Tomato Root Transformatie gevolgd door inenting met Ralstonia Solanacearum voor eenvoudige genetische analyse van bacteriële wilt ziekte

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Hier presenteren we een veelzijdige methode voor tomatenworteltransformatie, gevolgd door inenting met Ralstonia solanacearum om eenvoudige genetische analyse uit te voeren voor de studie van bacteriële verwelkingsziekte.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Morcillo, R. J. L., Zhao, A., Tamayo-Navarrete, M. I., García-Garrido, J. M., Macho, A. P. Tomato Root Transformation Followed by Inoculation with Ralstonia Solanacearum for Straightforward Genetic Analysis of Bacterial Wilt Disease. J. Vis. Exp. (157), e60302, doi:10.3791/60302 (2020).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ralstonia solanacearum is een verwoestende bodem gedragen vasculaire ziekteverwekker die een groot scala van plantensoorten kan infecteren, waardoor een belangrijke bedreiging voor de landbouw. Echter, de Ralstonia model is aanzienlijk onderonderzocht in vergelijking met andere modellen met bacteriële plantenpathogenen, zoals Pseudomonas syringae in Arabidopsis. Onderzoek gericht op het begrijpen van de interactie tussen Ralstonia en gewasplanten is essentieel voor het ontwikkelen van duurzame oplossingen voor de bestrijding van bacteriële verwelkingziekte, maar wordt momenteel belemmerd door het ontbreken van eenvoudige experimentele testen om de verschillende componenten van de interactie in inheemse waardplanten te karakteriseren. In dit scenario hebben we een methode ontwikkeld om genetische analyse van Ralstonia-infectie van tomaat uit te voeren, een natuurlijke gastheer van Ralstonia. Deze methode is gebaseerd op Agrobacterium rhizogenes-gemedieerde transformatie van tomatenwortels, gevolgd door Ralstonia bodem-drenken van de resulterende planten, met getransformeerde wortels die de constructie van belang uitdrukken. De veelzijdigheid van de root transformatie test maakt het mogelijk het uitvoeren van ofwel gen overexpressie of gen uitschakeling bemiddeld door RNAi. Als een proof of concept, gebruikten we deze methode om aan te tonen dat RNAi-gemedieerde uitschakeling van SlCESA6 in tomatenwortels de weerstand tegen Ralstoniaverleende. Hier beschrijven we deze methode in detail, waardoor genetische benaderingen om bacteriële verwelkingziekte te begrijpen in een relatief korte tijd en met kleine eisen van apparatuur en plant groeiruimte.

Introduction

Ralstonia solanacearum, het oorzakelijk middel van bacteriële verwelkingsziekte, is een verwoestende bodem gedragen vasculaire ziekteverwekker met een wereldwijde distributie die een groot scala van plantensoorten kan infecteren, waaronder aardappel, tomaat, tabak, banaan, peper en aubergine, onder andere1,2. Opbrengstverliezen veroorzaakt door Ralstonia kunnen 80-90% van de productie in tomaat, aardappel of banaan bereiken, afhankelijk van cultivar, klimaat, bodem en andere factoren3. Echter, de Ralstonia model is aanzienlijk onderonderzocht in vergelijking met andere modellen met bacteriële plantenpathogenen, zoals Pseudomonas syringae of Xanthomonas spp. Bovendien zijn de meeste studies in plantenmicrobe interacties gericht op de modelplant Arabidopsis thaliana. Hoewel onderzoek met behulp van deze modellen grotendeels heeft bijgedragen aan ons begrip van planten-bacteriën interacties, ze niet ingaan op de huidige noodzaak om deze interacties in gewasplanten te begrijpen. Onderzoek gericht op het begrijpen van de interactie tussen Ralstonia en gewasplanten is essentieel voor het ontwikkelen van duurzame oplossingen voor de bestrijding van bacteriële verwelkingziekte, maar wordt momenteel belemmerd door het ontbreken van eenvoudige experimentele testen om de verschillende componenten van de interactie te karakteriseren. In het bijzonder, tomaat, een natuurlijke gastheer voor Ralstonia, is de tweede belangrijkste groentegewas wereldwijd en wordt beïnvloed door een overvloed aan ziekten4, met inbegrip van bacteriële verwelking ziekte. In dit werk hebben we een eenvoudige methode ontwikkeld om genetische analyse van Ralstonia-infectie van tomaat uit te voeren. Deze methode is gebaseerd op Agrobacterium rhizogenes-gemedieerde transformatie van tomatenwortels, met behulp van DsRed fluorescentie als selectiemarker5, gevolgd door Ralstonia bodem-drenken van de resulterende planten, met getransformeerde wortels die de constructie van belang uitdrukken. De veelzijdigheid van de root transformatie test maakt het mogelijk het uitvoeren van ofwel gen overexpressie of gen uitschakeling bemiddeld door RNAi.

Een mogelijke beperking van deze methode bestaat uit de restgroei van niet-getransformeerde wortels. Dit is vooral belangrijk in de gevallen waarin de gebruikte plasmid een reportergen mist dat de selectie van getransformeerde wortels mogelijk maakt. Om dit probleem op te lossen, hebben we een alternatieve methode ontwikkeld op basis van antibioticaselectie, die de groei van niet-getransformeerde wortels remt en tegelijkertijd de groei van gezonde antibioticaresistente getransformeerde wortels mogelijk maakt. Aangezien A. rhizogenes de transformatie van scheuten niet induceert, zijn ze vatbaar voor het antibioticum en moeten ze daarom gescheiden worden gehouden van het antibioticahoudende medium.

Hoewel de weerstand van planten tegen Ralstonia niet goed wordt begrepen, hebben verschillende rapporten celwandwijzigingen geassocieerd met een verbeterde weerstand tegen bacteriële verwelking6,7,8,9. Er is gesuggereerd dat deze celwandveranderingen de vasculaire ontwikkeling beïnvloeden, een essentieel aspect voor de levensstijl van Ralstonia in de plant10. Mutaties in genen die de cellulose synthases CESA4, CESA7 en CESA8 in Arabidopsis thaliana coderen, zijn aangetoond dat secundaire celwand integriteit schaden, waardoor een verbeterde weerstand tegen Ralstonia, die lijkt te zijn gekoppeld aan ABA signalering8. Daarom hebben we als proof of concept voor onze methode RNAi-gemedieerde genuitschakeling van SlCESA6 (Solyc02g072240), een secundaire celwandcellulose synthase en ortholog van AtCESA8 (At4g18780) uitgevoerd. Latere bodem-drenken inenting met Ralstonia bleek dat het uitschakelen van SlCESA6 verbeterde weerstand tegen bacteriële wilt symptomen, wat suggereert dat cel wandgemedieerde weerstand tegen Ralstonia is waarschijnlijk bewaard in tomaat, en valideren van onze methode uit te voeren genetische analyse van bacteriële wilt resistentie in wortels tomaat. Hier beschrijven we deze methode in detail, waardoor genetische benaderingen om bacteriële verwelkingziekte te begrijpen in een relatief korte tijd en met kleine eisen van apparatuur en plant groeiruimte.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

OPMERKING: Belangrijke onderdelen van deze methode zijn het hanteren van plantaardige materialen in vitro, en daarom is het belangrijk om steriele omstandigheden te behouden tijdens al deze procedures, inclusief de visualisatie van DsRed fluorescentie. Tijdens het hele transformatieproces groeien tomatenzaailingen bij 25−28 °C en 16 h/8 h licht/donker (130 μmol fotonen m-2s-1 licht). Platen zijn verzegeld met microporietape om gasuitwisseling en transpiratie te vergemakkelijken.

1. Bereiding van tomatenplanten en Agrobacterium rhizogenes

  1. Steriliseren tomatenzaden(Solanum lycopersicum cv. Moneymaker, LA2706, Tomato Genetics Resource Center, TGRC) met 5% (v/v) natriumhypochloriet gedurende 5 min. Was 4-5 keer met gedestilleerd steriel water en houd de zaden langzaam schudden in steriel water over-nacht om ontkieming te vergemakkelijken.
  2. Breng de tomatenzaden over op halfsterkte Murashige en Skoog (1/2 MS) medium zonder sacharose (2,21 g/L MS, 8% w/v agar). Houd de zaden drie dagen in het donker op 25-28 °C (figuur 1A).
    LET OP: Ongeveer 40 zaden zijn meestal nodig voor elke constructie.
  3. Autoclave 8,5 cm2 vierkante filter papier. Plaats de vierkante filterpapierin 9 cm2 vierkante petrischaaltjes met 1/2 MS-medium (leg het papier bovenop de agar) en plaats zes ontkiemde tomatenzaden op elk bord(figuur 1B). Sluit de plaat af met microporietape en bebroed de ontkiemde zaden 3−4 dagen op 25−28 °C.
  4. Kweek Agrobacterium rhizogenes MSU440 in massief LB medium (met de juiste antibiotica) bij 28 °C twee dagen voor de transformatie van de plant.
    LET OP: A. rhizogenes wordt verzorgd door Dr. Juan Antonio López Ráez, EEZ-CSIC, Granada, Spanje. In het in dit artikel beschreven experiment werden A. rhizogenes met pK7GWIWG2_II-RedRoot::CESA6 of een lege vector, als controle, gebruikt. pK7GWIWG2_II-RedRoot bevat een reporter gen, DsRed, gedreven door de Arabidopsis thaliana ubiquitine promotor (pAtUBQ10), en verleent weerstand tegen spectinomycine (50 μg/mL). Het is mogelijk om andere vectoren te gebruiken voor genoverexpressie, zoals gemeld vóór5. In dit werk werd de versterking van het specifieke fragment voor SlCESA6-uitschakeling verkregen door reverse transcription (RT) PCR met BEHULP van RNA geïsoleerd van tomaat(S. lycopersicum cv. Moneymaker) en geligat in p-ENTR/D-TOPO vector(Tabel 1). Vervolgens werd het SlCESA6-RNAi-fragment gekloond in de pK7GWIWG2_II-RedRoot binaire vector.

2. Transformatie en selectie van planten

  1. Snijd met behulp van een steriele scalpel de radicle en de bodem van de hypocotyl van tomatenzaailingen (figuur 1C,D).
  2. Oogst A. rhizogenes biomassa van het oppervlak van het LB-medium met behulp van plastic tips of een scalpelblad en dompel de gesneden tomatenzaailingen zorgvuldig in de bacteriële biomassa(figuur 1E).
  3. Na inenting met A. rhizogenes,bedek de tomatenzaailingen met een halfcirkeld filterpapier van 2 cm x 4 cm (figuur 1F), om een hoge luchtvochtigheid te behouden en overleving en nieuwe wortelontwikkeling te vergemakkelijken.
  4. Bewaar de getransformeerde tomatenzaailingen gedurende 6-7 dagen. Gebruik vervolgens een steriele scalpel om de nieuwe opkomende harige wortels te knippen(figuur 1G,H; bij deze stap worden de wortels nog niet getransformeerd) en laat de zaailingen nieuwe harige wortels produceren.
  5. Zodra de tweede generatie van nieuwe harige wortels verschijnen (Figuur 1I), verwijder het filterpapier op de top van de zaailingen, en verzegel de plaat met microporie tape weer.
    OPMERKING: Op dit punt, de aanwezigheid van de DsRed fluorescerende marker in de transformatie vector maakt het mogelijk om de transformatie-efficiëntie in de nieuwe wortels te visualiseren.
  6. Als u DsRed-fluorescentie wilt visualiseren, gebruikt u een stereomicroscoop of andere apparatuur voor installatie in vivo beeldvorming(figuur 1J). Markeer de positieve (rode fluorescentie) getransformeerde wortels en verwijder de negatieve niet-getransformeerde wortels (geen rode fluorescentie) met behulp van een steriele scalpel.
  7. Breng de zaailingen met rode fluorescentie over op een nieuwe plaat met 1/2 MS-medium, teneinde de ontwikkeling van de getransformeerde wortel als hoofdwortel (figuur 1K) te vergemakkelijken. Houd de zaailingen die geen rode fluorescentie in dezelfde plaat vertonen om het ontstaan van fluorescerende wortels(figuur 1L)in latere tijdpunten te controleren.
  8. Alternatieve methode op basis van antibioticaselectie
    1. Als alternatief voor stap 2.5, bereid half gevulde 9 cm2 vierkante platen met 1/2 MS medium met het juiste antibioticum. Hellen de platen ongeveer 5° tijdens het voorbereidingsproces om een lege ruimte te genereren zonder medium(figuur 2A),waardoor de scheuten kunnen groeien om contact met het antibioticum te vermijden.
    2. Als alternatief voor stap 2.6 is na het snijden van de eerste niet-getransformeerde harige wortels ontstaan (stap 2.4), de zaailingen zonder wortels over te brengen naar de halfgevulde platen met behulp van filterpapier met de juiste grootte(figuur 2B).
      OPMERKING: Als positieve controle wordt aanbevolen om verschillende zaailingen te transformeren met een plasmid met dezelfde antibioticaresistentie en een reportergen (in dit protocol pK7GWIWG2_II-RedRoot; kanamycine 50 μg/mL).
    3. Als alternatief voor stap 2.7, laat de zaailingen ontwikkelen van nieuwe harige wortels en snijd die wortels die niet in direct contact met het oppervlak van het filter sandwich papier, omdat deze wortels kunnen voorkomen dat antibiotica selectie.
      OPMERKING: Als gevolg van het antibioticum effect, wortelontwikkeling kan langzamer zijn dan in platen zonder antibiotica. Nieuwe getransformeerde harige wortels verschijnen binnen 14-18 dagen na het overbrengen van de zaailingen zonder wortels naar de halfgevulde platen (stap 2.8.2) (figuur 2C-E).
  9. Bedek de zaailingen met een halfcirkels filterpapier van 2 cm x 4 cm, sluit de plaat af en bebroed de zaailingen om ze nieuwe harige wortels te laten ontwikkelen.
    OPMERKING: Het is niet nodig om de A. rhizogenes met antibiotica te elimineren. Het filterpapier bovenop het MS-medium en het gebrek aan sacharose remmen de verspreiding van de A. rhizogenes op de plaat5.
  10. Vijf tot zeven dagen na de eerste rootselectie herhaalt u het selectieproces om nieuwe getransformeerde wortels te selecteren en niet-getransformeerde wortels te verwijderen. Breng de zaailingen met getransformeerde wortels over op een nieuwe plaat met 1/2 MS-medium.

3. Overdracht naar inentingspotten

  1. Bereid inentingspotten waar het oppervlak van de wortels zal worden blootgesteld aan het bacteriële inentingsvat: week de inenting potten met water, giet overtollig water, en leg ze in een plastic plantplaat. Breng de geselecteerde zaailingen met getransformeerde wortels over in inentingspotten met een pincet(figuur 3A).
  2. Bedek de lade met plastic folie of een transparant deksel en houd ze op 25−28 °C en 65% vochtigheid (16 h/8 h licht/donker; 130 μmol fotonen m-2s-1 licht), om een hoog vochtigheidsniveau figuur 3Bte behouden ). Verwijder het deksel na vijf of zes dagen.
    OPMERKING: De getransformeerde tomatenplanten zijn twee tot drie weken na de overdracht van de tomatenplant klaar voor inenting(figuur 3C). Tijdens de groei op de bodem kunnen tomatenplanten nieuwe wortels produceren die niet worden getransformeerd. Om de omvang van dit fenomeen te bepalen, werd rode fluorescentie gevisualiseerd in wortels van 3 weken oude getransformeerde tomatenplanten. De meeste wortels (80%-100%) rode fluorescentie vertoonde, wat aangeeft dat ze inderdaad zijn getransformeerd (figuur 3D,E).

4. Bodemdrenken inenting

  1. Laat R. solancearum (stam GMI1000 in dit protocol) groeien in phi vloeibaar medium(tabel 211) in een orbitale shaker (200 rpm) bij 28 °C tot de stationaire fase.
  2. Bepaal bacteriële getallen door de optische dichtheid van de bacteriële cultuur op 600 nm (OD600)te meten. Verdun de bacteriële cultuur met water tot een OD600 van 0,1 (in omstandigheden die hier worden gebruikt, komt dit overeen met ongeveer 108 kolonievormende eenheden [CFU]/mL).
  3. Plaats 16-20 inentingspotten met getransformeerde tomatenplanten in een inentingslade (29 cm x 20 cm; Figuur 4A).
  4. Giet 300 mL (~15 mL per plant) van bacterieel intculum (OD600 van 0,1) in de lade met de inentingspotten. Laat ze 20 min(figuur 4B)weken in het inoculum.
  5. Bereid een nieuwe lade met een laag potgrond. Verplaats de ingeënte potten in de nieuwe lade (figuur 4C) en plaats de trays in een groeikamer met een luchtvochtigheid van 75%, 26−28 °C en een fotoperiode van 12 uur licht en 12 uur duisternis (130 μmol fotons m-2s-1 licht).

5. Bepaling van infectieparameters en statistische analyse

  1. Score ziekte symptomen zoals eerder beschreven12,13, met behulp van een schaal variërend van 0 (geen symptomen) tot 4 (volledige verwelking) (Figuur 4D-H), elke dag na Ralstonia inenting gedurende twee weken.
    OPMERKING: De ziekteindexgegevens worden in de loop van de tijd verzameld van dezelfde experimentele eenheid (elke plant).

6. Analyse van genexpressie

OPMERKING: De expressie van het transgene of het uitschakelen van het doelgen kan worden bepaald door RT-PCR of door kwantitatieve RT-PCR (qRT-PCR).

  1. Verzamel monsters en haal RNA uit een representatief deel van het getransformeerde wortelstelsel (om het effect op het doelgen te evalueren) en bladeren (als interne controle).
  2. Synthetiseren cDNA met behulp van 1 μg totaal DNase-behandeld RNA.
  3. Analyseer genexpressie van de doelgenen door qRT-PCR. Bereken de relatieve transcriptieniveaus met behulp van de 2-ΔΔCT-methode 14, met SlEFα-1 als huishoudingsgen15.
    OPMERKING: Primer-reeksen zijn opgenomen in tabel 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figuur 5 toont de ontwikkeling van ziektesymptomen van tomatenplanten met wortels getransformeerd met een lege vector (EV), en planten met wortels getransformeerd met een RNAi-constructie gericht op SlCESA6 (Solyc02g072240). De ziekteindexgegevens (figuur 5A) worden verzameld van dezelfde experimentele eenheid (elke installatie) in de loop van de tijd volgens een willekeurige schaal van 0 tot 4, en volgen geen Gaussische distributie, waardoor het gebruik van standaardtests voor parametrische gegevens wordt uitgesloten. Bovendien is er een intrinsieke plant-to-plant variatie in dit soort experimenten, als gevolg van de kolonisatie en infectie dynamiek. Hieronder hebben we verschillende methoden overwogen voor de representatie en statistische analyse van symptomen die verband houden met ralstonia-infectie.

Als een standaard aanpak, een U Mann-Whitney twee-tailed niet-parametrische test om zowel controle (EV) en SlCESA6-RNAi infectie bochten te vergelijken werd gebruikt. Volgens deze analyse lijkt het verschil tussen de mediaanen van beide curven niet significant(P = 0,16).

Het is ook mogelijk om het gebied onder de ziektevoortgangscurve (AUDPC) te kwantificeren, waardoor meerdere waarnemingen van ziektevooruitgang in één waarde kunnen worden gecombineerd. AUDPC toonde een hogere waarde voor controle-installaties (EV; 28,75 ± 4,75) in vergelijking met SlCESA6-RNAi(21,01 ± 4,74) planten aan het einde van het infectieproces, wat aangeeft dat SlCES6-stilstaandeplanten beter bestand zijn tegen Infectie van Ralstonia dan controle-installaties (figuur 5B).

Betrouwbaarheidsintervallen (CI) bieden een manier om met grote waarschijnlijkheid een bereik van waarden te schatten waarin de populatiewaarde (of parameter) van een bepaalde variabele wordt gevonden. Zoals blijkt uit figuur 5C, schatten het gebied van 95% CI for control (EV) en SlCESA6-RNAi-infectiekrommen een hogere kans op weerstand wanneer SlCESA6 het zwijgen wordt opgelegd.

Ziekteindexwaarden kunnen worden omgezet in binaire gegevens, rekening houdend met een ziekte-index lager dan 2 die overeenkomen met "0", en een ziekte-index gelijk of hoger dan 2 die overeenkomt met "1"12. Dit maakt de weergave van een overlevingscurve na Ralstonia inenting mogelijk. Deze transformatie is gebaseerd op de observatie dat, zodra de planten beginnen met het ontwikkelen van duidelijke symptomen (ziekte-index van 2), ze worden beschouwd als "besmet" en zal sterven als gevolg van deze infectie. De verschillen in overlevingskans tussen EV- en SlCESA6-RNAi-fabriekenwaren statistisch niet significant volgens een Statistische Test van Gehan-Breslow-Wilcoxon (P = 0,13) (figuur 5D).

Naast het uitvoeren van statistische analyses, P en ongeacht de verkregen P-waarden, is het de moeite waard om deze gegevens te interpreteren op basis van de reproduceerbaarheid van de waargenomen tendensen binnen verschillende repliceringen (Aanvullend figuur 1). In overeenstemming met dit begrip hebben een toenemend aantal wetenschappers onlangs opmerkingen gemaakt over de risico's van het overgebruiken van strikte statistische drempels (zoals de norm P ≤ 0,05)16.

De expressie van SlCESA6 werd geanalyseerd in twee willekeurig geselecteerde getransformeerde wortels vóór de inentingsstap, waaruit blijkt dat de verbeterde weerstand tegen Ralstonia correleert met de verminderde expressie van SlCESA6 (figuur 5E). Met behulp van deze methode kan een transformatiesnelheid van 35−40% na twee selectierondes worden verkregen (figuur 5F). Deze waarde kan worden verhoogd door extra selectierondes5uit te voeren.

Figure 1
Figuur 1: Plantvoorbereiding, transformatie en selectie. (A) Ontkieming van tomatenzaden in halfsterkte MS (1/2) medium. (B) Ontkiemde tomatenzaden die op filterpapier liggen dat op een plaat ligt die 1/2 MS-medium bevat. Tomatenzaailingen voor (C) en na (D) snijden van de radicle en de bodem van de hypocotyl. (E) Tomatenzaailing transformatie door dompelen in bacteriële biomassa. (F) Getransformeerde tomatenzaailingen bedekt met filterpapier om de luchtvochtigheid te behouden. Opkomst (G) en verwijdering (H) van nieuwe (niet-getransformeerde) harige wortels. (I) Getransformeerde wortels. (J) Selectie van getransformeerde tomatenharige wortels door visualisatie van DsRed fluorescentie. Rode pijlen geven positieve getransformeerde wortels aan die DsRed fluorescentie uitdrukken. (K) Ontwikkeling van de getransformeerde wortels als de belangrijkste wortels. (L) Visualisatie van DsRed fluorescentie in volwassen getransformeerde wortels. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 2
Figuur 2: Alternatieve methode op basis van antibioticaselectie. (A) Half gevulde vierkante plaat met 1/2 MS medium. (B) Snijd zaailingen die op filterpapier liggen dat op 1/2 MS-medium met antibioticum ligt, na verwijdering van de eerste niet-getransformeerde harige wortels. (C) Wortels bedekt met extra filterpapier. (D) Tomaat getransformeerde wortels geteeld op 1/2 MS medium met antibioticum. (E) Zaailingen getransformeerd met pK7GWIWG2_II-RedRoot (kanamycine 50 μg/mL), uitdrukken DsRed, als positieve controle. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 3
Figuur 3: Overdracht van getransformeerde tomaat naar inentingspotten. (A) Wortel-getransformeerde tomaten overgebracht naar volledig geweekte inenting potten. (B) Getransformeerde tomaten in inentingspotten bedekt met een plastic deksel om een hoge luchtvochtigheid te handhaven. (C) Twee tot drie weken oude wortel-getransformeerde tomaten, na overdracht aan inenting potten, klaar om te worden ingeënt. (D) Drie weken oude tomatenplanten na het verwijderen van de bodem. (E) DsRed fluorescentie in wortels van 3 weken oude getransformeerde tomatenplanten. Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 4
Figuur 4: Ralstonia bodem-drenken inenting. (A) Materialen die nodig zijn voor R. solanacearum GMI1000 inenting. (B) Bodemdrenken van getransformeerde tomaten in inentingspotten met R. solanacearum GMI1000 inoculum. (C) Ingeënte tomaten geplaatst op een laag potgrond. (D-H) Ralstonia symptomen schaal variërend van 0 (geen symptomen) tot 4 (volledige verwelking). Klik hier om een grotere versie van dit cijfer te bekijken.

Figure 5
Figuur 5: SlCESA6 silencing verhoogt de weerstand tegen R. solanacearum. (A) Ziekte symptomen van RNAi-gemedieerde SlCESA6-zwijgend (CESA6-RNAi) en lege vector (EV) wortel-getransformeerde tomatenplanten na inenting met R. solanacearum. De waarden komen overeen met de middelen ± SE van acht planten. (B) Gebied onder de ziekte voortgangscurve van planten weergegeven in paneel A. (C) 95% vertrouwen Interval van planten weergegeven in paneel A. (D) Procent van de overlevende planten weergegeven in paneel A. (E) Gen expressie analyse door qRT-PCR van RNAi-gemedieerde SlCESA6-silenced (CESA6i) en EV wortel-getransformeerde tomatenplanten in wortels (1,2) en shoot (S). Waarden komen overeen met de middelen ± SE van drie technische replicaties. (F) Transformatiesnelheid van EV en CESA6-RNAi wortel-getransformeerde tomatenplanten van twee onafhankelijke experimenten. Waarden komen overeen met de middelen ± SE, na twee selectierondes. Klik hier om een grotere versie van dit cijfer te bekijken.

Primer naam Primer sequentie (5'-3')
EFα-1-F GGTGGCGAGCATGATTTTGA
EFα-1-R CGAGCCAACCATGGAAAACAA
qCESA6-F GATCTGGTTCGCTTCTCTCGT
qCESA6-R TCCCTCCCTTTCATACCTTG
CESA6-RNAi-F CACCGGCGAACAAGTGGGGTTAG
CESA6-RNAi-R TTTGAGACTTTGGCACTGGA

Tabel 1: Primer sequenties.

Ingrediënten Voor 1 L
Bacto peptone Bacto peptone 10 g
Gistextract 1 g
Casamino zuren 1 g

Tabel 2: Phi (Ø) medium compositie.

Aanvullende figuur 1: Reproduceerbaarheid van het resultaat in figuur 5A. Ziekte symptomen van RNAi-gemedieerde SlCESA6-zwijgend (CESA6-RNAi) en EV wortel-getransformeerde tomatenplanten na inenting met R. solanacearum. De waarden komen overeen met de middelen ± SE van acht planten. Genexpressie analyse werd uitgevoerd door qRT-PCR van RNAi-gemedieerde SlCESA6-silenced (CESA6i) en Empty Vector (EV) root-getransformeerde tomatenplanten in wortels (1,2) en shoot (S). Waarden komen overeen met de middelen ± SE van drie technische replicaties. Klik hier om dit cijfer te downloaden.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ralstonia solanacearum vormt een belangrijke bedreiging voor de landbouw; echter, de interactie met natuurlijke gastheren van agrarisch belang is nog steeds slecht begrepen in vergelijking met andere bacteriële pathogenen, vooral in gewasplantensoorten. In de meeste gevallen wordt genetische analyse belemmerd door de tijd en kosten die nodig zijn om waardplanten genetisch te modificeren. Om dit probleem aan te pakken en de genetische analyse van R. solanacearum-infectie bij tomaat te vergemakkelijken, hebben we een eenvoudige methode ontwikkeld op basis van Agrobacterium rhizogenes-gemedieerde transformatie van tomatenwortels(figuur 1),gevolgd door bodemdrenken(figuur 3). De getransformeerde wortels worden geselecteerd met behulp van een fluorescerende reporter (DsRed in dit protocol) (Figuur 1). Daarnaast hebben we ook een alternatieve methode ontwikkeld op basis van antibioticaselectie die het niet-getransformeerde antennedeel(figuur 2)niet beschadigt.

Het transformatieprotocol is gebaseerd op dat beschreven door Ho-Plágaro et al.5, met verschillende wijzigingen. De veelzijdigheid van deze methode maakt meerdere aanvullende testen in getransformeerde wortels mogelijk, zoals die om de fysiologie van planten te analyseren, respons op chemische behandelingen en/of reacties op verschillende biotische en abiotische spanningen.

Na het overbrengen van de getransformeerde planten naar de bodem, hebben we de mogelijkheid overwogen dat planten nieuwe wortels kunnen ontwikkelen die niet kunnen worden getransformeerd. We onderzochten deze mogelijkheid door het observeren van de fluorescentie van DsRed in het wortelstelsel van getransformeerde planten twee weken na de overdracht ervan naar de bodem (vóór Ralstonia inenting). De resultaten toonden rode fluorescentie in de meerderheid van de wortels (figuur 3D).

T-DNA-overdracht door Agrobacterium wordt op een willekeurige manier geïntegreerd in het gastheergenoom, en daarom genereert deze methode een heterogene populatie tomatenplanten met een verschillend expressieniveau van het doelgen. R. solanacearum infectie veroorzaakt normaal gesproken de dood van de planten, die vervolgens belemmert de verzameling van wortelmonsters na het experiment om de genexpressie van elke plant te analyseren. Om het expressieniveau van het doelgen tijdens de experimenten te analyseren, selecteren we twee tot drie wortelgetransformeerde planten vóór de inentingsstap, als representatieve steekproef van de populatie die zal worden ingeënt. Figuur 5 toont aan dat de vermindering van ziektesymptomen bij tomatenplanten correleert met de efficiëntie van SlCESA6-uitschakeling vóór de inentingsstap. Daarom, en ondanks de beperkingen van het protocol, tonen onze representatieve resultaten duidelijk aan dat deze methode een krachtig hulpmiddel is om kandidaat-genen te bestuderen die betrokken zijn bij resistentie of gevoeligheid voor R. solanacearum in tomaat. Het voorbeeld in dit artikel stelde ons in staat om te bepalen dat het neerhalen van SlCESA6, een secundaire celwand-gerelateerde cellulose synthase, verbetert de weerstand tegen infectie door R. solanacearum, lijkt op eerdere waarnemingen met behulp van haar ortholog AtCESA8 (At4g18780) van Arabidopsis thaliana8.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Wij danken alle lableden van het Macho laboratorium voor nuttige discussies, Alvaro López-García voor statistisch advies, en Xinyu Jian voor technische en administratieve bijstand tijdens dit werk. Wij danken de PSC Cell Biology kernfaciliteit voor hulp bij fluorescentie beeldvorming Dit werk werd ondersteund door het Strategic Priority Research Program van de Chinese Academie van Wetenschappen (subsidie XDB27040204), het Shanghai Center for Plant Stress Biology (Chinees Academy of Sciences) en het Chinese 1000 Talents programma.

Materials

Name Company Catalog Number Comments
90 mm square Petri-dishes
Agar powder Sigma-Aldrich
Bacto peptone BD (Becton and Dickinson)
Casamino acids Sigma-Aldrich
Filter paper
In Vivo Plant Imaging System NightShade LB 985 Berthold Technologies
Jiffy pots Jiffy Products International A.S.
Micropore tape 3M
Murashige and Skoog medium (M519) Phytotechlab
Pindstrup substrate Pindstrup Mosebrug A/S
Scalpel and blade
Sodium hypochlorite Sigma-Aldrich
Sterile clean bench
Tweezers
Wahtman paper Wahtman International Ltd. Maldstone
Yeast extract OXOID

DOWNLOAD MATERIALS LIST

References

  1. Jiang, G., et al. Bacterial Wilt in China: History, Current Status, and Future Perspectives. Frontiers in Plant Science. 11, (8), 1549 (2017).
  2. Mansfield, J., et al. Top 10 plant pathogenic bacteria in molecular plant pathology. Molecular plant pathology. 13, (6), 614-629 (2012).
  3. Elphinstone, J. G. The current bacterial wilt situation: a global overview. In: Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. Allen, C., Prior, P., Hayward, A. C. American Phytopathological Society Press. St Paul, MN. 9-28 (2005).
  4. Jones, J. B., Jones, J. P., Stall, R. E., Zitter, T. A. Compendium of Tomato 1094 Diseases. APS Press. St Paul, MN. (1991).
  5. Ho-Plágaro, T., Huertas, R., Tamayo-Navarrete, M. I., Ocampo, J. A., García-Garrido, J. M. An improved method for Agrobacterium rhizogenes-mediated transformation of tomato suitable for the study of arbuscular mycorrhizal symbiosis. Plant Methods. 14, 34 (2018).
  6. Wydra, K., Beri, H. Structural changes of homogalacturonan, rhamnogalacturonan I and arabiogalactan protein in xylem cell walls of tomato gentoypes in reaction to Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 68, 41-50 (2006).
  7. Wydra, K., Beri, H. Immunohistochemical changes in methyl-ester distribution of homogalacturonan and side chain composition of rhamnogalacturonan I as possible components of basal resistance in tomato inoculated with Ralstonia solanacearum. Physiological and Molecular Plant Pathology. 70, 13-24 (2007).
  8. Hernández-Blanco, C., et al. Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance. Plant Cell. 19, (3), 890-903 (2007).
  9. Denancé, N., et al. Arabidopsis wat1 (walls are thin1)-mediated resistance to the bacterial vascular pathogen, Ralstonia solanacearum, is accompanied by cross-regulation of salicylic acid and tryptophan metabolism. Plant Journal. 73, (2), 225-239 (2013).
  10. Digonnet, C., et al. Deciphering the route of Ralstonia solanacearum colonization in Arabidopsis thaliana roots during a compatible interaction: focus at the plant cell wall. Planta. 236, (5), 1419-1431 (2012).
  11. Sang, Y., et al. The Ralstonia solanacearum type III effector RipAY targets plant redox regulators to suppress immune responses. Molecular Plant Pathology. 19, (1), 129-142 (2018).
  12. Remigi, P., Anisimova, M., Guidot, A., Genin, S., Peeters, N. Functional diversification of the GALA type III effector family contributes to Ralstonia solanacearum adaptation on different plant hosts. New Phytologist. 192, 976-987 (2011).
  13. Wang, K., et al. Functional assignment to positively selected sites in the core type III effector RipG7 from Ralstonia solanacearum. Molecular Plant Pathology. 17, 553-564 (2016).
  14. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods. 25, (4), 402-408 (2001).
  15. León-Morcillo, R. J., Martín-Rodríguez, J. A., Vierheilig, H., Ocampo, J. A., García-Garrido, J. M. Late activation of the 9-oxylipin pathway during arbuscular mycorrhiza formation in tomato and its regulation by jasmonate signalling. Journal of Experimental Botany. 63, (10), 3545-3558 (2012).
  16. Amrhein, V., Greenland, S., McShane, B. Retire statistical significance. Nature. 567, 305-307 (2019).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics