A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing

10.5K views

DOI:

10.3791/60347

December 3rd, 2019

In This Article

Summary

We provide a protocol for isolation of microglia from different dissected regions of an adult mouse brain hemisphere, followed by semi-automated library preparation for deep single-cell RNA sequencing of full-length transcriptomes. This method will help to elucidate functional heterogeneity of microglia in health and disease.

Abstract

As resident macrophages in the central nervous system, microglia actively control brain development and homeostasis, and their dysfunctions may drive human diseases. Considerable advances have been made to uncover the molecular signatures of homeostatic microglia as well as alterations of their gene expression in response to environmental stimuli. With the advent and maturation of single-cell genomic methodologies, it is increasingly recognized that heterogenous microglia may underlie the diverse roles they play in different developmental and pathological conditions. Further dissection of such heterogeneity can be achieved through efficient isolation of microglia from a given region of interest, followed by sensitive profiling of individual cells. Here, we provide a detailed protocol for the rapid isolation of microglia from different brain regions in a single adult mouse brain hemisphere. We also demonstrate how to use these sorted microglia for plate-based deep single-cell RNA sequencing. We discuss the adaptability of this method to other scenarios and provide guidelines for improving the system to accommodate large-scale studies.

Introduction

Microglia, representing 5%−10% of all neural cells, are resident macrophages scattered throughout the central nervous system (CNS)1. Protected behind blood-brain barrier, typical microglia in a healthy adult brain contain many fine processes that rapidly extend and retract to interact with neurons and other glial cells in the parenchyma. Microglia can also adopt the amoeboid morphology associated with increased phagocytic function during specific developmental stages or upon immune challenges in injury and disease1,2,3,4. Recent exciting discoveries have clearly demonstrated that microglia are by no means passive bystanders to brain-derived or pathological signals, but play pivotal roles in controlling brain development and homeostasis, for instance, by supporting neuronal survival, pruning immature synapses, promoting oligodendrocyte lineage cells differentiation as well as angiogenesis1. As more functions of microglia are elucidated, the excitement is further fueled by human genetics studies, which showed that many neurodegenerative disease risk genes, such as TREM2, are predominantly or exclusively expressed by microglia5,6,7. Given their significance in development and plausible disease-driving roles, tremendous effort has recently been put towards our understanding of microglial gene regulation and function in hope of finding new therapeutic targets for neurodegenerative diseases1,8.

RNA sequencing (RNA-seq) allows unbiased characterization of cell type-specific gene expression, which in turn guides scientists to investigate gene functions in dense cellular networks7. RNA-seq had been mostly done on bulk samples, leading to the discovery of a homeostatic microglial gene signature that distinguishes them from other neural and immune cells9. However, such an approach could overlook molecular and functional differences among microglia, especially those transiently present in development, or associated with aging and disease. Indeed, single-cell RNA-seq (scRNA-seq) offers the sensitivity and resolution that have revolutionized the field by revealing previously underappreciated heterogeneity of microglia in a variety of contexts2,3,10. In addition, due to the presence of other similar immune cells at the CNS-circulation interface, scRNA-seq provides information aiding the design of new tools to separate and functionally dissect these related cells with little prior knowledge2,11.

A diverse array of scRNA-seq platforms have been invented, each suitable for certain applications12. In general, droplet-based methods, such as 10x Genomics, are higher in throughput with (tens of) thousands of cells sequenced in each run, and they are less selective for the input which may contain mixed cell populations requiring broad categorization. Plate-based methods provide higher sensitivity and read depth13,14, usually targeting specific populations from cell sorting to reveal subtle differences or rare transcripts. Given the small percentage of microglial cells, particularly those development- or disease-associated subpopulations, among all CNS cell types, it is often desirable to isolate microglia from a specific region of interest and obtain deep and full-length transcriptomic information in order to understand their heterogeneity.

Here, we provide details on how to isolate microglia from different mouse brain regions dissected from a single hemisphere, which are used for single-cell (or bulk) RNA-seq following a semi-automated plate-based library preparation procedure. The other hemisphere can then be used for histological validation. Streamlined from a previously published method9, this isolation protocol aims to maximize the yield from small amount of starting materials, and meanwhile maintain endogenous microglial gene expression profiles. We use fluorescence-activated cell sorting (FACS) to enrich microglia (or other related immune cells of interest) into 96-well plates and miniaturize the volumes of reagents for library preparation in order to increase throughput. We highlight this sensitive scRNA-seq platform, although other plate-based strategies may be applied. This method can be easily adapted to isolate microglia from other dissected tissues, such as injury or disease foci, and the age of the mouse can vary across almost any postnatal stages. Efficient isolation of regional microglia for single-cell transcriptomics studies will facilitate better understanding of their functions in health and disease.

Access restricted. Please log in or start a trial to view this content.

Protocol

All procedures involving rodents conformed to Stanford University guidelines, which comply with national and state laws and policies. All animal procedures were approved by Stanford University's Administrative Panel on Laboratory Animal Care.

NOTE: All solution and buffer compositions are provided in Table of Materials.

1. Preparation on the Day of Cell Isolation

  1. Prepare the following reagents and chill them on ice: medium A (50 mL), magnetic-activated cell sorting (MCS) buffer (30 mL), FACS buffer (25 mL), phosphate-buffered saline (PBS; 30 mL), DNase (320 µL), and RNase inhibitor (30 µL).
    NOTE: The volumes provided here are sufficient to isolate microglia from 4 brain regions (e.g., cortex, cerebellum, hippocampus and striatum) of a single mouse brain hemisphere. Scale up if more tissues are used.
  2. Place four clean 2 mL Dounce homogenizers on ice and add 2 mL of medium A with 80 µL of DNase (12,500 units/mL) and 5 µL of RNase inhibitor into each Dounce homogenizer. Chill the pistons in 15 mL tubes.
  3. Label four 6 cm Petri dishes with brain regions for tissue collection and add 200 µL of cold medium A into each dish on ice. Add about 5 mL of medium A into a 6 cm Petri dish for dissection.
    NOTE: Prior to use, make sure all reagents are sterile and suitable for RNA applications. Bench and dissection tools need to be clean and sprayed with RNase decontamination solution (Table of Materials).

2. Brain Region Dissection

NOTE: This step should take ~30 min.

  1. Inject 400−500 µL of ketamine/xylazine (24 mg/mL ketamine and 2.4 mg/mL xylazine) into the peritoneum of a juvenile to adult stage mouse (>1 month old).
    NOTE: A male mouse is used here for illustration, but either gender is suitable.
  2. Wait for 5 min and pinch a hind paw to ensure lack of retraction.
  3. Immediately use a 26 G x 3/8 needle to perform transcardial perfusion with 20−30 mL of ice-cold PBS until buffer runs out with no visible blood.
  4. Decapitate the mouse with a pair of surgical scissors. Use small scissors to cut open the skin to expose the underneath skull, and then cut through the sagittal suture, lambdoidal suture and coronal suture. Use forceps to pull off both sides of parietal bone and interparietal bone without damaging the tissue, and carefully move the brain into the dissection Petri dish with medium A.
  5. Use a pre-chilled blade to cut the brain through midline into two hemispheres.
    NOTE: The four brain regions described here from a single hemisphere yield sufficient numbers of microglia for single-cell or bulk RNA-seq applications. The other hemisphere can be used for immunohistochemistry or RNA in situ validation.
  6. Separate the cerebellum from the cortical lobe and the brain stem with #55 forceps and transfer the tissue into a collection Petri dish.
  7. Use #55 forceps to carefully dissect out the hippocampus and the striatum from the cortex and transfer each tissue into a collection Petri dish.

3. Mechanical Tissue Dissociation

NOTE: Keep cells and reagents cool all the time except during staining steps. This step should take ~30 min.

  1. Chop each brain tissue with a razor blade into <1 mm3 fine pieces.
  2. Use 1 mL pipette (with tips cut off) to transfer tissue pieces into the pre-chilled Dounce homogenizers, each containing 2 mL of medium A with DNase and RNase inhibitor.
  3. Homogenize the tissue by slowly twisting the piston in and out of the Dounce homogenizer for 6−10 full strokes, until no visible chunks are present.
    NOTE: Douncing kills neurons and most other glial cells but leave microglial cells rather intact. Both insufficient and over-douncing can lead to low yield of cells.
  4. Transfer dissociated tissues into 50 mL tubes through 70 µm strainers.
  5. Rinse each Dounce homogenizer and piston with a total of 6 mL of cold medium A and filter the rinsing solution through the same strainer into the corresponding tube.
  6. Transfer the single cell suspensions (about 8 mL each) into 15 mL conical tubes and centrifuge at 400 x g for 5 min at 4 °C with brake = 5.

4. Myelin Removal

NOTE: This step should take ~60 min.

  1. Prepare 1 large depletion (LD) column (for cortex) and 3 large selection (LS) columns (for the other 3 regions) in a magnetic separator (Table of Materials). Rinse each column with 3 mL of MCS buffer.
  2. Once centrifugation is finished, pipette out and discard the supernatant without disturbing the pellet. For the cortex and cerebellum tissues, resuspend cells in 850 µL of MCS buffer with 1.8 µL of RNase inhibitor. For hippocampus and striatum tissues, resuspend cells in 400 µL of MCS buffer with 0.9 µL of RNase inhibitor.
    NOTE: The columns (LD vs. LS) and the volume used for resuspension are optimized based on the amount of myelin present in the tissue. If other brain regions are assayed, these conditions may need to be adjusted depending on the size of the tissue and how much myelin may exist. Effectiveness of myelin removal can be estimated in step 4.9.
  3. Add 100 µL of myelin removal beads each into cells from cortex and cerebellum and add 50 µL of myelin removal beads each into cells from hippocampus and striatum.
  4. Gently mix the cells with beads and incubate the tubes on ice for 10 min.
  5. Bring the volume of the tube with cortical cells to 2 mL with MCS buffer, and all others to 1 mL (i.e., add 1 mL for cortical cells; 500 µL for hippocampal and striatal cells; no need to add buffer to cerebellar cells).
  6. Once columns are empty of rinsing buffer, place a 15 mL tube below each column. Load cortical cells (2 mL) onto the LD column, and all others (1 mL each) onto the LS columns. Immediately use 1 mL of MCS buffer each to wash the original tubes and load the solution onto the corresponding columns.
  7. Wash the LD column once with 1 mL of MCS buffer and wash each LS column twice with 1 mL of MCS buffer each wash. Continue to collect the flow-through solution during washing.
  8. Filter cells into round bottom FACS tubes through 35 µm strainer caps.
    NOTE: Each tube should collect about 4 mL of single cell suspension depleted of myelin.
  9. Optionally, take 10 µL of the cell suspension and mix it with 10 µL of 0.4% trypan blue solution. Examine the cells under a 10x bright field microscope to estimate the yield, survival rate and the level of residual myelin.
    NOTE: A successful preparation should generate over 90% live cells (round in shape and excluding the blue dye) with little to no myelin debris.
  10. Pellet cells in the FACS tubes at 400 x g for 5 min at 4 °C, with brake = 5. Slowly pour out supernatant and dab the edge of the tube on tissue paper. Resuspend cells in each tube with 300 µL of FACS buffer.
    NOTE: If MCS sorting is preferred, CD11b beads can be used to select microglia and other myeloid cells following myelin removal. These cells can then be used for non-plate-based scRNA-seq as well as bulk RNA-seq. The caveat of this alternative approach is that CD11b beads do not separate microglia from other related immune cells which are also positive for this antigen.

5. Staining for Fluorescence-activated Cell Sorting

NOTE: This step should take ~40 min.

  1. Add 5 µL of mouse Fc receptors block reagent (Table of Materials) into each tube. Incubate for 5 min on ice.
  2. Add 1 µL of CD45-PE-Cy7 and 1 µL of CD11b-BV421 into each tube.
    NOTE: Antibodies with other conjugated fluorophores may be used. Antibodies against TMEM119, a specific marker for homeostatic microglia9, can also be included, but it is recommended to be used together with CD45 and CD11b, because certain microglia subpopulations may lose TMEM119 surface expression.
  3. Incubate the tubes on a shaker for 10 min at room temperature (RT).
  4. Add 2 mL of FACS buffer to wash.
  5. Pellet cells at 4 °C, 400 x g for 5 min. Slowly pour out supernatant and dab the edge of the tube on tissue paper. Resuspend cells in each tube using 400 µL of FACS buffer with 1 µL of RNase inhibitor and 0.5 µL of propidium iodide (PI, 1:1,000 dilution).

6. Index FACS Sorting

NOTE: This step should take ~1 h.

  1. Following standard FACS procedure, draw gates based on scatter (excluding debris), single cells, live cells (PI negative), microglia and myeloid cells (CD45+, CD11b+).
    NOTE: Typical microglial cells express CD45 at lower levels compared with other border-associated macrophages, such as perivascular and meningeal macrophages, and therefore gating on CD45 low CD11b+ should be sufficient if the focus of the research is gene expression profiles in these classical microglia1,2. However, certain subsets of microglia may have higher CD45 expression and this is particularly true during development or in disease conditions. To ensure unbiased analysis of microglial gene expression, CD45 high and CD45 low immunophenotypes can be recorded through index sorting setting and both populations collected for sequencing and downstream analysis. In addition, TMEM119 surface expression may be used to target the homeostatic microglial population (see step 5.2) and analyzed together with CD45 levels and the sequencing results.
  2. Sort single microglia (with a 100 µm nozzle) into 96-well polymerase chain reaction (PCR) plates, containing 4 µL of lysis buffer each well (see the published protocol14 for details).
    NOTE: The External RNA Control Consortium (ERCC) RNA spike-in mix (Table of Materials) can be added at 1:2.4 x 107 in the lysis buffer for quality control and normalization purposes2.
  3. Briefly vortex the plates and spin down using a bench-top centrifuge.
  4. Immediately freeze the samples on dry ice. Store the plates at -80 °C until library preparation.
    NOTE: Alternatively, more cells can be collected into 1.5 mL tubes with RNA extraction buffer for bulk RNA-seq. According to authors' experience, 3,000 cells are sufficient to generate good quality libraries following the published protocol2,14.

7. Single-cell RNA-sequencing Library Preparation

NOTE: Here, the published protocol14 is followed to generate scRNA-seq libraries with the aid of liquid handling robotics and a few modifications. In this article, the procedure is only briefly described, and the differences are highlighted. Processing 4 plates simultaneously takes about 2.5 days.

  1. Thaw plates on ice and perform reverse transcription with Oligo-dT30VN primer (in the lysis buffer) to generate cDNA with thermal cyclers (Table 1): 42 °C 90 min; 70 °C 5 min; 4 °C hold. Then amplify cDNA with an additional exonuclease digestion step at the beginning (Table 2) using the PCR master mix and in situ PCR (ISPCR) primers (Table of Materials) and the following PCR condition: 37 °C 30 min; 95 °C 3 min; 23 cycles of 98 °C 20 s, 67 °C 15 s, 72 °C 4 min; 72 °C 5 min.
  2. Purify cDNA using 18 µL of magnetic beads per well (0.7:1 ratio). Incubate the plate on a magnetic stand for 5 min and wash samples twice with freshly made 80% ethanol, 80 µL per well each time. After drying the plate for 15-20 min, elute cDNA with 20 µL of elution buffer per well.
    NOTE: For quality control, use a fragment analyzer (high sensitivity next-generation sequencing [NGS] fragment analysis, 1−6,000 bp) to check size distributions and concentrations of cDNA, and only further process samples with a smear between 500−5,000 bp, and higher than 0.05 ng/µL.
  3. To generate libraries, mix 0.4 µL of each cDNA sample with 1.2 µL of Tn5 tagmentation reagents from the library preparation kit (Table of Materials) in a 384-well plate with the aid of a nanoliter pipetting machine, at 55 °C 10 min.
    NOTE: Here, 1/12.5 of the suggested reaction volume (5 µL sample and 15 µL of tagmentation reagents) is added in order to reduce cost and meanwhile increase throughput. A nanoliter pipetting machine (Table of Materials) is used to transfer reagents (this and following steps) from and to 384-well plates.
  4. Add 0.4 µL of neutralization buffer to stop the tagmentation reaction at RT for 5 min.
  5. Add 384 indexes (Table of Materials, 0.4 µL forward and 0.4 µL reverse), 1.2 µL of PCR mix to samples (2 µL each), and amplify the libraries using the following condition: 72 °C 3 min; 95 °C 30 s; 10 cycles of 95 °C 10 s, 55 °C 30 s, 72 °C 1 min; 72 °C 5 min.
  6. Pool all individual libraries (take 1 µL each) from the same 384-well plate together, and use magnetic beads (Table of Materials, 0.7:1 ratio) to purify the final pooled libraries.
  7. Use a fluorometer (Table of Materials) to measure the concentrations and a bioanalyzer (Table of Materials) to examine the size distributions of pooled libraries before sequencing. Target the sequencing depth at 1 million raw reads per cell.
  8. Follow standard bioinformatic procedures to filter and trim sequencing reads and perform alignment2. Use the count table and meta data as inputs to do clustering analysis with the Seurat package15.

Access restricted. Please log in or start a trial to view this content.

Results

This protocol describes a method to isolate and sort microglia from different brain regions in one adult perfused brain hemisphere, followed by scRNA-seq. We use douncing to create single cell suspension and also as a first step to enrich microglia. Insufficient or over-douncing reduces the yield. In addition, adult mouse brains contain high levels of myelin, which can also reduce sorting efficiency and yield if not removed properly. Therefore, we examine the cell suspension under microscope by using trypan blue and a he...

Access restricted. Please log in or start a trial to view this content.

Discussion

Microglia actively interact with other cell types in the CNS, and they are very sensitive to environmental stimuli. In order to minimize inflammatory responses and aberrant changes in their gene expression during the isolation process, this protocol has been streamlined from a previously published method9, and it is now suitable to isolate microglia from multiple regions of a single mouse brain hemisphere in parallel. The tissues and reagents are kept at cold temperature and experiments are perfor...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

We thank Mariko L. Bennett, Liana Nicole Bonanno, and Spyros Darmanis for their help during the development of this protocol. We also thank the Stanford Shared FACS Facility, particularly Meredith Weglarz and Lisa Nichols; Yen Tran, Michael Eckart from Stanford Protein and Nucleic Acid Facility (PAN) for their great support for the filming. This work is funded by the JPB Foundation and Vincent J. Coates Foundation.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
5 M BetaineSigma-AldrichCat# B0300-5VL
10 mM dNTP mixThermo Fisher ScientificCat# R0192
0.5 M EDTA, pH 8.0Thermo Fisher ScientificCat# 15575020
10X Hanks’ Balanced Salt SolutionThermo Fisher ScientificCat# 14185-052
1 M HEPESThermo Fisher ScientificCat# 15630080
1X KAPA HIFI Hotstart Master MixKapa BiosciencesCat# KK2602
5 mL Round Bottom Polystyrene Tube, with Cell Strainer CapCorningCat# 352235
AATI, High Sensitivity NGS Fragment Analysis Kit (1 bp – 6,000 bp)Advanced AnalyticalCat# DNF-474-1000
Bovine Serum AlbuminSigma AldrichCat# A8806
DNase IWorthingtonCat# LS002007Working solution: 12500 units/ml
DTT, Molecular GradePromegaCat# P1171
ERCC RNA Spike-In MixThermo Fisher ScientificCat# 4456740
Fetal Bovine SerumThermo Fisher ScientificCat# 10437-028
Illumina XT Index Kit v2 Set A (96 indexes)IlluminaCat# FC-131-2001
Illumina XT Index Kit v2 Set B (96 indexes)IlluminaCat# FC-131-2002
Illumina XT Index Kit v2 Set C (96 indexes)IlluminaCat# FC-131-2003
Illumina XT Index Kit v2 Set D (96 indexes)IlluminaCat# FC-131-2004
Lambda Exonuclease (5 U/μl)New England BioLabsCat# M0262S
Mouse Fc blockBD PharmingenCat# 553142
Myelin removal beadsMiltenyl BiotecCat# 130-096-433
Nextera XT DNA Sample Prep KitIlluminaCat# FC-131-1096
NextSeq 500/550 High Output Kit v2.5 (150 Cycles)IlluminaCat# 20024907
PBS (10X), pH 7.4Thermo Fisher ScientificCat# 70011044
PCRClean DX beadsAline BiosciencesCat# C-1003-50
Propidium IodideThermo Fisher ScientificCat# P3566Staining: 1:1000
Qubit dsDNA HS Assay KitThermal Fisher ScientificCat# Q32851
Rat monoclonal anti mouse/human CD11b, Brilliant Violet 421 (clone M1/70)BioLegendCat# 101236; RRID: AB_11203704Staining: 1:300
Rat monoclonal anti mouse CD45, PE/Cy7 (clone 30-F11)Thermo Fisher ScientificCat# 25-0451-82; RRID: AB_469625Staining: 1:300
Recombinant RNase InhibitorTakara BioCat# 2313B
SMARTScribe Reverse Transcriptase (100 U/μl)ClontechCat# 639538Containing 5x First strand buffer
Oligonucleotides
0.1 μM ISPCR Oligo: 5' - AAGCAGTGGTATCAA
CGCAGAGT-3'
(Picelli et al., 2014)
Oligo-dT30VN primer: 5' - AAGCAGTGGTATCAACGCA
GAGTACT 30 VN-3'
(Picelli et al., 2014)
TSO 5' - AAGCAGTGGTATCAACGCAGA
GTACATrGrG+G-3' ("r" is forribobases and "+" is for an LNA base)
(Picelli et al., 2014)
Solutions
FACS bufferRecipe: sterile-filtered 1% FBS, 2 mM EDTA, 25 mM HEPES in 1X PBS
MCS bufferRecipe: sterile-filtered 0.5% BSA, 2 mM EDTA in 1X PBS
Medium ARecipe: 15 mM HEPES, 0.5% glucose in 1X HBSS without phenol red
Plates
384-well Rigi-Plate PCR Microplates, Axygen ScientificVWR89005-556
Hard-shell 96-well PCR platesBio-RadHSP9631
Others
Dumont #55 forcepsFine Science Tools11295-51
Dounce homogenizer, 2 mlWheaton357422
Large depletion columnMiltenyi Biotec130-042-901
Large selection columnMiltenyi Biotec130-042-401
MACS MultiStandMiltenyi Biotec130-042-303
QuadroMACS SeparatorMiltenyi Biotec130-090-976
RNAzapThermo Fisher ScientificAM9780
Strainer (70 μm)Falcon352350
Equipment
BD FACSAria IIBD Bioscienceshttp://www.bdbiosciences.com/
BioanalyzerAgilent2100
Fragment AnalyzerAgilent5300
Mosquito HTS nanoliter pipetting robotTTP Labtechhttps://www.ttplabtech.com/
Qubit 4 FluorometerThermo Fisher ScientificQ33226

References

  1. Li, Q., Barres, B. A. Microglia and macrophages in brain homeostasis and disease. Nature Reviews Immunology. 18 (4), 225-242 (2018).
  2. Li, Q., et al. Developmental Heterogeneity of Microglia and Brain Myeloid Cells Revealed by Deep Single-Cell RNA Sequencing. Neuron. 101 (2), 207-223 (2019).
  3. Keren-Shaul, H., et al. A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease. Cell. 169 (7), 1276-1290 (2017).
  4. Bohlen, C. J., et al. Diverse Requirements for Microglial Survival, Specification, and Function Revealed by Defined-Medium Cultures. Neuron. 94 (4), 759-773 (2017).
  5. Guerreiro, R., et al. TREM2 variants in Alzheimer's disease. New England Journal of Medicine. 368 (2), 117-127 (2013).
  6. Jonsson, T., et al. Variant of TREM2 associated with the risk of Alzheimer's disease. New England Journal of Medicine. 368 (2), 107-116 (2013).
  7. Zhang, Y., et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. Journal of Neuroscience. 34 (36), 11929-11947 (2014).
  8. Colonna, M., Butovsky, O. Microglia Function in the Central Nervous System During Health and Neurodegeneration. Annual Review of Immunology. 35, 441-468 (2017).
  9. Bennett, M. L., et al. New tools for studying microglia in the mouse and human CNS. Proceedings of the National Academy of Sciences of the United States of America. 113 (12), 1738-1746 (2016).
  10. Hammond, T. R., et al. Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes. Immunity. 50 (1), 253-271 (2019).
  11. Van Hove, H., et al. A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment. Nature Neuroscience. 22 (6), 1021-1035 (2019).
  12. Chen, G., Ning, B., Shi, T. Single-Cell RNA-Seq Technologies and Related Computational Data Analysis. Frontiers in Genetics. 10, 317(2019).
  13. Svensson, V., et al. Power analysis of single-cell RNA-sequencing experiments. Nature Methods. 14 (4), 381-387 (2017).
  14. Picelli, S., et al. Full-length RNA-seq from single cells using Smart-seq2. Nature Protocols. 9 (1), 171-181 (2014).
  15. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161 (5), 1202-1214 (2015).
  16. Ziegenhain, C., et al. Comparative Analysis of Single-Cell RNA Sequencing Methods. Molecular Cell. 65 (4), 631-643 (2017).
  17. Tabula Muris, C., et al. Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature. 562 (7727), 367-372 (2018).
  18. Bohlen, C. J., Bennett, F. C., Bennett, M. L. Isolation and Culture of Microglia. Current Protocols in Immunology. 125 (1), 70(2018).
  19. Haimon, Z., et al. Re-evaluating microglia expression profiles using RiboTag and cell isolation strategies. Nature Immunology. 19 (6), 636-644 (2018).
  20. Collins, H. Y., Bohlen, C. J. Isolation and Culture of Rodent Microglia to Promote a Dynamic Ramified Morphology in Serum-free Medium. Journal of Visualized Experiments. (133), e57122(2018).
  21. Nikodemova, M., Watters, J. J. Efficient isolation of live microglia with preserved phenotypes from adult mouse brain. Journal of Neuroinflammation. 9, 147(2012).
  22. Swartzlander, D. B., et al. Concurrent cell type-specific isolation and profiling of mouse brains in inflammation and Alzheimer's disease. Journal of Clinical Investigation Insight. 3 (13), 121109(2018).
  23. Hennig, B. P., et al. Large-Scale Low-Cost NGS Library Preparation Using a Robust Tn5 Purification and Tagmentation Protocol. G3. 8 (1), Bethesda. 79-89 (2018).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Microglia IsolationBrain Region DissectionFlow Cytometry SortingMyelin Removal BeadsFACS Buffer PreparationCD45 CD11B StainingCell Viability AssessmentLibrary Preparation ProtocolDeep Sequencing Analysis