फोटॉन्सएम-2एस-1 लाइट) पर रखें, ताकि उच्च स्तर की आर्द्रता को बनाए रखा जा सके चित्रा 3बी)। पांच या छह दिनों के बाद कवर निकालें।
    नोट: बदल टमाटर के पौधे टीका के लिए तैयार हैं दो से तीन सप्ताह बाद उन्हें मिट्टी में स्थानांतरित करने के बाद(चित्रा 3सी)। मिट्टी पर विकास के दौरान, टमाटर के पौधे नई जड़ों का उत्पादन कर सकते हैं जो बदल नहीं रहे हैं। इस घटना की सीमा निर्धारित करने के लिए, लाल फ्लोरेसेंस 3 सप्ताह पुराने टमाटर के पौधों की जड़ों में कल्पना की गई थी । अधिकांश जड़ें (80%-100%) लाल फ्लोरेसेंस दिखाया, यह दर्शाता है कि वे वास्तव में बदल रहे हैं(चित्रा 3डी, ई)।

4. मिट्टी से भीग ने टीका

  1. एक कक्षीय शेखर (200 आरपीएम) में 28 डिग्री सेल्सियस पर स्थिर चरण में पीएचआई तरल माध्यम(तालिका 211)में आर सोलांसरम (इस प्रोटोकॉल में तनाव GMI1000) बढ़ें।
  2. 600 एनएम (ओडी600)पर बैक्टीरियल कल्चर के ऑप्टिकल घनत्व को मापकर बैक्टीरियल नंबर निर्धारित करें। 0.1 के एक ओडी600 के लिए पानी के साथ जीवाणु संस्कृति पतला (यहाँ इस्तेमाल शर्तों में, यह लगभग 108 कॉलोनी बनाने इकाइयों [CFU]/mL) से मेल खाती है.
  3. एक टीका ट्रे में बदल टमाटर के पौधों युक्त 16−20 टीका बर्तन रखें (29 सेमी x 20 सेमी; चित्रा 4ए)
  4. टीका बर्तन युक्त ट्रे में बैक्टीरियल इनोकुलम (0.1 के ओडी600) के 300 mL (~ 15 mL प्रति पौधे) डालो। उन्हें 20 मिन(चित्रा 4बी)के लिए इनोकुलम में भिगोदें।
  5. पोटिंग मिट्टी की परत के साथ एक नई ट्रे तैयार करें। टीका लगाने वाले बर्तनों को नई ट्रे(चित्रा 4सी)में ले जाएं और ट्रे को 75% आर्द्रता, 26−28 डिग्री सेल्सियस, और 12 घंटे प्रकाश और 12 घंटे अंधेरे (130 माइक्रोमोल फोटॉनएम-2एस-1 लाइट) के फोटोपीरियड के साथ ग्रोथ चैंबर में रखें।

5. संक्रमण मापदंडों और सांख्यिकीय विश्लेषण का निर्धारण

  1. स्कोर रोग के लक्षण ों के रूप में पहलेवर्णित 12,,13,0 (कोई लक्षण नहीं) से 4 (पूर्ण मुरझाना)(चित्रा 4डी-एच),प्रत्येक दिन दो सप्ताह के लिए राल्सोनिया टीका के बाद से लेकर पैमाने का उपयोग कर ।
    नोट: रोग सूचकांक डेटा समय के साथ एक ही प्रयोगात्मक इकाई (प्रत्येक संयंत्र) से एकत्र किए जाते हैं ।

6. जीन अभिव्यक्ति विश्लेषण

नोट: ट्रांसजीन की अभिव्यक्ति या लक्ष्य जीन के मुंह को बंद करने का निर्धारण आरटी-पीसीआर द्वारा या मात्रात्मक आरटी-पीसीआर (क्यूआरटी-पीसीआर) द्वारा किया जा सकता है।

  1. नमूने एकत्र करें और परिवर्तित रूट सिस्टम के प्रतिनिधि भाग से आरएनए निकालें (लक्ष्य जीन पर प्रभाव का मूल्यांकन करने के लिए) और पत्तियां (आंतरिक नियंत्रण के रूप में)।
  2. कुल DNase-इलाज आरएनए के 1 μg का उपयोग कर सिंथेसाइज सीडीएनए संश्लेषण।
  3. क्यूआरटी-पीसीआर द्वारा लक्ष्य जीन की जीन अभिव्यक्ति का विश्लेषण करें। 2-11सीटी विधि14का उपयोग करके सापेक्ष प्रतिलेखन स्तर की गणना करें, एसएलईएफα-1 का उपयोग हाउसकीपिंग जीन15के रूप में करें।
    नोट: प्राइमर दृश्यों तालिका 1में सूचीबद्ध हैं ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

चित्रा 5 एक खाली वेक्टर (ईवी) के साथ बदल जड़ों के साथ टमाटर के पौधों के रोग के लक्षणों के विकास से पता चलता है, और एक RNAi निर्माण SlCESA6 (Solyc02g072240)के साथ बदल जड़ों के साथ पौधों। रोग सूचकांक डेटा(चित्रा 5ए)0 से 4 तक मनमाने पैमाने के अनुसार समय के साथ एक ही प्रयोगात्मक इकाई (प्रत्येक संयंत्र) से एकत्र किए जाते हैं, और एक गॉसियन वितरण का पालन नहीं करते हैं, पैरामेट्रिक डेटा के लिए मानक परीक्षणों के उपयोग का फैसला करते हैं। इसके अलावा, उपनिवेशीकरण और संक्रमण गतिशीलता के कारण इस प्रकार के प्रयोगों में आंतरिक पौधे-से-पौधे भिन्नता है। नीचे हमने राल्स्टोनिया संक्रमण से जुड़े लक्षणों के प्रतिनिधित्व और सांख्यिकीय विश्लेषण के लिए विभिन्न तरीकों पर विचार किया।

एक मानक दृष्टिकोण के रूप में, नियंत्रण (ईवी) और एसएलसीईएसए6-आरएनएआईसंक्रमण घटता दोनों की तुलना करने के लिए यू मान-व्हिटनी दो पूंछ वाले गैर-पैरामेट्रिक परीक्षण का उपयोग किया गया था। इस विश्लेषण के अनुसार, दोनों घटता के औसत के बीच अंतर गैर महत्वपूर्ण प्रतीत होता है(पी = 0.16)..

रोग प्रगति वक्र (AUDPC) के तहत क्षेत्र की मात्रा बताना भी संभव है, जो रोग प्रगति की कई टिप्पणियों को एक ही मूल्य में मिलाने की अनुमति देता है। AUDPC नियंत्रण संयंत्रों के लिए एक उच्च मूल्य दिखाया (ईवी; २८.७५ ± ४.७५) SlCESA6-RNAI(२१.०१ ± ४.७४) पौधों की तुलना में संक्रमण प्रक्रिया के अंत में, यह दर्शाता है कि SlCES6-खामोशपौधों नियंत्रण संयंत्रों की तुलना में राल्स्टोनिया संक्रमण के लिए अधिक प्रतिरोधी है(चित्रा 5बी)

आत्मविश्वास अंतराल (सीआई) उच्च संभावना के साथ अनुमान लगाने का एक तरीका प्रदान करता है, मूल्यों की एक श्रृंखला जिसमें किसी दिए गए चर का जनसंख्या मूल्य (या पैरामीटर) पाया जाता है। जैसा कि यह चित्रा 5सीमें दिखाया गया है, नियंत्रण के लिए 95% सीआई (ईवी) और एसएलसीईएसए6-आरएनएआई संक्रमण घटता का क्षेत्र प्रतिरोध की अधिक संभावना का अनुमान है जब SlCESA6 को खामोश कर दिया जाता है।

रोग सूचकांक मूल्यों को बाइनरी डेटा में तब्दील किया जा सकता है, "0" के अनुरूप 2 से कम रोग सूचकांक और "1"12के अनुरूप 2 से अधिक रोग सूचकांक को ध्यान में रखते हुए। यह राल्स्टोनिया टीका के बाद अस्तित्व वक्र के प्रतिनिधित्व की अनुमति देता है। यह परिवर्तन अवलोकन पर आधारित है कि, एक बार पौधे स्पष्ट लक्षण (2 के रोग सूचकांक) विकसित करना शुरू कर देते हैं, तो उन्हें "संक्रमित" माना जाता है और इस संक्रमण के परिणामस्वरूप मर जाएगा। ईवी और SlCESA6-RNAIपौधों के बीच जीवित रहने की दर में अंतर एक गेहान-Breslow-Wilcoxon सांख्यिकीय परीक्षण(पी = ०.१३)(चित्रा 5डी)के अनुसार सांख्यिकीय महत्वपूर्ण नहीं थे ।

सांख्यिकीय विश्लेषण करने के अलावा, और प्राप्त पी मूल्यों की परवाह किए बिना, विभिन्न प्रतिकृतियों(अनुपूरक चित्र ा 1)के भीतर देखी गई प्रवृत्तियों की प्रजनन क्षमता के आधार पर इन आंकड़ों की व्याख्या करना लायक है। इस धारणा को ध्यान में रखते हुए, वैज्ञानिकों की बढ़ती संख्या ने हाल ही में सख्त सांख्यिकीय थ्रेसहोल्ड (जैसे मानक पी के रूप में 0.05)16का उपयोग करने के जोखिमों पर टिप्पणी की है।

SlCESA6 की अभिव्यक्ति टीका कदम से पहले दो बेतरतीब ढंग से चयनित परिवर्तित जड़ों में विश्लेषण किया गया था, दिखा रहा है कि राल्सोनिया के लिए बढ़ाया प्रतिरोध SlCESA6 (चित्रा 5ई)की कम अभिव्यक्ति के साथ संबंधित है । इस विधि का उपयोग करके, चयन के दो दौर के बाद 35−40% की परिवर्तन दर प्राप्त की जा सकती है(चित्र5एफ)। अतिरिक्त चयन राउंड5प्रदर्शन करके इस मूल्य को बढ़ाया जा सकता है ।

Figure 1
चित्रा 1: संयंत्र की तैयारी, परिवर्तन और चयन। (A)आधी ताकत वाले एमएस (आधा) माध्यम में टमाटर के बीजों का अंकुरण। (ख)अंकुरित टमाटर के बीज 1/2 एमएस माध्यम वाली प्लेट पर पड़े फिल्टर पेपर पर रखे गए हैं । टमाटर रोपण से पहले(सी)और बाद(डी)रेडिकल और हाइपोकोटिल के नीचे काटने । (ई)बैक्टीरियल बायोमास में डुबोकर टमाटर अंकुर परिवर्तन। (एफ)आर्द्रता बनाए रखने के लिए फिल्टर पेपर से ढके टमाटर के रोपण को बदल दिया। उद्भव(जी)और हटाने(एच)नई (गैर बदल) बालों वाली जड़ों की । (I)बदल जड़ें। (जम्मू)DsRed फ्लोरेसेंस की दृश्य द्वारा बदल टमाटर बालों वाली जड़ों का चयन । लाल तीर DsRed फ्लोरेसेंस व्यक्त सकारात्मक रूपांतरित जड़ों का संकेत देते हैं। (K)बदली हुई जड़ों का विकास मुख्य जड़ों के रूप में । (एल)परिपक्व रूपांतरित जड़ों में DsRed फ्लोरेसेंस का दृश्य। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 2
चित्रा 2: एंटीबायोटिक चयन के आधार पर वैकल्पिक विधि। (क) आधा भरा वर्ग प्लेट जिसमें आधा एमएस माध्यम होता है। (ख)पहले गैर-परिवर्तित बालों वाली जड़ों को हटाने के बाद एंटीबायोटिक के साथ आधा एमएस माध्यम पर पड़े फिल्टर पेपर पर निस्तारित कट रोपण । (ग)जड़ें अतिरिक्त फिल्टर पेपर से ढकी हुई हैं । (D)टमाटर ने एंटीबायोटिक के साथ 1/2 एमएस माध्यम पर उगाई गई जड़ों को बदल दिया । (ई)pK7GWIWG2_II-रेडरूट (कनामाइसिन 50 μg/mL) के साथ बदल गई अंकुर, डीएसरेड को सकारात्मक नियंत्रण के रूप में व्यक्त करता है। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 3
चित्रा 3: टीका बर्तन के लिए बदल टमाटर का हस्तांतरण । (A)रूट-बदल टमाटर पूर्ण लथपथ टीका बर्तन में स्थानांतरित कर दिया । (ख)उच्च स्तर की आर्द्रता बनाए रखने के लिए प्लास्टिक के ढक्कन से ढके टीका बर्तनों में टमाटर को बदल दिया । (ग)दो से तीन सप्ताह पुराने जड़ में तब्दील टमाटर, टीका बर्तन के लिए हस्तांतरण के बाद, टीका लगाने के लिए तैयार है । (D)मिट्टी हटाने के बाद तीन सप्ताह पुराने टमाटर के पौधे । (ई)3 सप्ताह पुराने टमाटर के पौधों की जड़ों में DsRed फ्लोरेसेंस । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 4
चित्रा 4: राल्स्टोनिया मिट्टी भीग टीका। (A) आर सोलनसेरम जीएमआई1000 टीका के लिए आवश्यक सामग्री। (ख) आर सोलनसेरम जीएमआई1000 इनोकुलम के साथ टीका के बर्तनों में परिवर्तित टमाटर की मिट्टी भीगना । (ग)पोटिंग मिट्टी की एक परत पर रखे गए इनोक्यूलेटेड टमाटर। (डी-एच) राल्स्टोनिया रोग के लक्षण 0 (कोई लक्षण नहीं) से लेकर 4 (पूर्ण मुरझाना) तक का पैमाना। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 5
चित्रा 5: SlCESA6 silencing आर solanacearumके प्रतिरोध को बढ़ाता है । (A)आरएनएआई-मध्यस्थता एसएलसीईएसए6-खामोश(CESA6-RNAI)और खाली वेक्टर (ईवी) रूट-ट्रांसफॉर्म टमाटर के पौधों के रोग के लक्षण आर सोलासेरमके साथ टीका पर । मान आठ पौधों के साधन ± एसई के अनुरूप हैं। (ख)पैनल ए में दिखाए गए पौधों की रोग प्रगति वक्र के तहत क्षेत्र(सी)पैनल ए(डी)पैनल ए में दिखाए गए पौधों का प्रतिशत पैनल ए(ई)आरएनएआई के क्यूआरटी-पीसीआर द्वारा जीन अभिव्यक्ति विश्लेषण-मध्यस्थता एसएलसीईएसए6-खामोश(CESA6i) और जड़ ईवी-परिवर्तित टमाटर के पौधों को जड़ों में (1,2) और शूट (एस) । मान तीन तकनीकी प्रतिकृतियों के साधन ± एसई के अनुरूप हैं। (एफ)ईवी और CESA6-RNAIरूट-दो स्वतंत्र प्रयोगों के टमाटर के पौधों को बदल की परिवर्तन दर । मूल्य चयन के दो दौर के बाद, साधन ± एसई के अनुरूप हैं। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

प्राइमर नाम प्राइमर अनुक्रम (5'-3')
EFα-1-F GGTGGCGAGCATGATTTTGA
EFα-1-R CGAGCCAACCATAAAAAAAAaaaaaaaaa
qCESA6-F GATCTGGTTCGCTCTCTCGT
qCESA6-R TCCCTCCCTTTCATACCTTG
CESA6-RNAI-एफ CACCGGCGAACAAGTGGTTAG
CESA6-RNAI-R TTTGAGACTTTGGCACTGGA

तालिका 1: प्राइमर दृश्यों।

सामग्री 1 एल के लिए
बैको पेप्टोन 10 ग्राम
खमीर निकालने 1 ग्राम
कैसियानो एसिड 1 ग्राम

तालिका 2: फी (ø) मध्यम संरचना।

अनुपूरक चित्र 1: चित्रा 5A में दिखाए गए परिणाम की पुन: उत्पादकता। आर सोलनसेरमके साथ टीका पर आरएनएआई-मध्यस्थता SlCESA6-खामोश(CESA6-RNAi)और ईवी रूट-रूपांतरित टमाटर के पौधों के रोग के लक्षण । मान आठ पौधों के साधन ± एसई के अनुरूप हैं। जीन अभिव्यक्ति विश्लेषण आरएनएआई-मध्यस्थता SlCESA6-खामोश(CESA6i) और खाली वेक्टर (EV) जड़-जड़ों में टमाटर के पौधों (१,२) और शूट (एस) के क्यूआरटी-पीसीआर द्वारा किया गया था । मान तीन तकनीकी प्रतिकृतियों के साधन ± एसई के अनुरूप हैं। इस आंकड़े को डाउनलोड करने के लिए यहां क्लिक करें।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

राल्सोनिया सोलनसेरम कृषि के लिए एक महत्वपूर्ण खतरा बन गया है; हालांकि, कृषि महत्व के प्राकृतिक मेजबानों के साथ इसकी बातचीत अभी भी अन्य बैक्टीरियल रोगजनकों की तुलना में खराब समझ में आती है, विशेष रूप से फसल पौधों की प्रजातियों में। ज्यादातर मामलों में, आनुवंशिक विश्लेषण समय और आनुवंशिक रूप से मेजबान पौधों को संशोधित करने के लिए आवश्यक खर्च से रुकावट है । इस समस्या को दूर करने और टमाटर में आर सोलासेरम संक्रमण के आनुवंशिक विश्लेषण की सुविधा के लिए, हमने एग्रोबैक्टीरियम राइजोजीन-टमाटरकी जड़ों के मध्यस्थता परिवर्तन(चित्रा 1)पर आधारित एक आसान विधि विकसित की है, जिसके बाद मिट्टी से भीगने वाले टीका(चित्रा 3)हैं । परिवर्तित जड़ों को फ्लोरोसेंट रिपोर्टर (इस प्रोटोकॉल में DsRed)(चित्रा 1)का उपयोग करके चुना जाता है। इसके अतिरिक्त, हमने एंटीबायोटिक चयन के आधार पर एक वैकल्पिक विधि भी विकसित की है जो गैर-परिवर्तित हवाई भाग(चित्रा 2)को नुकसान नहीं पहुंचाती है।

परिवर्तन प्रोटोकॉल कई संशोधनों के साथ हो-प्लागारो एट अल5द्वारा वर्णित है। इस विधि की बहुमुखी प्रतिभा में तब्दील जड़ों में कई अतिरिक्त परखकी की अनुमति देता है, जैसे पौधे के शरीर विज्ञान का विश्लेषण करने के लिए, रासायनिक उपचार के लिए प्रतिक्रिया, और/

परिवर्तित पौधों को मिट्टी में स्थानांतरित करने के बाद, हमने इस संभावना पर विचार किया कि पौधे नई जड़ें विकसित कर सकते हैं जिन्हें बदल नहीं दिया जा सकता है। हमने डीरेड से ट्रांसफॉर्मेंस को मिट्टी में स्थानांतरित करने के दो सप्ताह बाद (राल्स्टोनिया टीका से पहले) में परिवर्तित पौधों की जड़ प्रणाली में फ्लोरेसेंस को देखकर इस संभावना का पता लगाया। परिणामों ने अधिकांश जड़ों(चित्रा 3डी)में लाल फ्लोरेसेंस दिखाया।

एग्रोबैक्टीरियम द्वारा टी-डीएनए हस्तांतरण को यादृच्छिक तरीके से मेजबान जीनोम में एकीकृत किया जाता है, और इसलिए, यह विधि लक्ष्य जीन के विभिन्न अभिव्यक्ति स्तर के साथ टमाटर के पौधों की विषम आबादी उत्पन्न करती है। आर सोलासेरम संक्रमण सामान्य रूप से पौधों की मौत का कारण बनता है, जो बाद में, प्रत्येक पौधे की जीन अभिव्यक्ति का विश्लेषण करने के लिए प्रयोग के बाद जड़ नमूनों के संग्रह में बाधा डालता है। प्रयोगों के दौरान लक्ष्य जीन की अभिव्यक्ति के स्तर का विश्लेषण करने के लिए, हम टीका चरण से पहले दो से तीन जड़-रूपांतरित पौधों का चयन करते हैं, जो आबादी के प्रतिनिधि नमूने के रूप में टीका लगाया जाएगा। चित्रा 5 से पता चलता है कि टमाटर के पौधों में रोग के लक्षणों की कमी टीका कदम से पहले SlCESA6 मुंह की दक्षता के साथ संबंधित है । इसलिए, और प्रोटोकॉल की सीमाओं के बावजूद, हमारे प्रतिनिधि परिणाम स्पष्ट रूप से प्रदर्शित करते हैं कि यह विधि टमाटर में आर सोलासेरम के प्रतिरोध या संवेदनशीलता में शामिल उम्मीदवार जीन का अध्ययन करने के लिए एक शक्तिशाली उपकरण है। इस लेख में दिखाए गए उदाहरण ने हमें यह निर्धारित करने की अनुमति दी कि दस्तक-डाउन SlCESA6,एक माध्यमिक सेल दीवार से संबंधित सेल्यूलोज सिंथाज़, आर सोलासेरमद्वारा संक्रमण के प्रतिरोध को बढ़ाता है, जो अरबीडोप्सिस थैलियाना8से अपने ऑर्थोलॉग AtCESA8 (At4g18780)का उपयोग करके पिछली टिप्पणियों जैसा दिखता है।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

हम सहायक चर्चाओं के लिए मर्को प्रयोगशाला के सभी प्रयोगशाला सदस्यों, सांख्यिकीय सलाह के लिए अलवारो लोपेज़-गार्सिया और इस कार्य के दौरान तकनीकी और प्रशासनिक सहायता के लिए शिनयु जियान को धन्यवाद देते हैं। हम फ्लोरेसेंस इमेजिंग के साथ सहायता के लिए पीएससी सेल बायोलॉजी कोर सुविधा का शुक्रिया अदा करते हैं इस काम को चीनी विज्ञान अकादमी (अनुदान XDB27040204), शंघाई सेंटर फॉर प्लांट स्ट्रेस बायोलॉजी (चीनी) के रणनीतिक प्राथमिकता अनुसंधान कार्यक्रम द्वारा समर्थित किया गया था विज्ञान अकादमी) और चीनी १००० प्रतिभा कार्यक्रम ।

Materials

Name Company Catalog Number Comments
90 mm square Petri-dishes
Agar powder Sigma-Aldrich
Bacto peptone BD (Becton and Dickinson)
Casamino acids Sigma-Aldrich
Filter paper
In Vivo Plant Imaging System NightShade LB 985 Berthold Technologies
Jiffy pots Jiffy Products International A.S.
Micropore tape 3M
Murashige and Skoog medium (M519) Phytotechlab
Pindstrup substrate Pindstrup Mosebrug A/S
Scalpel and blade
Sodium hypochlorite Sigma-Aldrich
Sterile clean bench
Tweezers
Wahtman paper Wahtman International Ltd. Maldstone
Yeast extract OXOID

DOWNLOAD MATERIALS LIST

References

  1. Jiang, G., et al. Bacterial Wilt in China: History, Current Status, and Future Perspectives. Frontiers in Plant Science. 11, (8), 1549 (2017).
  2. Mansfield, J., et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular plant pathology. 13, (6), 614-629 (2012).
  3. Elphinstone, J. G. The current bacterial wilt situation: a global overview. In: Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. Allen, C., Prior, P., Hayward, A. C. American Phytopathological Society Press. St Paul, MN. 9-28 (2005).
  4. Jones, J. B., Jones, J. P., Stall, R. E., Zitter, T. A. Compendium of Tomato 1094 Diseases. APS Press. St Paul, MN. (1991).
  5. Ho-Plágaro, T., Huertas, R., Tamayo-Navarrete, M. I., Ocampo, J. A., García-Garrido, J. M. An improved method for Agrobacterium rhizogenes-mediated transformation of tomato suitable for the study of arbuscular mycorrhizal symbiosis. Plant Methods. 14, 34 (2018).
  6. Wydra, K., Beri, H. Structural changes of homogalacturonan, rhamnogalacturonan I and arabiogalactan protein in xylem cell walls of tomato gentoypes in reaction to Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 68, 41-50 (2006).
  7. Wydra, K., Beri, H. Immunohistochemical changes in methyl-ester distribution of homogalacturonan and side chain composition of rhamnogalacturonan I as possible components of basal resistance in tomato inoculated with Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 70, 13-24 (2007).
  8. Hernández-Blanco, C., et al. Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell. 19, (3), 890-903 (2007).
  9. Denancé, N., et al. Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant Journal. 73, (2), 225-239 (2013).
  10. Digonnet, C., et al. Deciphering the route of Ralstonia solanacearum colonization in Arabidopsis thaliana roots during a compatible interaction: focus at the plant cell wall. Planta. 236, (5), 1419-1431 (2012).
  11. Sang, Y., et al. The Ralstonia solanacearum type III effector RipAY targets plant redox regulators to suppress immune responses. Molecular Plant Pathology. 19, (1), 129-142 (2018).
  12. Remigi, P., Anisimova, M., Guidot, A., Genin, S., Peeters, N. Functional diversification of the GALA type III effector family contributes to Ralstonia solanacearum adaptation on different plant hosts. New Phytologist. 192, 976-987 (2011).
  13. Wang, K., et al. Functional assignment to positively selected sites in the core type III effector RipG7 from Ralstonia solanacearum. Molecular Plant Pathology. 17, 553-564 (2016).
  14. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25, (4), 402-408 (2001).
  15. León-Morcillo, R. J., Martín-Rodríguez, J. A., Vierheilig, H., Ocampo, J. A., García-Garrido, J. M. Late activation of the 9-oxylipin pathway during arbuscular mycorrhiza formation in tomato and its regulation by jasmonate signalling. Journal of Experimental Botany. 63, (10), 3545-3558 (2012).
  16. Amrhein, V., Greenland, S., McShane, B. Retire statistical significance. Nature. 567, 305-307 (2019).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics