डीप सिंगल-सेल आरएनए अनुक्रमण के लिए एक वयस्क माउस ब्रेन गोलार्द्ध से क्षेत्र-विशिष्ट माइक्रोग्लिया का अलगाव

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

हम एक वयस्क माउस मस्तिष्क गोलार्द्ध के विभिन्न विच्छेदित क्षेत्रों से माइक्रोग्लिया के अलगाव के लिए एक प्रोटोकॉल प्रदान करते हैं, जिसके बाद पूर्ण लंबाई वाले ट्रांसक्रिप्टोम के डीप सिंगल-सेल आरएनए अनुक्रमण के लिए अर्ध-स्वचालित पुस्तकालय तैयारी की जाती है। यह विधि स्वास्थ्य और रोग में माइक्रोग्लिया की कार्यात्मक विषमता को स्पष्ट करने में मदद करेगी।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Zhou, L., Li, Q. Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing. J. Vis. Exp. (154), e60347, doi:10.3791/60347 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

केंद्रीय तंत्रिका तंत्र में निवासी मैक्रोफेज के रूप में, माइक्रोग्लिया सक्रिय रूप से मस्तिष्क के विकास और होमोस्टोसिस को नियंत्रित करते हैं, और उनके रोग मानव रोगों को चला सकते हैं। होमोस्टैटिक माइक्रोग्लिया के आणविक हस्ताक्षरों के साथ-साथ पर्यावरणीय उत्तेजनाओं के जवाब में उनके जीन अभिव्यक्ति के परिवर्तन को उजागर करने के लिए काफी प्रगति की गई है । एकल-कोशिका जीनोमिक पद्धतियों के आगमन और परिपक्वता के साथ, यह तेजी से मान्यता प्राप्त है कि विषम माइक्रोग्लिया विभिन्न विकासात्मक और रोग स्थितियों में खेलने वाली विविध भूमिकाओं को रेखांकित कर सकता है। इस तरह की विषमता के आगे विच्छेदन ब्याज के एक दिए गए क्षेत्र से माइक्रोग्लिया के कुशल अलगाव के माध्यम से प्राप्त किया जा सकता है, जिसके बाद व्यक्तिगत कोशिकाओं की संवेदनशील प्रोफाइलिंग की जा सकती है । यहां, हम एक वयस्क माउस मस्तिष्क गोलार्द्ध में विभिन्न मस्तिष्क क्षेत्रों से माइक्रोग्लिया के तेजी से अलगाव के लिए एक विस्तृत प्रोटोकॉल प्रदान करते हैं। हम यह भी प्रदर्शित करते हैं कि प्लेट-आधारित डीप सिंगल-सेल आरएनए अनुक्रमण के लिए इन हल माइक्रोग्लिया का उपयोग कैसे करें। हम अन्य परिदृश्यों के लिए इस विधि की अनुकूलनशीलता पर चर्चा करते हैं और बड़े पैमाने पर अध्ययनों को समायोजित करने के लिए प्रणाली में सुधार के लिए दिशानिर्देश प्रदान करते हैं।

Introduction

माइक्रोग्लिया, सभी तंत्रिका कोशिकाओं का 5%−10% का प्रतिनिधित्व करते हैं, केंद्रीय तंत्रिका तंत्र (सीएनएस)1में फैले निवासी मैक्रोफेज हैं। रक्त-मस्तिष्क बाधा के पीछे संरक्षित, स्वस्थ वयस्क मस्तिष्क में विशिष्ट माइक्रोग्लिया में कई अच्छी प्रक्रियाएं होती हैं जो पैरान्चिमा में न्यूरॉन्स और अन्य ग्लियल कोशिकाओं के साथ बातचीत करने के लिए तेजी से विस्तार और वापस ले जाती हैं। माइक्रोग्लिया विशिष्ट विकासात्मक चरणों के दौरान या चोट और रोग1,2,3,4में प्रतिरक्षा चुनौतियों से जुड़े अमोएब्इड आकृति विज्ञान को भी अपना सकता है । हाल ही में रोमांचक खोजों ने स्पष्ट रूप से दिखा दिया है कि माइक्रोग्लिया मस्तिष्क-व्युत्पन्न या रोग संकेतों के लिए निष्क्रिय पास खड़े नहीं हैं, लेकिन मस्तिष्क के विकास और होमोस्टोसिस को नियंत्रित करने में निर्णायक भूमिका निभाते हैं, उदाहरण के लिए, न्यूरोनल अस्तित्व का समर्थन करके, अपरिपक्व सिनेप्स की छंटाई, ओलिगोडेनरोसाइट वंश कोशिकाओं के भेदभाव के साथ-साथ एंजियोजेनेसिस1को बढ़ावा देना। चूंकि माइक्रोग्लिया के अधिक कार्य स्पष्ट होते हैं, उत्तेजना को मानव आनुवंशिकी अध्ययनों से अधिक ईंधन दिया जाता है, जिससे पता चला है कि ट्रेम2 जैसे कई न्यूरोडीजेनेरेटिव रोग जोखिम वाले जीन मुख्य रूप से या विशेष रूप से माइक्रोग्लिया5,6,7द्वारा व्यक्त किए जाते हैं। विकास और प्रशंसनीय रोग ड्राइविंग भूमिकाओं में उनके महत्व को देखते हुए, हाल ही में माइक्रोग्लजीन विनियमन और न्यूरोडीजेनेरेटिव रोगों के लिए नए चिकित्सीय लक्ष्य खोजने की आशा में समारोह की हमारी समझ की दिशा में जबरदस्त प्रयास किया गया है1,8

आरएनए अनुक्रमण (आरएनए-सीक्यू) सेल प्रकार-विशिष्ट जीन अभिव्यक्ति के निष्पक्ष लक्षण वर्णन की अनुमति देता है, जो बदले में वैज्ञानिकों को घने सेलुलर नेटवर्क7में जीन कार्यों की जांच करने के लिए मार्गदर्शन करता है। आरएनए-सेक ज्यादातर थोक नमूनों पर किया गया था, जिससे होमोस्टैटिक माइक्रोग्लियल जीन हस्ताक्षर की खोज हुई जो उन्हें अन्य तंत्रिका और प्रतिरक्षा कोशिकाओं9से अलग करती है। हालांकि, इस तरह के एक दृष्टिकोण माइक्रोग्लिया के बीच आणविक और कार्यात्मक मतभेदों को नजरअंदाज कर सकता है, विशेष रूप से उन क्षणिक विकास में मौजूद है, या उंर बढ़ने और रोग के साथ जुड़े । दरअसल, एकल सेल आरएनए-सीक्यू (स्क्आरएनए-सीक्यू) संवेदनशीलता और संकल्प प्रदान करता है जिसने विभिन्न संदर्भों2,3,10में माइक्रोग्लिया की पहले से कम सराहना की गई विषमता का खुलासा करके क्षेत्र में क्रांति ला दी है। इसके अलावा, सीएनएस-सर्कुलेशन इंटरफेस में अन्य समान प्रतिरक्षा कोशिकाओं की उपस्थिति के कारण, स्क्आरएनए-सीक्यू इन संबंधित कोशिकाओं को अलग करने और कार्यात्मक रूप से कम पूर्व ज्ञान2,11के साथ अलग और कार्यात्मक रूप से विच्छेदन करने के लिए नए उपकरणों के डिजाइन में सहायता करने वाली जानकारी प्रदान करता है।

स्क्आरएनए-सीक्यू प्लेटफार्मों की एक विविध सरणी का आविष्कार किया गया है, प्रत्येक कुछ अनुप्रयोगों के लिए उपयुक्त12। सामान्य तौर पर, 10x जीनोमिक्स जैसे बूंद-आधारित तरीके, प्रत्येक रन में अनुक्रमित हजारों कोशिकाओं के साथ थ्रूपुट में अधिक होते हैं, और वे इनपुट के लिए कम चयनात्मक होते हैं जिसमें मिश्रित कोशिका आबादी हो सकती है जिसमें व्यापक वर्गीकरण की आवश्यकता होती है। प्लेट-आधारित विधियां उच्च संवेदनशीलता प्रदान करती हैं और गहराई13,14पढ़ती हैं, आमतौर पर सूक्ष्म मतभेदों या दुर्लभ प्रतिलिपियों को प्रकट करने के लिए सेल छंटाई से विशिष्ट आबादी को लक्षित करती हैं। सभी सीएनएस सेल प्रकारों के बीच माइक्रोग्लियल कोशिकाओं, विशेष रूप से उन विकास-या रोग से जुड़ी उपआबादी के छोटे प्रतिशत को देखते हुए, अक्सर माइक्रोग्लिया को ब्याज के एक विशिष्ट क्षेत्र से अलग करना और उनकी विषमता को समझने के लिए गहरी और पूर्ण लंबाई की प्रतिलेखन जानकारी प्राप्त करना वांछनीय होता है।

यहां, हम एक गोलार्द्ध से विच्छेदित विभिन्न माउस मस्तिष्क क्षेत्रों से माइक्रोग्लिया को अलग करने के तरीके के बारे में विवरण प्रदान करते हैं, जिनका उपयोग अर्ध-स्वचालित प्लेट-आधारित पुस्तकालय तैयार करने की प्रक्रिया के बाद एकल-कोशिका (या थोक) आरएनए-सीक्यू के लिए किया जाता है। इसके बाद दूसरे गोलार्द्ध का इस्तेमाल हिस्टोलॉजिकल सत्यापन के लिए किया जा सकता है । एक पहले प्रकाशित विधि9से सुव्यवस्थित, इस अलगाव प्रोटोकॉल शुरू सामग्री की छोटी राशि से उपज को अधिकतम करने के लिए करना है, और इस बीच एंडोजेनस माइक्रोग्लियल जीन अभिव्यक्ति प्रोफाइल बनाए रखने । हम 96-अच्छी प्लेटों में माइक्रोग्लिया (या अन्य संबंधित प्रतिरक्षा कोशिकाओं) को समृद्ध करने के लिए फ्लोरेसेंस-एक्टिवेटेड सेल छंटाई (एफएसीएस) का उपयोग करते हैं और थ्रूपुट को बढ़ाने के लिए पुस्तकालय तैयार करने के लिए अभिकर्मकों की मात्रा को छोटा करते हैं। हम इस संवेदनशील स्क्आरएनए-सीक्यू प्लेटफॉर्म को हाइलाइट करते हैं, हालांकि अन्य प्लेट-आधारित रणनीतियों को लागू किया जा सकता है। इस विधि को आसानी से अन्य विच्छेदित ऊतकों, जैसे चोट या रोग फोसी से माइक्रोग्लिया को अलग करने के लिए अनुकूलित किया जा सकता है, और माउस की उम्र लगभग किसी भी प्रसवोत्तर चरणों में भिन्न हो सकती है। एकल सेल ट्रांसक्रिप्टोमिक्स अध्ययन के लिए क्षेत्रीय माइक्रोग्लिया के कुशल अलगाव से स्वास्थ्य और रोग में उनके कार्यों की बेहतर समझ में आसानी होगी ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

कृंतक ों को शामिल करने वाली सभी प्रक्रियाएं स्टैनफोर्ड विश्वविद्यालय के दिशा-निर्देशों के अनुरूप हैं, जो राष्ट्रीय और राज्य के कानूनों और नीतियों का पालन करते हैं । सभी पशु प्रक्रियाओं को प्रयोगशाला पशु देखभाल पर स्टैनफोर्ड विश्वविद्यालय के प्रशासनिक पैनल द्वारा अनुमोदित किया गया ।

नोट: सभी समाधान और बफर रचनाएं सामग्री की तालिकामें प्रदान की जाती हैं ।

1. सेल अलगाव के दिन तैयारी

  1. निम्नलिखित अभिकर्मकों को तैयार करें और उन्हें बर्फ पर ठंडा करें: मध्यम ए (50 एमएल), चुंबकीय-सक्रिय सेल छंटाई (एमसीएस) बफर (30 एमएल), एफएसीएस बफर (25 एमएल), फॉस्फेट-बफर्ड नमकीन (पीबीएस; 30 एमएल), DNase (320 μL), और RNase अवरोधक (30 μL)।
    नोट: यहां प्रदान की गई मात्रा एक ही माउस मस्तिष्क गोलार्द्ध के 4 मस्तिष्क क्षेत्रों (जैसे, कॉर्टेक्स, सेरिबैलम, हिप्पोकैम्पस और स्ट्रिटम) से माइक्रोग्लिया को अलग करने के लिए पर्याप्त हैं। यदि अधिक ऊतकों का उपयोग किया जाता है तो स्केल करें।
  2. बर्फ पर चार साफ 2 mounce समरूपता रखें और प्रत्येक Dounce समरूपमें DNase (१२,५०० इकाइयों/mL) के 80 μL और RNase अवरोधक के 5 μL के साथ मध्यम ए के 2 mL जोड़ें । पिस्टन को 15 मिलील ट्यूबमें ठंडा करें।
  3. ऊतक संग्रह के लिए मस्तिष्क क्षेत्रों के साथ चार 6 सेमी पेट्री व्यंजन लेबल और बर्फ पर प्रत्येक पकवान में ठंड मध्यम एक के २०० μL जोड़ें । विच्छेदन के लिए 6 सेमी पेट्री डिश में मध्यम ए के बारे में 5 mL जोड़ें।
    नोट: उपयोग करने से पहले, सुनिश्चित करें कि सभी अभिकर्मक बाँझ हैं और आरएनए अनुप्रयोगों के लिए उपयुक्त हैं। बेंच और विच्छेदन उपकरणों को साफ और RNase विसंदूषण समाधान(सामग्री की तालिका) केसाथ छिड़काव की जरूरत है ।

2. मस्तिष्क क्षेत्र विच्छेदन

नोट: यह कदम ~ 30 मिन लेना चाहिए।

  1. वयस्क चरण माउस (>1 महीने पुराने) के लिए एक किशोर के पेरिटोनम में केटामाइन/जाइलाज़ीन (24 मिलीग्राम/mL केटामाइन और 2.4 मिलीग्राम/mL xylazine) के 400−500 μL इंजेक्ट करें।
    नोट: एक पुरुष माउस का उपयोग यहां चित्रण के लिए किया जाता है, लेकिन या तो लिंग उपयुक्त है।
  2. 5 मिन के लिए प्रतीक्षा करें और पीछे हटने की कमी सुनिश्चित करने के लिए एक हिंद पंजा चुटकी लें।
  3. तुरंत एक 26 जी x 3/8 सुई का उपयोग करने के लिए बर्फ के 20−30 मिलीग्राम के साथ ट्रांसकैरडायल perfusion प्रदर्शन ठंडा PBS जब तक बफर कोई दिखाई रक्त के साथ बाहर चलाता है ।
  4. सर्जिकल कैंची की एक जोड़ी के साथ माउस decapitate। खोपड़ी के नीचे बेनकाब करने के लिए त्वचा को खोलने के लिए छोटी कैंची का उपयोग करें, और फिर सिटटल सीवन, लैम्बडोइडल सीवन और कोरोनल सीवन के माध्यम से काटा जाए। ऊतक को नुकसान पहुंचाए बिना पार्श्व हड्डी और इंटरपैरल हड्डी के दोनों किनारों को खींचने के लिए संदंश का उपयोग करें, और मस्तिष्क को मध्यम ए के साथ विच्छेदन पेट्री डिश में सावधानी से स्थानांतरित करें।
  5. मिडलाइन के माध्यम से मस्तिष्क को दो गोलार्द्धों में काटने के लिए पूर्व-ठंडा ब्लेड का उपयोग करें।
    नोट: एक ही गोलार्द्ध से यहां वर्णित चार मस्तिष्क क्षेत्रएकल कोशिका या थोक आरएनए-एसईक्यू अनुप्रयोगों के लिए माइक्रोग्लिया की पर्याप्त संख्या पैदा करते हैं । अन्य गोलार्द्ध का उपयोग सीटू सत्यापन में इम्यूनोहिस्टोकेमिस्ट्री या आरएनए के लिए किया जा सकता है।
  6. कॉर्टिकल पालि से सेरिबैलम को अलग करें और मस्तिष्क स्टेम #55 संदंश के साथ और ऊतक को संग्रह पेट्री डिश में स्थानांतरित करें।
  7. #55 को ध्यान से हिप्पोकैम्पस और प्रांतस्था से striatum बाहर विच्छेदन और एक संग्रह पेट्री पकवान में प्रत्येक ऊतक हस्तांतरण करने के लिए मजबूर का प्रयोग करें ।

3. मैकेनिकल टिश्यू डिसोक्सिजन

नोट: कोशिकाओं और अभिकर्मकों को धुंधला चरणों के दौरान छोड़कर हर समय ठंडा रखें। यह कदम ~ 30 मिन लेना चाहिए।

  1. प्रत्येक मस्तिष्क के ऊतकों को एक रेजर ब्लेड के साथ और 1 मिमी3 ठीक टुकड़ों में काट लें।
  2. पूर्व ठंडा Dounce समरूपता में ऊतक टुकड़े स्थानांतरित करने के लिए 1 mL पिपेट (युक्तियों के साथ) का उपयोग करें, प्रत्येक DNase और RNase अवरोधक के साथ मध्यम ए के 2 mL युक्त ।
  3. टिश्यू को धीरे-धीरे 6−10 पूर्ण स्ट्रोक के लिए ड्रोग होमोजेनेज़र में और बाहर पिस्टन घुमाकर, जब तक कोई दिखाई देने वाला हिस्सा मौजूद नहीं है।
    नोट: Douncing न्यूरॉन्स और सबसे अन्य ग्लिल कोशिकाओं को मारता है, लेकिन माइक्रोग्लिल कोशिकाओं के बजाय बरकरार छोड़ दें। अपर्याप्त और अधिक-douncing दोनों कोशिकाओं की कम उपज का कारण बन सकते हैं।
  4. 70 माइक्रोन छलनी के माध्यम से 50 मिलीआर ट्यूबों में अलग ऊतकों स्थानांतरण।
  5. प्रत्येक Dounce समरूपता और पिस्टन को ठंडे माध्यम ए के कुल 6 मिलील के साथ कुल्ला करें और इसी ट्यूब में एक ही छलनी के माध्यम से रिंसिंग समाधान को फ़िल्टर करें।
  6. ब्रेक = 5 के साथ 4 डिग्री सेल्सियस पर 5 डिग्री सेल्सियस पर 5 मिन के लिए एकल सेल निलंबन (लगभग 8 mL प्रत्येक) को 15 मीटर शंकुट्यूब और अपकेंद्री 400 x ग्राम पर स्थानांतरित करें।

4. मायलिन हटाने

नोट: यह कदम ~ 60 मिन लेना चाहिए।

  1. चुंबकीय विभाजक(सामग्री की तालिका)में 1 बड़े कमी (एलडी) कॉलम (कॉर्टेक्स के लिए) और 3 बड़े चयन (एलएस) कॉलम (अन्य 3 क्षेत्रों के लिए) तैयार करें। एमसीएस बफर के 3 एमएल के साथ प्रत्येक कॉलम कुल्ला।
  2. एक बार केंद्रीकरण समाप्त हो जाने के बाद, पैलेट को बाहर निकालदें और पैलेट को परेशान किए बिना अधिनायक को त्याग दें। कॉर्टेक्स और सेरिबैलम ऊतकों के लिए, आरनैस अवरोधक के 1.8 माइक्रोन के साथ एमसीएस बफर के 850 माइक्रोन में कोशिकाओं को फिर से निलंबित करें। हिप्पोकैम्पस और स्ट्रेटम ऊतकों के लिए, आरनैस अवरोधक के 0.9 माइक्रोन के साथ एमसीएस बफर के 400 माइक्रोन में कोशिकाओं को फिर से निलंबित करें।
    नोट: ऊतक में मौजूद मायलिन की मात्रा के आधार पर कॉलम (एलडी बनाम एलएस) और पुनर्संकण के लिए उपयोग की जाने वाली मात्रा अनुकूलित की जाती है। यदि अन्य मस्तिष्क क्षेत्रों परखे हैं, इन शर्तों को ऊतक के आकार के आधार पर समायोजित करने की आवश्यकता हो सकती है और कितना myelin मौजूद हो सकता है । माइलिन हटाने की प्रभावशीलता चरण 4.9 में अनुमानित किया जा सकता है।
  3. कॉर्टेक्स और सेरिबैलम से कोशिकाओं में मायलिन हटाने मोतियों के 100 माइक्रोन जोड़ें और हिप्पोकैम्पस और स्ट्रेटम से कोशिकाओं में प्रत्येक माइलिन हटाने मोतियों के 50 μL जोड़ें।
  4. धीरे-धीरे कोशिकाओं को मोतियों के साथ मिलाएं और 10 मिन के लिए बर्फ पर ट्यूबों को इनक्यूबेट करें।
  5. एमसीएस बफर के साथ कॉर्टिकल कोशिकाओं के साथ ट्यूब की मात्रा को 2 एमएल में लाएं, और अन्य सभी को 1 एमएल (यानी, कॉर्टिकल कोशिकाओं के लिए 1 एमएल जोड़ें; हिप्पोकैम्पल और स्ट्रियल कोशिकाओं के लिए 500 माइक्रोन; सेरिबैलर कोशिकाओं में बफर जोड़ने की आवश्यकता नहीं है)।
  6. एक बार कॉलम rinsing बफर से खाली कर रहे हैं, प्रत्येक कॉलम के नीचे एक 15 mL ट्यूब जगह है । एलडी कॉलम पर कॉर्टिकल कोशिकाओं (2 mL) लोड करें, और अन्य सभी (1 mL प्रत्येक) एलएस कॉलम पर। तुरंत एमसीएस बफर के 1 एमएल का उपयोग मूल ट्यूबों को धोने और संबंधित स्तंभों पर समाधान लोड करने के लिए प्रत्येक।
  7. एमसीएस बफर के 1 एमएल के साथ एक बार एलडी कॉलम धोएं और प्रत्येक एलएस कॉलम को एमसीएस बफर प्रत्येक धोने के 1 एमएल के साथ दो बार धोएं। धोने के दौरान प्रवाह के माध्यम से समाधान इकट्ठा करने के लिए जारी रखें।
  8. 35 माइक्रोन छलनी टोपियां के माध्यम से गोल नीचे FACS ट्यूबों में कोशिकाओं को फ़िल्टर करें।
    नोट: प्रत्येक ट्यूब को मायलिन के समाप्त एकल सेल निलंबन के लगभग 4 मिलील एकत्र करना चाहिए।
  9. वैकल्पिक रूप से, सेल निलंबन के 10 माइक्रोन लें और इसे 0.4% ट्राइपैन ब्लू सॉल्यूशन के 10 माइक्रोन के साथ मिलाएं। उपज, जीवित रहने की दर और अवशिष्ट मायलिन के स्तर का अनुमान लगाने के लिए 10x उज्ज्वल क्षेत्र माइक्रोस्कोप के तहत कोशिकाओं की जांच करें।
    नोट: एक सफल तैयारी के लिए 90% से अधिक लाइव कोशिकाओं (आकार में दौर और नीले रंग को छोड़कर) के साथ कोई myelin मलबे के लिए थोड़ा उत्पन्न करना चाहिए।
  10. 4 डिग्री सेल्सियस पर 5 मिन के लिए 400 x ग्राम पर FACS ट्यूबों में पैलेट कोशिकाओं, ब्रेक = 5 के साथ। धीरे-धीरे सुपरनेटेंट डालें और ऊतक कागज पर ट्यूब के किनारे को डब करें। प्रत्येक ट्यूब में कोशिकाओं को FACS बफर के 300 माइक्रोन के साथ फिर से निलंबित करें।
    नोट: यदि एमसीएस छंटाई पसंद की जाती है, तो MYelin हटाने के बाद माइक्रोग्लिया और अन्य माइलॉयड कोशिकाओं का चयन करने के लिए सीडी11बी मोतियों का उपयोग किया जा सकता है। इन कोशिकाओं को तो गैर प्लेट आधारित स्क्रैना-सीक्यू के साथ ही थोक आरएनए-seq के लिए इस्तेमाल किया जा सकता है । इस वैकल्पिक दृष्टिकोण की चेतावनी यह है कि CD11b मोती अन्य संबंधित प्रतिरक्षा कोशिकाओं से माइक्रोग्लिया को अलग नहीं करते हैं जो इस एंटीजन के लिए भी सकारात्मक हैं।

5. फ्लोरेसेंस-सक्रिय सेल छंटाई के लिए धुंधला

नोट: यह कदम ~ 40 मिन लेना चाहिए।

  1. माउस एफसी रिसेप्टर्स ब्लॉक रिएजेंट(सामग्री की तालिका)के 5 μL प्रत्येक ट्यूब में जोड़ें। बर्फ पर 5 मिन के लिए इनक्यूबेट।
  2. प्रत्येक ट्यूब में CD45-PE-Cy7 के 1 μL और CD11b-BV421 के 1 μL जोड़ें ।
    नोट: अन्य संयुग्मित फ्लोरोफोरस के साथ एंटीबॉडी का उपयोग किया जा सकता है। TMEM119 के खिलाफ एंटीबॉडी, होमोस्टैटिक माइक्रोग्लिया9के लिए एक विशिष्ट मार्कर, भी शामिल किया जा सकता है, लेकिन इसे सीडी45 और सीडी11बी के साथ उपयोग करने की सिफारिश की जाती है, क्योंकि कुछ माइक्रोग्लिया उपआबादी TMEM119 सतह अभिव्यक्ति खो सकती है।
  3. कमरे के तापमान (आरटी) पर 10 मीटर के लिए एक शेखर पर ट्यूबों इनक्यूबेट।
  4. धोने के लिए FACS बफर के 2 mL जोड़ें।
  5. 4 डिग्री सेल्सियस पर पैलेट सेल, 5 मिन के लिए 400 x ग्राम। धीरे-धीरे सुपरनेटेंट डालें और टिश्यू पेपर पर ट्यूब के किनारे को थपका दें। प्रत्येक ट्यूब में कोशिकाओं को आरनैस अवरोधक के 1 माइक्रोन और प्रोपिडियम आयोडाइड (पीआई, 1:1,000 कमजोर पड़ने) के 0.5 माइक्रोन के साथ एफएसीएस बफर के 400 माइक्रोन का उपयोग करके पुनर्निलंबित करें।

6. इंडेक्स एफएसीएस छंटाई

नोट: यह कदम ~ 1 घंटे लेना चाहिए।

  1. मानक FACS प्रक्रिया का पालन करते हुए, तितर बितर (मलबे को छोड़कर), एकल कोशिकाओं, लाइव कोशिकाओं (पीआई नकारात्मक), माइक्रोग्लिया और माइलॉयड कोशिकाओं (CD45+,CD11b+)के आधार पर फाटक बनाएं।
    नोट: विशिष्ट माइक्रोग्लियल कोशिकाएं अन्य सीमा से जुड़े मैक्रोफेज जैसे परिधि और मेनिंगल मैक्रोफेज की तुलना में निचले स्तरों पर सीडी45 व्यक्त करती हैं, और इसलिए सीडी45 कम CD11b+ पर गेटिंग पर्याप्त होनी चाहिए यदि अनुसंधान का ध्यान इन शास्त्रीय माइक्रोग्लिया1,2में जीन अभिव्यक्ति प्रोफाइल है। हालांकि, माइक्रोग्लिया के कुछ सबसेट में सीडी45 अभिव्यक्ति अधिक हो सकती है और यह विकास के दौरान या रोग की स्थिति में विशेष रूप से सच है। माइक्रोग्लिअल जीन अभिव्यक्ति के निष्पक्ष विश्लेषण को सुनिश्चित करने के लिए, सीडी45 उच्च और सीडी45 कम इम्यूनोफेनोटाइप सूचकांक छंटाई सेटिंग और अनुक्रमण और डाउनस्ट्रीम विश्लेषण के लिए एकत्र की गई दोनों आबादी के माध्यम से दर्ज किया जा सकता है। इसके अलावा, TMEM119 सतह अभिव्यक्ति का उपयोग होमोस्टैटिक माइक्रोग्ल आबादी (चरण 5.2 देखें) को लक्षित करने के लिए किया जा सकता है और सीडी 45 के स्तर और अनुक्रमण परिणामों के साथ विश्लेषण किया जा सकता है।
  2. एकल माइक्रोग्लिया (100 माइक्रोन नोजल के साथ) को 96-अच्छी तरह से पॉलीमरेज़ चेन रिएक्शन (पीसीआर) प्लेटों में सॉर्ट करें, जिसमें प्रत्येक अच्छी तरह से लाइसिस बफर के 4 माइक्रोन होते हैं (विवरण के लिए प्रकाशित प्रोटोकॉल14 देखें)।
    नोट: एक्सट्रीम आरएनए कंट्रोल कंसोर्टियम (ईआरसीसी) आरएनए स्पाइक-इन मिक्स(टेबल ऑफ मैटेरियल्स)को गुणवत्ता नियंत्रण और सामान्यीकरण उद्देश्योंकेलिए लिसिस बफर में 1:2.4 x 107 पर जोड़ा जा सकता है।
  3. संक्षेप में प्लेटों भंवर और एक बेंच शीर्ष अपकेंद्रित्र का उपयोग कर नीचे स्पिन ।
  4. तुरंत सूखी बर्फ पर नमूनों को फ्रीज करें। पुस्तकालय तैयार होने तक प्लेटों को -80 डिग्री सेल्सियस पर स्टोर करें।
    नोट: वैकल्पिक रूप से, अधिक कोशिकाओं को थोक आरएनए-एसईक्यू के लिए आरएनए निष्कर्षण बफर के साथ 1.5 मिलीएल ट्यूबों में एकत्र किया जा सकता है। लेखकों के अनुभव के अनुसार, प्रकाशित प्रोटोकॉल2,14के बाद अच्छी गुणवत्ता वाले पुस्तकालयों को उत्पन्न करने के लिए 3,000 कोशिकाएं पर्याप्त हैं।

7. एकल सेल आरएनए-अनुक्रमण पुस्तकालय तैयारी

नोट: यहां, प्रकाशित प्रोटोकॉल14 तरल हैंडलिंग रोबोटिक्स और कुछ संशोधनों की सहायता से स्क्रैना-सीक्यू पुस्तकालयों को उत्पन्न करने के लिए पालन किया जाता है। इस लेख में, प्रक्रिया केवल संक्षेप में वर्णित है, और मतभेदों पर प्रकाश डाला जाता है । एक साथ 4 प्लेटों को प्रोसेस करने में लगभग 2.5 दिन लगते हैं।

  1. बर्फ पर गल प्लेटें और ओलिगो-dT30VN प्राइमर (lysis बफर में) के साथ रिवर्स ट्रांसक्रिप्शन प्रदर्शन करने के लिए थर्मल साइकिलर्स के साथ सीडीएनए उत्पन्न करने के लिए(तालिका 1):42 डिग्री सेल्सियस 90 min; 70 डिग्री सेल्सियस 5 मिन; 4 डिग्री सेल्सियस पकड़ो। फिर पीसीआर मास्टर मिक्स का उपयोग करके और सीटू पीसीआर (आईएसपीसीआर) प्राइमर(सामग्री की तालिका)और निम्नलिखित पीसीआर स्थिति: 37 डिग्री सेल्सियस 30 मिन में शुरुआत(टेबल 2)में एक अतिरिक्त एक्सोन्यूलीज पाचन कदम के साथ सीडीएनए बढ़ाना; 95 डिग्री सेल्सियस 3 मिन; 98 डिग्री सेल्सियस 20 एस, 67 डिग्री सेल्सियस 15 एस, 72 डिग्री सेल्सियस 4 मिन के 23 चक्र; 72 डिग्री सेल्सियस 5 मिन।
  2. अच्छी तरह से प्रति चुंबकीय मोतियों के 18 μL (0.7:1 अनुपात) का उपयोग कर cDNA शुद्ध। 5 मिन के लिए एक चुंबकीय स्टैंड पर प्लेट इनक्यूबेट और ताजा बनाया ८०% इथेनॉल, ८० μL प्रति अच्छी तरह से हर बार के साथ दो बार नमूनों को धोने । 15-20 टिन के लिए प्लेट सुखाने के बाद, प्रति अच्छी तरह से एल्यूटियन बफर के 20 माइक्रोन के साथ एलुट सीडीएनए।
    नोट: गुणवत्ता नियंत्रण के लिए, आकार वितरण और सीडीएनए की सांद्रता की जांच करने के लिए एक खंड एनालाइजर (उच्च संवेदनशीलता अगली पीढ़ी अनुक्रमण [एनजीएस] टुकड़ा विश्लेषण, 1−6,000 बीपी) का उपयोग करें, और केवल 500−5,000 बीपी के बीच एक धब्बा के साथ आगे की प्रक्रिया के नमूने, और 0.05 एनजी/μL से अधिक है।
  3. पुस्तकालयों को उत्पन्न करने के लिए, 55 डिग्री सेल्सियस 10 किमी पर, एक नैनोलीटर पाइपटिंग मशीन की सहायता से 384-अच्छी प्लेट में पुस्तकालय तैयार करने किट(सामग्री की तालिका)से टीएन5 टैगमेंटेशन रिएजेंट्स के 1.2 माइक्रोन के साथ प्रत्येक सीडीएनए नमूने के 0.4 माइक्रोन मिलाएं।
    नोट: यहां, लागत को कम करने और इस बीच थ्रूपुट में वृद्धि करने के लिए सुझाए गए प्रतिक्रिया मात्रा (5 माइक्रोन नमूना और टैगमेंटेशन रिएजेंट्स के 15 माइक्रोन) के 1/12.5 को जोड़ा जाता है। एक नैनोलीटर पाइपटिंग मशीन(सामग्री की तालिका)का उपयोग अभिकर्मकों (यह और निम्नलिखित चरणों) को और 384-अच्छी प्लेटों से स्थानांतरित करने के लिए किया जाता है।
  4. 5 मिन के लिए आरटी में टैगमेंटेशन रिएक्शन को रोकने के लिए बेअसर बफर के 0.4 माइक्रोन जोड़ें।
  5. 384 इंडेक्स(सामग्री की तालिका,0.4 माइक्रोन फॉरवर्ड और 0.4 माइक्रोन रिवर्स), पीसीआर मिश्रण के 1.2 माइक्रोन नमूनों (2 माइक्रोन प्रत्येक) में जोड़ें, और निम्नलिखित स्थिति का उपयोग करके पुस्तकालयों को बढ़ाना: 72 डिग्री सेल्सियस 3 मिन; 95 डिग्री सेल्सियस 30 एस; 95 डिग्री सेल्सियस 10 एस, 55 डिग्री सेल्सियस 30 एस, 72 डिग्री सेल्सियस 1 मिन के 10 चक्र; 72 डिग्री सेल्सियस 5 मिन।
  6. पूल सभी व्यक्तिगत पुस्तकालयों (प्रत्येक 1 μL ले) एक ही ३८४-अच्छी तरह से थाली से एक साथ, और चुंबकीय मोती का उपयोग करें(सामग्री की मेज,0.7:1 अनुपात) अंतिम पूल पुस्तकालयों को शुद्ध करने के लिए ।
  7. अनुक्रमण से पहले पूल किए गए पुस्तकालयों के आकार वितरण की जांच करने के लिए सांद्रता और बायोएनालाइजर(सामग्री की तालिका)को मापने के लिए फ्लोरोमीटर(सामग्रीकी तालिका) का उपयोग करें। 1 मिलियन कच्चे प्रति सेल पढ़ता है पर अनुक्रमण गहराई लक्ष्य।
  8. अनुक्रमण पढ़ता है और संरेखण2करने के लिए मानक जैव सूचना विज्ञान प्रक्रियाओं का पालन करें । सेराट पैकेज15के साथ क्लस्टरिंग विश्लेषण करने के लिए इनपुट के रूप में काउंट टेबल और मेटा डेटा का उपयोग करें।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

यह प्रोटोकॉल एक वयस्क छिद्रित मस्तिष्क गोलार्द्ध में विभिन्न मस्तिष्क क्षेत्रों से माइक्रोग्लिया को अलग करने और सॉर्ट करने की विधि का वर्णन करता है, जिसके बाद स्क्आरएनए-सीक्यू होता है। हम एकल सेल निलंबन बनाने के लिए और माइक्रोग्लिया को समृद्ध करने के लिए पहले कदम के रूप में भी douncing का उपयोग करते हैं। अपर्याप्त या अधिक douncing उपज को कम कर देता है। इसके अलावा, वयस्क माउस दिमाग में मायलिन का उच्च स्तर होता है, जो ठीक से नहीं हटाए जाने पर छंटाई दक्षता और उपज को भी कम कर सकता है। इसलिए, हम एंटीबॉडी धुंधलाप्रदर्शनकरने से पहले माइलिन हटाने (चरण 4.9) की उपज, सेल व्यवहार्यता और प्रभावकारिता का अनुमान लगाने के लिए ट्राइपैन ब्लू और हीमोसाइटोमीटर का उपयोग करके माइक्रोस्कोप के नीचे सेल निलंबन की जांच करते हैं। इस बिंदु पर कुल सेल मायने रखता है प्रांतस्था के लिए 30,000 से अधिक होना चाहिए, और अन्य ऊतकों के लिए 5,000 से अधिक। कोशिकाओं के 90% से अधिक थोड़ा myelin मलबे के साथ व्यवहार्य होना चाहिए।

हम माइक्रोग्लिया (या माइलॉयड कोशिकाओं) को सॉर्ट करने के लिए एक FACS मशीन का उपयोग करते हैं, जो आमतौर पर सीडी 45 कम और सीडी 11बी सकारात्मक होते हैं। कॉर्टिकल ऊतक के लिए कम से कम, सफल अलगाव सभी जीवित एकल कोशिकाओं(चित्रा 2)में से 80% से अधिक माइक्रोग्लिया उत्पन्न करना चाहिए। मरने/मृत आबादी तैयारी के केवल एक छोटे से अंश (लगभग 10%) का प्रतिनिधित्व करती है ।

एक बार व्यक्तिगत माइक्रोग्लिया को लाइसिस बफर में कैप्चर किया जाता है, आरएनए जारी किया जाता है और बाद में सीडीएनए के लिए लिखित रिवर्स होजाता है, जिसे फिर 23 चक्रों के लिए परिलक्षित किया जाता है। इन सीडीएनए नमूनों की गुणवत्ता की जांच करना महत्वपूर्ण है- पुस्तकालय बनाने से पहले उनमें से कम से कम एक हिस्सा। एक केशिका इलेक्ट्रोफोरेसिस प्लेटफॉर्म के रूप में, खंड एनालाइजर और उच्च संवेदनशील एनजीएस टुकड़ा किट (1−6,000 बीपी) आकार वितरण के बारे में त्वरित और सटीक जानकारी प्रदान करता है और साथ ही 96-अच्छी प्लेट(चित्रा 3ए)के प्रत्येक कुएं में मौजूद सीडीएनए अणुओं की मात्रा भी प्रदान करता है। नमूने एक धब्बा (500−5,000 बीपी) और कुछ एकाग्रता सीमा से ऊपर दिखा (जैसे, 0.05 एनजी/μL) पुस्तकालयों बनाने के लिए इस्तेमाल किया जा सकता है । इसी तरह, पूल किए गए पुस्तकालयों को अनुक्रमण(चित्रा 3बी)से पहले बायोएनालाइजर पर परीक्षण किया जाना चाहिए।

हम नमूनों को प्रति सेल 1 मिलियन से अधिक कच्चे पढ़ता है, जो इस स्क्रैना-सीक्यू पद्धति16की पता लगाने की शक्ति को संतृप्त करता है। लगभग 60% मानचित्रण दर के साथ, प्रति माइक्रोग्लियल सेल 2,000 से अधिक जीन का पता लगाया जा सकता है। हमने प्रकाशित डेटा प्राप्त किया जो इस अलगाव विधि17का उपयोग करके उत्पन्न किए गए थे, और अनुक्रमित आबादी(चित्र 4)में माइक्रोग्लिया-विशिष्ट जीन का पता लगाने के लिए स्वतंत्र प्रयोगों और संवेदनशीलता से इसकी प्रजनन क्षमता प्रदर्शित करते हैं।

Figure 1
चित्रा 1: माइक्रोग्लिया अलगाव उपज, सेल व्यवहार्यता और मायलिन हटाने की दक्षता का अनुमान। बाएं पैनल ने मायलिन हटाने के स्तंभों से गुजरने के बाद ट्राइपैन ब्लू सना हुआ कोशिकाओं (कॉर्टेक्स से) की उज्ज्वल क्षेत्र छवि (4x आवर्धन) दिखाया। अन्य क्षेत्रों के लिए परिणाम समान दिखेंगे लेकिन कम कोशिकाओं के साथ। कोशिकाओं के विशाल बहुमत (यदि सभी नहीं) उज्ज्वल (गैर-दाग) और प्रक्रियाओं के नुकसान के कारण दौर दिखाई दिया। सही छवि बॉक्स्ड क्षेत्र के ज़ूम-इन (20x) थी और थोड़ा मायलिन मलबा मौजूद था। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 2
चित्रा 2: गेट्स माइक्रोग्लिया छंटाई के लिए इस्तेमाल किया । डेटा ने कॉर्टेक्स से माइक्रोग्लिया को छांटने के लिए गेटिंग रणनीति दिखाई, और अन्य क्षेत्रों के लिए एक ही रणनीति का उपयोग किया गया था। सेल मलबे को पहले तितर-बितर भूखंड से बाहर रखा गया था, और एकल कोशिकाओं को आगे तितर-बितर क्षेत्र (एफएससी-ए) /फॉरवर्ड स्कैटर-चौड़ाई (एफएससी-डब्ल्यू) द्वारा गेट किया गया था । लाइव कोशिकाओं को पीआई नकारात्मक धुंधला द्वारा गेट किया गया था, जो सभी एकल कोशिकाओं के लगभग 90% से थे। माइक्रोग्लिया, लगभग 80% जीवित कोशिकाओं का प्रतिनिधित्व करता है, सीडी 45 कम सीडी 11बी + गेट से हल किया गया था। कुल ~ 30,000 माइक्रोग्लिया को कॉर्टेक्स ऊतक (3 महीने पुराने माउस के एक गोलार्द्ध से) से अलग और हल किया जा सकता है। एक एफएसीएस मशीन पर इंडेक्स छंटाई की गई । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 3

Figure 3
चित्रा 3: एक माइक्रोग्लियल सेल और एक अंतिम पूल पुस्तकालय से प्रवर्धित सीडीएनए के लिए प्रतिनिधि गुणवत्ता नियंत्रण परिणाम। (ए)एक टुकड़ा विश्लेषक का उपयोग करके, सभी टुकड़ों को एक्स धुरी पर उनके आकार के साथ प्लॉट किया जाता है, और वाई धुरी पर सापेक्ष फ्लोरेसेंस तीव्रता, किसी दिए गए आकार के सीडीएनए की बहुतायत को दर्शाता है। एलएम (लोअर मार्कर, 1 बीपी) और यूएम (अपर मार्कर, 6,000 बीपी) सीडीएनए मात्रा को मापने के लिए उपयोग की जाने वाली सांद्रता के साथ मार्कर लोड कर रहे हैं। एक प्रतिनिधि माइक्रोग्लियल सेल से सफलतापूर्वक प्रवर्धित सीडीएनए आकार वितरण ग्राफ या 500 बीपी और 5,000 बीपी के बीच जेल ग्राफ पर एक धब्बा (लेबल ब्रैकेट) पर एक वक्र (हरी बिंदीदार रेखा) बनाता है। अन्य लेबल वाली चोटियों को ईआरसीसी स्पाइक-इन अणुओं या राइबोसोमल आरएनए से परिलक्षित किया गया था। ५०० बीपी और ५,००० बीपी के बीच सीडीएनए की एकाग्रता की मात्रा निर्धारित की जा सकती है, और ०.०५ एनजी/μL से अधिक सांद्रता वाले नमूनों और इस तरह के विशिष्ट घटता दिखाने के लिए पुस्तकालय की तैयारी के लिए बनाए रखा जाता है । आरएफयू, सापेक्ष फ्लोरेसेंस यूनिट। (ख)एक बायोएनालाइजर पर प्रतिनिधि गुणवत्ता नियंत्रण परिणाम जिसमें अंतिम पूल्ड लाइब्रेरी (लगभग 380 कोशिकाओं के साथ) का आकार वितरण दिखाया गया है। आमतौर पर, यह 200 बीपी से 2,000 बीपी तक होता है जिसका औसत आकार 400−600 बीपी होता है। दो तेज चोटियों पर मार्कर लोड हो रहे थे। फू, फ्लोरेसेंस यूनिट। कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

Figure 4
चित्रा 4: दो पुरुष चूहों के 4 मस्तिष्क क्षेत्रों से अलग माइक्रोग्लिया का स्क्रना-सीक्यू विश्लेषण। (A)tSNE क्षेत्रीय माइक्रोग्लिया के आपस में पैटर्न दिखा tSNE साजिश (माउस #1 से केवल कोशिकाओं पर प्रकाश डाला गया) । वे tSNE साजिश पर केंद्रित क्षेत्रों में सूक्ष्म बदलाव से परे क्षेत्र मूल के अनुसार अलग समूहों के रूप में नहीं है (संभवतः बैच प्रभाव के कारण) । यह अवलोकन वयस्क चूहों में वैश्विक जीन अभिव्यक्ति के आधार पर माइक्रोग्लिया की सीमित क्षेत्रीय विषमता के अनुरूप है (इस विषय पर आगे चर्चा के लिए हाल ही में एक प्रकाशन2 देखें)। (ख)टीएसईनई प्लॉट में दो व्यक्तिगत चूहों से माइक्रोग्लिया का ओवरलैपिंग पैटर्न दिखाया गया है जिन्हें स्वतंत्र रूप से संसाधित किया गया था । यद्यपि छोटे बैच प्रभाव मौजूद हो सकते हैं (भूखंड के कुछ क्षेत्रों में ध्यान केंद्रित करने वाली कोशिकाएं), ये कोशिकाएं पशु मूल के अनुसार अलग-अलग समूह नहीं बनाती हैं। यह परिणाम प्रयोगों के बीच डेटा की तुलना करने के लिए प्रोटोकॉल की प्रजनन क्षमता का सुझाव देता है। (ग)स्आरएनए-सीक्यू द्वारा पता लगाए गए माइक्रोग्लिया हस्ताक्षर जीन की अभिव्यक्ति, जिसमें विशिष्ट मार्कर के लिए 95% से अधिक डिटेक्शन रेट दिखाई देता है, जैसे कि Tmem119 और P2ry12,और Sall1 और Pu.1जैसे ज्ञात ट्रांसक्रिप्शन कारकों के लिए 80% से अधिक डिटेक्शन रेट। प्रकाशित साहित्य17से आंकड़ों का फिर से विश्लेषण किया गया । (घ)अलग-थलग पड़े माइक्रोग्लिया के विशाल बहुमत में अन्य कोशिका प्रकारों के लिए विशिष्ट जीन की अभिव्यक्ति की कमी है, जैसे कि टब्ब 3 (न्यूरॉन्स), अल्ध1एल1 (एस्ट्रोसाइट्स), गजब1 (ओलिगोडेन्ट्रोसाइट्स), और Tie1 (एंडोथेलियल कोशिकाएं)। (ई)जीन से संबंधित माइक्रोग्लिअल सक्रियण या तनाव की अभिव्यक्ति। शास्त्रीय मार्कर, टीनफ, इल्1बी, नग 2और एनएफकेबी 2,जो नीच व्यक्त किए जाते हैं, शीर्ष पर दिखाए जाते हैं। प्रारंभिक प्रतिक्रिया जीन, Egr1 और Fos,नीचे दिखाया जाता है (चर्चा देखें) । कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें ।

अभिकर्मक वॉल्यूम (μL)
सेल लिसिस 4
रिवर्स ट्रांसक्रिप्टेज़ (100 यू/माइक्रोन) 0.95
आरएनएसई अवरोधक 0.25
5x पहला स्ट्रैंड बफर 2
डिथियोथ्रेइटॉल (डीटीटी; 100 एमएम) 0.5
बीटाइन (5 एम) 2
एमजीसीएल2 (1 एम) 0.06
टेम्पलेट स्विच ओलिगो (टीएसओ; 100 माइक्रोन) 0.1
एच2 0.14
कुल 10

तालिका 1: रिवर्स ट्रांसक्रिप्शन स्थिति। एक रिवर्स ट्रांसक्रिप्शन प्रतिक्रिया के लिए पुनः एजेंट वॉल्यूम प्रदान किए जाते हैं।

अभिकर्मक वॉल्यूम (μL)
रिवर्स ट्रांसक्रिप्शन उत्पाद 10
2x पीसीआर मास्टर मिक्स 12.5
ISPCR प्राइमर (10 μM) 0.25
लैम्ब्डा एक्सोनलीज 0.1125
एच2 2.1375
कुल 25

तालिका 2: पीसीआर प्रवर्धन की स्थिति। एक ही सेल से सीडीएनए के एक पीसीआर प्रवर्धन के लिए रिएजेंट वॉल्यूम प्रदान किए जाते हैं।

प्लेट-आधारित (यह प्रोटोकॉल) बूंद आधारित (10x जीनोमिक्स)
संवेदनशीलता अधिक जीन का पता चला कम जीन का पता चला
पूर्ण लंबाई हाँ नहीं (5' या 3 ' अंत)
सेल संख्या/आबादी के लिए लचीलापन छोटी या दुर्लभ उपआबादी के लक्षण वर्णन के लिए उपयुक्त बड़े सेल आबादी के व्यापक वर्गीकरण के लिए उपयुक्त
प्रवाह कोशिकाओं के कई हजारों तक कोशिकाओं के हजारों के लिए सैकड़ों
अद्वितीय आणविक पहचानकर्ता नहीं हाँ
प्रति सेल लागत $ 1−$ 5 $ 1 से कम
प्रायोगिक कठिनाई अधिक कदम और आमतौर पर तरल हैंडलिंग रोबोटिक्स की आवश्यकता होती है व्यावसायीकृत मशीनों के साथ प्रदर्शन करना सरल
सेल आबादी FACS छंटाई द्वारा लक्षित निष्पक्ष

तालिका 3: प्लेट-आधारित और बूंद-आधारित स्क्आरएनए-सीक्यू विधियों के बीच तुलना। इस लेख में, प्लेट-आधारित पूर्ण लंबाई स्आरएनए-सीक्यू प्रक्रिया प्रदान की गई है, जिसमें इनपुट के रूप में कोशिकाओं की छोटी संख्या के लिए उच्च संवेदनशीलता, पूर्ण लंबाई अनुक्रमण और लचीलेपन के फायदे हैं। ड्रॉपलेट-आधारित विधियां उच्च थ्रूपुट, कम लागत, प्रदर्शन करने में आसान और अद्वितीय आणविक पहचानकर्ताओं में डेटा के फायदे प्रदान करती हैं। वे प्रयोगों के उद्देश्य के आधार पर पूरक हैं।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

माइक्रोग्लिया सक्रिय रूप से सीएनएस में अन्य सेल प्रकारों के साथ बातचीत करते हैं, और वे पर्यावरणीय उत्तेजनाओं के प्रति बहुत संवेदनशील हैं। अलगाव की प्रक्रिया के दौरान उनके जीन अभिव्यक्ति में भड़काऊ प्रतिक्रियाओं और अपथन परिवर्तनों को कम करने के लिए, इस प्रोटोकॉल को पहले से प्रकाशित विधि9से सुव्यवस्थित किया गया है, और अब यह समानांतर में एक माउस मस्तिष्क गोलार्द्ध के कई क्षेत्रों से माइक्रोग्लिया को अलग करने के लिए उपयुक्त है। ऊतकों और अभिकर्मकों को ठंडे तापमान पर रखा जाता है और प्रयोग ों को सीमित ऊतक आकारों के आधार पर कम वॉश और कम अभिकर्मकों के साथ समय पर (विच्छेदन से छंटाई तक लगभग 3.5 घंटे) में किया जाता है। हम अन्य समरूपता विधियों पर douncing चुनते हैं, जैसे एंजाइमैटिक पाचन, क्योंकि यांत्रिक वियोजन को मार सकता है और इस प्रकार न्यूरॉन्स और अन्य ग्लियल कोशिकाओं को हटा या हटा सकते हैं, जबकि माइक्रोग्लिया9,18को थोड़ा नुकसान या सक्रियण होता है। हालांकि, अधिक-douncing, माइक्रोग्लिया की उपज को कम कर सकता है और इससे बचा जाना चाहिए। यह पहले दिखाया गया है कि यांत्रिक विच्छेदन और मोतियों आधारित मायलिन हटाने के बाद FACS छंटाई माइक्रोग्लिया के लिए कम सक्रियण परिचय, शास्त्रीय भड़काऊ जीन की ंयूनतम अभिव्यक्ति के आधार पर, उदाहरण के लिए, Tnf, Il1b, Nos2,और Nfkb29 (चित्रा 4ई)। फिर भी, माइक्रोग्लिया अभी भी एफओएस और ईजी1 (चित्रा 4ई)जैसे प्रारंभिक प्रतिक्रिया जीन को अपरेण करके पूर्व वीवो स्थितियों का जवाब दे सकता है, जो सामान्य रूप से वीवो2,19में माइक्रोग्लिया द्वारा व्यक्त नहीं किए जाते हैं, और ट्रांसक्रिप्टोमिक अध्ययन से इस तरह के परिवर्तनों को हमेशा हिटोलॉजी वर्गों पर मान्य किया जाना चाहिए।

यहां हम एक वयस्क माउस मस्तिष्क गोलार्द्ध से कॉर्टेक्स, सेरिबैलम, हिप्पोकैम्पस और स्ट्रिटम से माइक्रोग्लिया को अलग करने के लिए प्रक्रियाएं प्रदान करते हैं, और इस प्रोटोकॉल को आसानी से अन्य क्षेत्रों या चरणों में अनुकूलित किया जा सकता है। यह स्थितियों के लिए उपयोगी है, उदाहरण के लिए, जब रोग प्रभावित माइक्रोग्लिया मस्तिष्क के कुछ क्षेत्रों तक सीमित होते हैं जिन्हें विच्छेदित किया जा सकता है, या उम्र बढ़ने के अध्ययन में, जहां महत्वपूर्ण व्यक्तिगत विविधताओं के कारण पूलिंग नमूने अनुपयुक्त हैं। माइक्रोग्लियल (या पैन सहज प्रतिरक्षा) एपिटोप के खिलाफ एंटीबॉडी की उपलब्धता के साथ, इस प्रोटोकॉल को चूहे या मानवऊतक9 9में माइक्रोग्लिया को अलग करने के लिए भी अनुकूलित किया जा सकता है। बड़े या पुराने ऊतकों के लिए समायोजन करते समय, मायलिन-हटाने वाले मोतियों की मात्रा और उपयोग किए गए स्तंभों के प्रकार पर विचार करना और परीक्षण करना महत्वपूर्ण है। मायलिन हटाने के लिए एक वैकल्पिक दृष्टिकोण वाणिज्यिक कम चिपचिपाहट मीडिया20में घनत्व ढाल केंद्रीकरण द्वारा है । कुल मिलाकर ये दोनों विधियां उनकी दक्षता में तुलनीय हैं, हालांकि घनत्व ढाल केंद्रीकरण विधि थोड़ी अधिक पैदावार प्रदान कर सकती है, और दूसरी ओर, चुंबकीय मोती विधि एंडोटॉक्सिन को पेश करने की संभावना कम होती है, जो माइक्रोग्लिया21,22को सक्रिय कर सकती है।

कुल मस्तिष्क कोशिकाओं के बीच माइक्रोग्लिया के छोटे प्रतिशत के कारण, एकल-कोशिका प्रतिलेखन अध्ययन करने से पहले माइक्रोग्लिया को समृद्ध या शुद्ध करना अक्सर आवश्यक होता है। हम नीच प्रतिनिधित्व सेल प्रकार ों पर कब्जा करने के लिए एक संवेदनशील दृष्टिकोण के रूप में FACS का उपयोग करते हैं, और CD11b और CD45 सतह अभिव्यक्ति के आधार पर माइक्रोग्लिया का चयन करते हैं। एक गोलार्द्ध से, हम नियमित रूप से कॉर्टेक्स के लिए ~ 30,000 माइक्रोग्लिया प्राप्त करते हैं, और सेरिबैलम, हिप्पोकैम्पस या स्ट्रिटम के लिए ~ 5,000 माइक्रोग्लिया प्राप्त करते हैं। ये पैदावार अधिकांश एकल-सेल अनुप्रयोगों के साथ-साथ थोक आरएनए-एसईक्यू (3,000 या अधिक कोशिकाओं का उपयोग किया जा सकता है) के लिए पर्याप्त हैं। यह उल्लेखनीय है कि माइक्रोग्लिया विकास या रोग2के दौरान सीडी 45 प्रतिरक्षण को बढ़ावा दे सकता है, जिसमें सीडी 45 के निम्न और उच्च स्तर दोनों के साथ मामले की कोशिकाओं को दर्ज किया जाना चाहिए और विश्लेषण के लिए अनुक्रम को हल किया जाना चाहिए। माइक्रोग्लिया को समृद्ध करने के लिए एक और विकल्प मायलिन हटाने के बाद CD11b मोती-मध्यस्थता चुंबकीय सक्रिय सेल छंटाई का उपयोग करना है, लेकिन यह ड्रॉपलेट विधियों के लिए स्क्आरएनए-सीक्यू को सीमित करेगा।

एकल सेल संकल्प पर माइक्रोग्लिअल जीन अभिव्यक्ति का अध्ययन करने के लिए, हम आमतौर पर प्रति नमूना कम से कम 2−3 96-अच्छी तरह से प्लेटों में कोशिकाओं को सॉर्ट करते हैं और तरल हैंडलिंग मशीनों के साथ पुस्तकालय तैयार करते हैं। यह दिखाया गया है कि यह प्लेट-आधारित पूर्ण लंबाई पुस्तकालय तैयार करने का दृष्टिकोण पता लगाने की सीमा में सबसे संवेदनशील स्क्रैना-सीक्यू विधियों में से एक है, जो दुर्लभ प्रतिलिपियों के सटीक मात्राकरण की अनुमति देता है, जैसे कि प्रतिलेखन कारक13,14,16। पूर्ण लंबाई अनुक्रमण के कारण, यह दृष्टिकोण 5 या 3 के पूर्वाग्रह के अधीन नहीं है और इसका उपयोग स्प्लिसिंग वेरिएंट(तालिका 3)का विश्लेषण करने के लिए किया जा सकता है। इसके अलावा, बूंद आधारित तरीकों के विपरीत, जिन्हें आमतौर पर प्रतिक्रिया में सैकड़ों या हजारों कोशिकाओं की आवश्यकता होती है, इस प्लेट-आधारित प्रोटोकॉल में प्रत्येक प्रयोग में कोशिकाओं की एक छोटी संख्या को शामिल करने की छूट होती है, और धीरे-धीरे बाद में डिजाइन में अधिक प्लेटें जोड़कर जनसंख्या आकार का विस्तार किया जाता है। भ्रूण विकास जैसी कुछ स्थितियों में माइक्रोग्लिया के छोटे सबसेट का अध्ययन करते समय यह लाभप्रद होता है।

हालांकि यह प्रोटोकॉल मस्तिष्क क्षेत्रीय माइक्रोग्लिया के लिए उच्च गुणवत्ता वाले स्आरएनए-सीक्यू पुस्तकालयों को पुन: उत्पन्न करता है, यह अक्सर अपेक्षाकृत उच्च लागत (पुस्तकालय तैयार करने के लिए लगभग $ 5/सेल के कारण छोटे पैमाने पर अध्ययन ों के लिए उपयुक्त होता है, यदि शेल्फ स्मार्टसेक्यू वी 4 किट का उपयोग करके $ 23/सेल से अभी भी सस्ता है)। कई रणनीतियां लागत को कम करने और थ्रूपुट बढ़ाने में मदद कर सकती हैं। सबसे पहले, कोशिकाओं को लिसिस बफर के 0.5 माइक्रोन के साथ 384-अच्छी प्लेटों में हल किया जा सकता है, और इसके लिए केवल प्रारंभिक रिवर्स ट्रांसक्रिप्शन और पीसीआर प्रवर्धन चरणों के लिए अभिकर्मकों की 1/8 मात्रा की आवश्यकता होती है। दूसरा, इन-हाउस Tn5 ट्रांसपोसेज़ का उत्पादन करना संभव है जिसमें व्यावसायिक रूप से उपलब्ध किट23में समान गुणवत्ता है। इन दो संशोधनों पुस्तकालय तैयार करने की लागत को कम कर सकता है $1/सेल के लिए नीचे । तीसरा, अनुकूलित अनुक्रमित का उपयोग करके, अनुक्रमित गहराई (>1 मिलियन पढ़ता/सेल)17का त्याग किए बिना एक प्रणाली पर अनुक्रमण के लिए हजारों कोशिकाओं को एक साथ पूल किया जा सकता है। स्वचालित तरल हैंडलिंग रोबोटों के समावेश के साथ ये सुधार, लगभग किसी भी परिभाषित क्षेत्रों से अलग माइक्रोग्लिया के उच्च-थ्रूपुट डीप स्क्आरएनए-सीक्यू को सक्षम करेंगे।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

हम इस प्रोटोकॉल के विकास के दौरान उनकी मदद के लिए मारिको एल बेनेट, लता निकोल बोनानो और स्पायरोस डार्मैनिस को धन्यवाद देते हैं। हम स्टैनफोर्ड साझा FACS सुविधा, विशेष रूप से मेरेडिथ Weglarz और लिसा निकोल्स का भी शुक्रिया अदा करते हैं; येन ट्रान, स्टैनफोर्ड प्रोटीन और न्यूक्लिक एसिड सुविधा (पैन) से माइकल Eckart फिल्मांकन के लिए उनके महान समर्थन के लिए । इस काम को जेपीबी फाउंडेशन और विंसेंट जे कोट्स फाउंडेशन द्वारा वित्त पोषित किया जाता है।

Materials

Name Company Catalog Number Comments
5 M Betaine Sigma-Aldrich Cat# B0300-5VL
10 mM dNTP mix Thermo Fisher Scientific Cat# R0192
0.5 M EDTA, pH 8.0 Thermo Fisher Scientific Cat# 15575020
10X Hanks’ Balanced Salt Solution Thermo Fisher Scientific Cat# 14185-052
1 M HEPES Thermo Fisher Scientific Cat# 15630080
1X KAPA HIFI Hotstart Master Mix Kapa Biosciences Cat# KK2602
5 mL Round Bottom Polystyrene Tube, with Cell Strainer Cap Corning Cat# 352235
AATI, High Sensitivity NGS Fragment Analysis Kit (1 bp – 6,000 bp) Advanced Analytical Cat# DNF-474-1000
Bovine Serum Albumin Sigma Aldrich Cat# A8806
DNase I Worthington Cat# LS002007 Working solution: 12500 units/ml
DTT, Molecular Grade Promega Cat# P1171
ERCC RNA Spike-In Mix Thermo Fisher Scientific Cat# 4456740
Fetal Bovine Serum Thermo Fisher Scientific Cat# 10437-028
Illumina XT Index Kit v2 Set A (96 indexes) Illumina Cat# FC-131-2001
Illumina XT Index Kit v2 Set B (96 indexes) Illumina Cat# FC-131-2002
Illumina XT Index Kit v2 Set C (96 indexes) Illumina Cat# FC-131-2003
Illumina XT Index Kit v2 Set D (96 indexes) Illumina Cat# FC-131-2004
Lambda Exonuclease (5 U/μl) New England BioLabs Cat# M0262S
Mouse Fc block BD Pharmingen Cat# 553142
Myelin removal beads Miltenyl Biotec Cat# 130-096-433
Nextera XT DNA Sample Prep Kit Illumina Cat# FC-131-1096
NextSeq 500/550 High Output Kit v2.5 (150 Cycles) Illumina Cat# 20024907
PBS (10X), pH 7.4 Thermo Fisher Scientific Cat# 70011044
PCRClean DX beads Aline Biosciences Cat# C-1003-50
Propidium Iodide Thermo Fisher Scientific Cat# P3566 Staining: 1:1000
Qubit dsDNA HS Assay Kit Thermal Fisher Scientific Cat# Q32851
Rat monoclonal anti mouse/human CD11b, Brilliant Violet 421 (clone M1/70) BioLegend Cat# 101236; RRID: AB_11203704 Staining: 1:300
Rat monoclonal anti mouse CD45, PE/Cy7 (clone 30-F11) Thermo Fisher Scientific Cat# 25-0451-82; RRID: AB_469625 Staining: 1:300
Recombinant RNase Inhibitor Takara Bio Cat# 2313B
SMARTScribe Reverse Transcriptase (100 U/μl) Clontech Cat# 639538 Containing 5x First strand buffer
Oligonucleotides
0.1 μM ISPCR Oligo: 5' - AAGCAGTGGTATCAA
CGCAGAGT-3'
(Picelli et al., 2014)
Oligo-dT30VN primer: 5' - AAGCAGTGGTATCAACGCA
GAGTACT 30 VN-3'
(Picelli et al., 2014)
TSO 5' - AAGCAGTGGTATCAACGCAGA
GTACATrGrG+G-3' ("r" is forribobases and "+" is for an LNA base)
(Picelli et al., 2014)
Solutions
FACS buffer Recipe: sterile-filtered 1% FBS, 2 mM EDTA, 25 mM HEPES in 1X PBS
MCS buffer Recipe: sterile-filtered 0.5% BSA, 2 mM EDTA in 1X PBS
Medium A Recipe: 15 mM HEPES, 0.5% glucose in 1X HBSS without phenol red
Plates
384-well Rigi-Plate PCR Microplates, Axygen Scientific VWR 89005-556
Hard-shell 96-well PCR plates Bio-Rad HSP9631
Others
Dumont #55 forceps Fine Science Tools 11295-51
Dounce homogenizer, 2 ml Wheaton 357422
Large depletion column Miltenyi Biotec 130-042-901
Large selection column Miltenyi Biotec 130-042-401
MACS MultiStand Miltenyi Biotec 130-042-303
QuadroMACS Separator Miltenyi Biotec 130-090-976
RNAzap Thermo Fisher Scientific AM9780
Strainer (70 μm) Falcon 352350
Equipment
BD FACSAria II BD Biosciences http://www.bdbiosciences.com/
Bioanalyzer Agilent 2100
Fragment Analyzer Agilent 5300
Mosquito HTS nanoliter pipetting robot TTP Labtech https://www.ttplabtech.com/
Qubit 4 Fluorometer Thermo Fisher Scientific Q33226

DOWNLOAD MATERIALS LIST

References

  1. Li, Q., Barres, B. A. Microglia and macrophages in brain homeostasis and disease. Nature Reviews Immunology. 18, (4), 225-242 (2018).
  2. Li, Q., et al. Developmental Heterogeneity of Microglia and Brain Myeloid Cells Revealed by Deep Single-Cell RNA Sequencing. Neuron. 101, (2), 207-223 (2019).
  3. Keren-Shaul, H., et al. A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease. Cell. 169, (7), 1276-1290 (2017).
  4. Bohlen, C. J., et al. Diverse Requirements for Microglial Survival, Specification, and Function Revealed by Defined-Medium Cultures. Neuron. 94, (4), 759-773 (2017).
  5. Guerreiro, R., et al. TREM2 variants in Alzheimer's disease. New England Journal of Medicine. 368, (2), 117-127 (2013).
  6. Jonsson, T., et al. Variant of TREM2 associated with the risk of Alzheimer's disease. New England Journal of Medicine. 368, (2), 107-116 (2013).
  7. Zhang, Y., et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. Journal of Neuroscience. 34, (36), 11929-11947 (2014).
  8. Colonna, M., Butovsky, O. Microglia Function in the Central Nervous System During Health and Neurodegeneration. Annual Review of Immunology. 35, 441-468 (2017).
  9. Bennett, M. L., et al. New tools for studying microglia in the mouse and human CNS. Proceedings of the National Academy of Sciences of the United States of America. 113, (12), 1738-1746 (2016).
  10. Hammond, T. R., et al. Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes. Immunity. 50, (1), 253-271 (2019).
  11. Van Hove, H., et al. A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment. Nature Neuroscience. 22, (6), 1021-1035 (2019).
  12. Chen, G., Ning, B., Shi, T. Single-Cell RNA-Seq Technologies and Related Computational Data Analysis. Frontiers in Genetics. 10, 317 (2019).
  13. Svensson, V., et al. Power analysis of single-cell RNA-sequencing experiments. Nature Methods. 14, (4), 381-387 (2017).
  14. Picelli, S., et al. Full-length RNA-seq from single cells using Smart-seq2. Nature Protocols. 9, (1), 171-181 (2014).
  15. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  16. Ziegenhain, C., et al. Comparative Analysis of Single-Cell RNA Sequencing Methods. Molecular Cell. 65, (4), 631-643 (2017).
  17. Tabula Muris, C., et al. Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature. 562, (7727), 367-372 (2018).
  18. Bohlen, C. J., Bennett, F. C., Bennett, M. L. Isolation and Culture of Microglia. Current Protocols in Immunology. 125, (1), 70 (2018).
  19. Haimon, Z., et al. Re-evaluating microglia expression profiles using RiboTag and cell isolation strategies. Nature Immunology. 19, (6), 636-644 (2018).
  20. Collins, H. Y., Bohlen, C. J. Isolation and Culture of Rodent Microglia to Promote a Dynamic Ramified Morphology in Serum-free Medium. Journal of Visualized Experiments. (133), e57122 (2018).
  21. Nikodemova, M., Watters, J. J. Efficient isolation of live microglia with preserved phenotypes from adult mouse brain. Journal of Neuroinflammation. 9, 147 (2012).
  22. Swartzlander, D. B., et al. Concurrent cell type-specific isolation and profiling of mouse brains in inflammation and Alzheimer's disease. Journal of Clinical Investigation Insight. 3, (13), 121109 (2018).
  23. Hennig, B. P., et al. Large-Scale Low-Cost NGS Library Preparation Using a Robust Tn5 Purification and Tagmentation Protocol. G3. 8, (1), Bethesda. 79-89 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics