Isolering av region-spesifikke Mikroglia fra en voksen mus Brain halvkule for Deep single-celle RNA sekvensering

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi tilbyr en protokoll for isolering av mikroglia fra ulike dissekert regioner av en voksen mus hjerne halvkule, etterfulgt av semi-automatisert bibliotek forberedelse for dyp enkelt celle RNA sekvensering av full lengde transcriptomes. Denne metoden vil bidra til å belyse funksjonell heterogenitet av mikroglia i helse og sykdom.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Zhou, L., Li, Q. Isolation of Region-specific Microglia from One Adult Mouse Brain Hemisphere for Deep Single-cell RNA Sequencing. J. Vis. Exp. (154), e60347, doi:10.3791/60347 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Som bosatt makrofager i det sentrale nervesystemet, mikroglia aktivt kontrollere hjernens utvikling og homeostase, og deres dysfunksjoner kan drive menneskelige sykdommer. Det er gjort betydelige fremskritt for å avdekke de molekylære signaturene av homøostatisk mikroglia samt endringer av deres genuttrykk som svar på miljømessige stimuli. Med bruk og modning av single-Cell genomisk metoder, er det stadig mer anerkjent at heterogene mikroglia kan ligger til grunn de ulike rollene de spiller i ulike utviklingsmessige og patologiske forhold. Ytterligere Disseksjon av slike heterogenitet kan oppnås gjennom effektiv isolering av mikroglia fra en gitt region av interesse, etterfulgt av følsom profilering av individuelle celler. Her gir vi en detaljert protokoll for rask isolering av mikroglia fra ulike hjernens regioner i en enkelt voksen mus hjerne halvkule. Vi viser også hvordan du bruker disse sorterte mikroglia for plate BAS ert, dyp enkelt celle RNA-sekvenser. Vi diskuterer tilpasning av denne metoden til andre scenarier og gir retningslinjer for å forbedre systemet for å imøtekomme store studier.

Introduction

Mikroglia, som representerer 5% − 10% av alle nevrale celler, er bosatt makrofager spredt over hele det sentrale nervesystemet (CNS)1. Beskyttet bak blod-hjerne barriere, typisk mikroglia i en sunn voksen hjernen inneholder mange fine prosesser som raskt utvide og trekke seg tilbake til å samhandle med neurons og andre gliacellene celler i parenchyma. Mikroglia kan også vedta Amoeboid morfologi forbundet med økt phagocytic funksjon under bestemte utviklingstrinn eller på immun utfordringer i skade og sykdom1,2,3,4. Nylige spennende oppdagelser har tydelig vist at mikroglia er på ingen måte passive tilskuere til hjerne-avledet eller patologiske signaler, men spiller avgjørende roller i å kontrollere hjernens utvikling og homeostase, for eksempel ved å støtte neuronal overlevelse, beskjæring umodne synapser, fremme oligodendrocyte avstamning celler differensiering samt angiogenese1. Som flere funksjoner mikroglia er belyst, spenningen er ytterligere fueled av Human genetikk studier, som viste at mange nevrodegenerative sykdom risiko gener, som TREM2, er overveiende eller utelukkende uttrykt av mikroglia5,6,7. Gitt sin betydning i utvikling og sannsynlig sykdom-kjøring roller, har enorm innsats nylig blitt satt mot vår forståelse av mikrogliaaggregater gen regulering og funksjon i håp om å finne nye terapeutiske mål for nevrodegenerative sykdommer1,8.

RNA sekvensering (RNA-SEQ) tillater objektiv karakterisering av celle type-spesifikke genuttrykk, som i sin tur veileder forskere til å undersøke gen funksjoner i tette mobilnettverk7. RNA-SEQ hadde vært stort sett gjort på bulk prøver, fører til oppdagelsen av en homøostatisk mikrogliaaggregater gen signatur som skiller dem fra andre nevrale og immune celler9. Imidlertid kan en slik tilnærming overse molekylære og funksjonelle forskjeller blant mikroglia, spesielt de midlertidig stede i utvikling, eller forbundet med aldring og sykdom. Faktisk, enkelt celle RNA-SEQ (scRNA-SEQ) tilbyr følsomhet og oppløsning som har revolusjonert feltet ved å avsløre tidligere underappreciated heterogenitet av mikroglia i en rekke sammenhenger2,3,10. I tillegg, på grunn av tilstedeværelsen av andre lignende immunceller på CNS-sirkulasjon grensesnitt, scRNA-SEQ gir informasjon hjelpe utformingen av nye verktøy for å skille og funksjonelt analysere disse relaterte celler med litt tidligere kunnskap2,11.

En mangfoldig oppstille av scRNA-SEQ plattform ha blitt konstruere, hver egnet til bestemt søknadene12. Generelt er dråpe BAS ert metoder, for eksempel 10x Genomics, høyere i gjennomstrømming med (titusenvis av) celler sekvensielt i hver kjøring, og de er mindre selektive for innspill som kan inneholde blandet celle populasjoner som krever bred kategorisering. Plate BAS ert metoder gir høyere følsomhet og lese dybde13,14, vanligvis rettet mot bestemte populasjoner fra celle sortering for å avdekke subtile forskjeller eller sjeldne transkripsjoner. Gitt den lille prosentandelen av mikrogliaaggregater celler, spesielt de utvikling-eller sykdoms-assosiert subpopulasjoner, blant alle CNS celletyper, er det ofte ønskelig å isolere mikroglia fra en bestemt region av interesse og få dyp og full-lengde transcriptomic informasjon for å forstå deres heterogenitet.

Her gir vi informasjon om hvordan du isolerer mikroglia fra ulike mus hjernen regioner dissekert fra en enkelt halvkule, som brukes for én celle (eller bulk) RNA-SEQ etter en semi-automatisert plate-basert bibliotek forberedelse prosedyre. Den andre halvkule kan deretter brukes til histologiske validering. Strømlinjeformet fra en tidligere publisert metode9, denne isolasjons protokollen har som mål å maksimere avkastningen fra små mengder av Start materialer, og i mellomtiden opprettholde endogene mikrogliaaggregater genuttrykk profiler. Vi bruker fluorescens-aktivert celle sortering (FACS) for å berike mikroglia (eller andre relaterte immunceller av interesse) i 96-brønn plater og miniaturize volumene av reagenser for biblioteks forberedelser for å øke gjennomstrømningen. Vi fremhever denne følsomme scRNA-SEQ-plattformen, selv om andre plate-baserte strategier kan brukes. Denne metoden kan lett tilpasses til å isolere mikroglia fra andre dissekert vev, slik som skade eller sykdoms prioriteringer, og alder av musen kan variere over nesten alle postnatal etapper. Effektiv isolering av regionale mikroglia for enkelt celle transcriptomics studier vil gjøre det lettere å forstå deres funksjoner i helse og sykdom.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle prosedyrer som involverer gnagere likedannet til Stanford University retningslinjer, som overholder nasjonale og statlige lover og retningslinjer. Alle dyr prosedyrer ble godkjent av Stanford University ' s administrative panel på laboratorium Animal Care.

Merk: Alle løsninger og buffer komposisjoner er gitt i tabell over materialer.

1. forberedelse på dagen for Cell Isolation

  1. Klargjør følgende reagenser og chill dem på is: medium A (50 mL), magnetisk-aktivert celle sortering (MCS) buffer (30 mL), FACS buffer (25 mL), fosfat-bufret saltvann (PBS; 30 mL), DNase (320 μL), og RNase-hemmer (30 μL).
    Merk: Volumene som er gitt her er tilstrekkelige til å isolere mikroglia fra 4 hjerneområder (f.eks. cortex, lillehjernen, hippocampus og striatum) av en enkelt mus hjerne halvkule. Skaler opp hvis mer vev brukes.
  2. Plasser fire rene 2 mL Dounce homogenisatorer på is og tilsett 2 mL medium A med 80 μL av DNase (12 500 enheter/mL) og 5 μL av RNase-hemmere i hver Dounce-homogenisator. Chill stemplene i 15 mL rør.
  3. Label fire 6 cm Petri retter med hjernen regioner for vev samling og tilsett 200 μL av kaldt medium A i hver tallerken på isen. Tilsett ca 5 mL medium A i en 6 cm Petri parabolen for disseksjon.
    Merk: Kontroller at alle reagenser er sterile og egnet for RNA-programmer før bruk. Benk-og disseksjon verktøy må være rene og sprayet med RNase rense løsning (tabell av materialer).

2. Brain region disseksjon

Merk: Dette trinnet bør ta ~ 30 min.

  1. Injiser 400 − 500 μL av ketamin/xylazine (24 mg/mL ketamin og 2,4 mg/mL xylazine) inn i peritoneum til en ung til voksen scene mus (> 1 mnd gammel).
    Merk: En mannlig mus brukes her for illustrasjon, men enten kjønn er egnet.
  2. Vent i 5 min og knip en bakben for å sikre manglende tilbaketrekking.
  3. Bruk umiddelbart en 26 G x 3/8 nål for å utføre transcardial med 20 − 30 mL iskald PBS til bufferen renner ut uten synlig blod.
  4. Halshugge musen med et par kirurgiske saks. Bruk små saks for å kutte åpne huden for å avdekke undersiden skallen, og deretter skjære gjennom sagittal Sutur, lambdoidal Sutur og koronale Sutur. Bruk tang til å trekke av begge sider av parietal bein og interparietal bein uten å skade vevet, og forsiktig flytte hjernen inn i disseksjon Petri parabolen med medium A.
  5. Bruk en pre-kjølt blad for å kutte hjernen gjennom midtlinjen i to halvkuler.
    Merk: De fire hjerne regionene som er beskrevet her fra en enkelt halvkule, gir et tilstrekkelig antall mikroglia for enkelt celle-eller bulk RNA-SEQ-programmer. Den andre halvkule kan brukes til immunhistokjemi eller RNA in situ validering.
  6. Skill lillehjernen fra kortikale flik og hjernestammen med #55 tang og overføre vevet inn i en samling Petri parabolen.
  7. Bruk #55 tang å nøye analysere ut hippocampus og striatum fra cortex og overføre hvert vev i en samling Petri parabolen.

3. mekanisk vev dissosiasjon

Merk: Hold celler og reagenser kjølige hele tiden unntatt under farge trinnene. Dette trinnet bør ta ~ 30 min.

  1. Hakk hvert hjernevev med et barberblad i < 1 mm3 fine stykker.
  2. Bruk 1 mL pipette (med tips avskåret) for å overføre vev brikker i pre-kjølt Dounce homogenisatorer, hver inneholder 2 mL medium A med DNase og RNase inhibitor.
  3. Homogenisere vevet ved langsomt å vri stempelet inn og ut av Dounce-homogenisator for 6 − 10 fulle slag, til det ikke finnes synlige deler.
    Merk: Douncing dreper neurons og de fleste andre gliacellene celler, men la mikrogliaaggregater celler heller intakt. Både utilstrekkelig og over-douncing kan føre til lav avkastning av celler.
  4. Overfør dissosiert vev inn i 50 mL rør gjennom 70 μm siler.
  5. Skyll hver Dounce homogenisator og stempel med totalt 6 mL kaldt medium A og Filtrer skylle løsningen gjennom samme sil inn i det tilsvarende røret.
  6. Overfør enkelt celle suspensjoner (ca. 8 mL hver) inn i 15 mL koniske rør og sentrifuger ved 400 x g i 5 min ved 4 ° c med brems = 5.

4. fjerning av myelin

Merk: Dette trinnet bør ta ~ 60 min.

  1. Klargjør 1 stor tømming (LD) kolonne (for cortex) og 3 store utvalg (LS) kolonner (for de andre 3 regionene) i et magnetisk skilletegn (tabell av materialer). Skyll hver kolonne med 3 mL MCS-buffer.
  2. Når sentrifugering er ferdig, Pipetter ut og kast supernatanten uten å forstyrre pellet. For cortex og lillehjernen vev, resuspend celler i 850 μL av MCS buffer med 1,8 μL av RNase-hemmer. For hippocampus og striatum vev, resuspend celler i 400 μL av MCS buffer med 0,9 μL av RNase-hemmer.
    Merk: Kolonnene (LD kontra LS) og volumet som brukes for blanding er optimalisert basert på mengden av myelin som finnes i vevet. Hvis andre hjerneområder er analyseres, kan disse forholdene må justeres avhengig av størrelsen på vevet og hvor mye myelin kan eksistere. Effektiviteten av myelin fjerning kan anslås i trinn 4,9.
  3. Tilsett 100 μL av myelin fjerning perler hver i celler fra cortex og lillehjernen og tilsett 50 μL av myelin fjerning perler hver i celler fra hippocampus og striatum.
  4. Bland forsiktig cellene med perler og ruge rørene på isen i 10 min.
  5. Bring volumet av røret med kortikale celler til 2 mL med MCS buffer, og alle andre til 1 mL (dvs. Tilsett 1 mL for kortikale celler; 500 μL for hippocampus og stria tale celler, trenger ikke å legge buffer til lillehjernen celler).
  6. Når kolonnene er tomme for skylle buffer, plasserer du et 15 mL rør under hver kolonne. Legg kortikale celler (2 mL) på LD-kolonnen, og alle andre (1 mL hver) på LS-kolonnene. Bruk umiddelbart 1 mL MCS buffer hver for å vaske de originale rørene og laste løsningen på tilsvarende kolonner.
  7. Vask LD-kolonnen én gang med 1 mL MCS-buffer og vask hver LS-kolonne to ganger med 1 mL MCS-buffer hver vask. Fortsett å samle den gjennomstrømnings løsning under vask.
  8. Filtrer celler i runde bunn FACS rør gjennom 35 μm sil caps.
    Merk: Hvert rør skal samle ca 4 mL av enkelt celle suspensjon utarmet av myelin.
  9. Du kan også ta 10 μL av celle fjæringen og blande den med 10 μL av 0,4% trypan blå oppløsning. Undersøk cellene under et 10x skarpt felt mikroskop for å anslå utbyttet, overlevelsesraten og nivået av gjenværende myelin.
    Merk: En vellykket forberedelse skal generere over 90% levende celler (rund i form og unntatt den blå fargestoff) med liten eller ingen myelin rusk.
  10. Pellet celler i FACS rør ved 400 x g i 5 min ved 4 ° c, med brems = 5. Langsomt helle ut supernatanten og DAB kanten av røret på silkepapir. Resuspend celler i hvert rør med 300 μL av FACS buffer.
    Merk: Hvis MCS sortering foretrekkes, CD11b perler kan brukes til å velge mikroglia og andre myelogen celler etter myelin fjerning. Disse cellene kan deretter brukes til ikke-plate-baserte scRNA-SEQ samt bulk RNA-SEQ. Den påminnelse om denne alternative tilnærmingen er at CD11b perler ikke skille mikroglia fra andre relaterte immunceller som også er positive for dette antigen.

5. farging for fluorescens-aktivert Cell sortering

Merk: Dette trinnet bør ta ~ 40 min.

  1. Tilsett 5 μL av mus FC reseptorer blokkere reagens (tabell av materialer) i hvert rør. Ruge i 5 minutter på isen.
  2. Tilsett 1 μL av CD45-PE-Cy7 og 1 μL av CD11b-BV421 i hvert rør.
    Merk: Antistoffer med andre bøyd fluorophores kan brukes. Antistoffer mot TMEM119, en bestemt markør for homøostatisk mikroglia9, kan også inkluderes, men det anbefales å brukes sammen med CD45 og CD11b, fordi visse mikroglia subpopulasjoner kan miste TMEM119 overflate uttrykk.
  3. Ruge rørene på en shaker i 10 minutter ved romtemperatur (RT).
  4. Tilsett 2 mL FACS buffer å vaske.
  5. Pellet celler ved 4 ° c, 400 x g i 5 min. langsomt helle ut supernatanten og DAB kanten av røret på silkepapir. Resuspend celler i hvert rør med 400 μL av FACS-buffer med 1 μL av RNase-hemmer og 0,5 μL av propidium iodide (PI, 1:1000 fortynning).

6. indeks FACS sortering

Merk: Dette trinnet skal ta ~ 1 t.

  1. Etter standard FACS prosedyre, tegne porter basert på scatter (unntatt rusk), enkeltceller, levende celler (PI negative), mikroglia og myelogen celler (CD45+, CD11b+).
    Merk: Typiske mikrogliaaggregater celler uttrykker CD45 på lavere nivåer sammenlignet med andre Border-tilknyttede makrofager, som inflammasjon og meningeal makrofager, og derfor gating på CD45 lav CD11b+ bør være tilstrekkelig Hvis fokuset for forskningen er genuttrykk profiler i disse klassiske mikroglia1,2. Visse delsett av mikroglia kan imidlertid ha høyere CD45 uttrykk, og dette gjelder spesielt under utvikling eller sykdoms forhold. For å sikre objektiv analyse av mikrogliaaggregater genuttrykk, kan CD45 høy og CD45 lav immunophenotypes registreres gjennom indeks sorterings innstilling og begge populasjoner samlet for sekvensering og nedstrøms analyse. I tillegg kan TMEM119 overflate uttrykk brukes til å målrette den homøostatisk mikrogliaaggregater populasjonen (se trinn 5,2) og analyseres sammen med CD45 nivåer og resultatene av sekvensering.
  2. Sorter enkelt mikroglia (med et 100 μm-munnstykke) til 96-vel polymerase kjede reaksjons plater (PCR), som inneholder 4 μL av lyseringsbuffer hver brønn (se den publiserte protokoll14 for detaljer).
    Merk: Den eksterne RNA Control Consortium (ERCC) RNA Spike-in mix (innholdsfortegnelsen) kan legges til ved 1:2.4 x 107 i lyseringsbufferen for kvalitetskontroll og normalisering formål2.
  3. Kort Vortex platene og spinne ned ved hjelp av en benk-Top sentrifuger.
  4. Umiddelbart fryse prøvene på tørr is. Oppbevar platene på-80 ° c til biblioteket forberedes.
    Merk: Alternativt kan flere celler samles inn i 1,5 mL rør med RNA utvinning buffer for bulk RNA-SEQ. Ifølge forfatterne erfaring, 3 000 celler er tilstrekkelig til å generere god kvalitet biblioteker etter den publiserte protokollen2,14.

syvende single-Cell RNA-sekvensering bibliotek forberedelse

Merk: Her, den publiserte protokollen14 er fulgt for å generere scRNA-SEQ biblioteker ved hjelp av flytende håndtering robotikk og noen modifikasjoner. I denne artikkelen er fremgangsmåten bare kort beskrevet, og forskjellene er uthevet. Processing 4 plater tar samtidig ca 2,5 dager.

  1. Tin platene på is og utfør omvendt transkripsjon med oligo-dT30VN primer (i lyseringsbuffer) for å generere cDNA med termisk cyclers (tabell 1): 42 ° c 90 min; 70 ° c 5 min; 4 ° c hold. Forsterk deretter cDNA med et ekstra exonuclease fordøyelsen trinn i begynnelsen (tabell 2) ved hjelp av PCR Master mix og in situ PCR (ISPCR) primere (tabell av materialer) og følgende PCR tilstand: 37 ° c 30 min; 95 ° c 3 min; 23 sykluser med 98 ° c 20 s, 67 ° c 15 s, 72 ° c 4 min; 72 ° c 5 min.
  2. Rens cDNA med 18 μL magnetiske perler per brønn (0,7:1 forhold). Ruge platen på et magnetisk stativ i 5 min og vask prøvene to ganger med fersk laget 80% etanol, 80 μL per brønn hver gang. Etter tørking av platen i 15-20 min, eluere cDNA med 20 μL av eluering buffer per brønn.
    Merk: For kvalitetskontroll, bruk en fragment analysator (høy følsomhet neste generasjons sekvensering [NGS] fragment analyse, 1 − 6000 BP) for å kontrollere størrelses fordelinger og konsentrasjoner av cDNA, og bare videre prosess prøver med en smøre mellom 500 − 5000 BP, og høyere enn 0,05 ng/μL.
  3. For å generere biblioteker, bland 0,4 μL av hver cDNA prøve med 1,2 μL av Tn5 tagmentation reagenser fra biblioteket Preparation Kit (tabell av materialer) i en 384-brønn plate ved hjelp av en nanoliter pipettering maskin, ved 55 ° c 10 min.
    Merk: Her tilsettes 1/12.5 av det foreslåtte reaksjons volumet (5 μL prøve og 15 μL av tagmentation reagenser) for å redusere kostnadene og i mellomtiden øke gjennomstrømningen. En nanoliter pipettering maskin (innholdsfortegnelsen) brukes til å overføre reagenser (denne og følgende trinn) fra og til 384-brønn plater.
  4. Tilsett 0,4 μL av nøytralisering buffer for å stanse tagmentation reaksjonen ved RT i 5 min.
  5. Legg til 384 indekser (tabell med materialer, 0,4 μL fremover og 0,4 μL revers), 1,2 ΜL av PCR-miks til prøver (2 μL hver), og Forsterk bibliotekene ved hjelp av følgende tilstand: 72 ° c 3 min; 95 ° c 30 s; 10 sykluser på 95 ° c 10 s, 55 ° c 30 s, 72 ° c 1 min; 72 ° c 5 min.
  6. Pool alle individuelle biblioteker (ta 1 μL hver) fra samme 384-brønn plate sammen, og bruk magnetiske perler (tabell av materialer, 0,7:1 ratio) for å rense den endelige samlede bibliotekene.
  7. Bruk en fluorometer (tabell med materialer) til å måle konsentrasjonen og en Bioanalyzer (tabell med materialer) for å undersøke størrelsesfordelingen av grupperte biblioteker før sekvensering. Mål sekvensering dybden på 1 000 000 rå leser per celle.
  8. Følg standard Bioinformatic prosedyrer for å filtrere og trimme sekvensering leser og utføre justering2. Bruk telle tabellen og meta data som innganger til å gjøre Clustering analyse med Seurat pakke15.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Denne protokollen beskriver en metode for å isolere og sortere mikroglia fra forskjellige hjerneområder i en voksen perfusert hjerne halvkule, etterfulgt av scRNA-SEQ. Vi bruker douncing til å lage enkelt celle oppheng og også som et første skritt for å berike mikroglia. Utilstrekkelig eller over-douncing reduserer utbyttet. I tillegg voksen mus hjerner inneholder høye nivåer av myelin, som også kan redusere sortering effektivitet og yield hvis ikke fjernes riktig. Derfor undersøker vi celle fjæringen under mikroskop ved å bruke trypan blå og en hemocytometer for å estimere avkastningen, celle levedyktigheten og effekten av myelin fjerning (trinn 4,9) før du utfører antistoff farging (figur 1). Totalt antall celle tellinger på dette punktet bør være over 30 000 for cortex, og over 5 000 for andre vev. Over 90% av cellene bør være levedyktig med lite myelin rusk.

Vi bruker en FACS maskin for å sortere mikroglia (eller myelogen celler), som vanligvis er CD45 lav og CD11b positive. Minst for kortikale vev, vellykket isolasjon bør generere over 80% mikroglia ut av alle live enkeltceller (figur 2). Den døende/døde befolkning representerer bare en liten brøkdel av preparatet (rundt 10%).

Når de enkelte mikroglia er tatt inn i lyseringsbufferen, frigjøres RNA, og deretter blir det omvendt kopiert til cDNA, som deretter forsterkes i 23 sykluser. Det er viktig å sjekke kvaliteten på disse cDNA prøvene-minst en del av dem-før du gjør bibliotekene. Som en kapillær elektroforese plattform, fragment analysator og høysensitiv NGS fragment kits (1 − 6000 BP) gir rask og nøyaktig informasjon om størrelsesfordeling, samt mengde cDNA molekyler til stede i hver brønn av en 96-brønn plate (Figur 3a). Prøver som viser en smøre (500 − 5000 BP) og over visse konsentrasjons terskel (f.eks. 0,05 ng/μL) kan brukes til å lage biblioteker. På samme måte bør de grupperte bibliotekene testes på en bioanalyzer før sekvensering (Figur 3B).

Vi sekvens prøvene til en dybde på over 1 000 000 rå leser per celle, som Metter deteksjons kraften i denne scRNA-SEQ metodikk16. Med ca 60% kartlegging rente, over 2 000 gener per mikrogliaaggregater celle kan oppdages. Vi fikk publisert data som ble generert ved hjelp av denne isolasjons metoden17, og demonstrerer reproduserbarheten fra uavhengige eksperimenter og følsomhet for å påvise mikroglia gener på tvers av den sekvensert populasjonen (Figur 4).

Figure 1
Figur 1: estimering av mikroglia isolasjon yield, celle levedyktighet og effektiviteten av myelin fjerning. Den venstre panel viste lyse feltet bildet (4X forstørrelse) av trypan blå farget celler (fra cortex) etter å ha passert gjennom myelin fjerning kolonner. Resultater for andre regioner vil se like ut, men med færre celler. De aller fleste (om ikke alle) av celler dukket opp lyse (ikke-farget) og runde på grunn av tap av prosesser. Det riktige bildet var Zoom inn (20x) av eske området og lite myelin rusk var til stede. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: Gates som brukes til å sortere mikroglia. Data viste gating strategi for sortering av mikroglia fra cortex, og den samme strategien ble brukt for andre regioner. Celle rusk ble først ekskludert fra scatter tomten, og enkeltceller var inngjerdet av Forward scatter-området (FSC-A)/Forward scatter-bredde (FSC-W). Levende celler ble inngjerdet av PI negative flekker, som var fra ca 90% av alle enkeltceller. Mikroglia, representerer cirka 80% av bo celler, var sorterte fra det CD45 lav CD11b + gate. Totalt ~ 30 000 mikroglia kunne isoleres og sorteres fra cortex vev (fra en halvkule av en 3-måneders gammel mus). Indeks sorteringen ble utført på en FACS-maskin. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3

Figure 3
Figur 3: representative kvalitetskontrollresultater for forsterket cDNA fra en enkelt mikrogliaaggregater celle og en eventuell gruppert bibliotek. (A) ved hjelp av en fragment analysator, er alle fragmenter plottet med sine størrelser på X-aksen, og relative fluorescens intensitet på Y-aksen, som betegner overflod av en gitt størrelse cDNA. LM (nedre markør, 1 BP) og UM (øvre markør, 6 000 BP) laster markører med kjente konsentrasjoner som brukes for å måle cDNA-antall. Vellykket forsterket cDNA fra en representativ mikrogliaaggregater celle danner en kurve (grønn stiplet linje) på størrelsesfordelingen grafen eller en smøre (merket brakett) på gel grafen mellom 500 BP og 5 000 BP. Andre merkede topper ble forsterket fra ERCC Spike-in molekyler eller ribosomal RNA. Konsentrasjonen av cDNA mellom 500 BP og 5 000 BP kan være kvantifisert, og disse prøvene med konsentrasjoner høyere enn 0,05 ng/μL og viser slike typiske kurver beholdes for biblioteket forberedelse. RFU, relativ fluorescens enhet. (B) representativ kvalitetskontroll resultat på en bioanalyzer som viser størrelsesfordelingen av et endelig gruppert bibliotek (med omtrent 380 celler). Vanligvis spenner det fra 200 BP til 2 000 BP med en gjennomsnittlig størrelse på 400-600 BP. De to skarpe toppene var lasting markører. FU, fluorescens enhet. Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: scRNA-SEQ analyse av mikroglia isolert fra 4 hjernen regioner av to mannlige mus. (A) tSNE plot viser blandet mønster av regionale mikroglia (bare celler fra mus #1 ble uthevet). De ikke danner distinkte klynger i henhold til regionen opprinnelse utover subtile skifte i konsentrerte områder på tSNE tomten (muligens på grunn av batch-effekter). Denne observasjonen er forenlig med begrenset Regional heterogenitet av mikroglia basert på global genuttrykk i den voksne mus (se en fersk publikasjon2 for videre diskusjon om dette emnet). (B) tSNE plot viser overlappende mønster av mikroglia fra to individuelle mus som ble behandlet uavhengig. Selv om små satsvise effekter kan eksistere (celler konsentrere seg i visse områder av plottet), disse cellene ikke danner distinkte klynger i henhold til animalsk opprinnelse. Dette resultatet tyder på reproduserbarhet for protokollen for å sammenligne data mellom eksperimenter. (C) uttrykk for mikroglia signatur gener oppdaget av scRNA-SEQ viser over 95% oppdagelsen rate for spesifikke markører, slik som Tmem119 og P2ry12, og over 80% oppdagelsen rate for kjente transkripsjon faktorer som Sall1 og PU. 1. Dataene ble re-analysert fra publisert litteratur17. (D) store flertallet av isolerte mikroglia mangler uttrykk for gener som er spesifikke for andre celletyper, for eksempel Tubb3 (neurons), Aldh1l1 (astrocytter), Gjb1 (oligodendrocytes) og Tie1 (endothelial celler). (E) uttrykk for gener relatert mikrogliaaggregater aktivering eller stress. Klassiske markører, TNF, Il1b, Nos2, og Nfkb2, som er ydmyk uttrykt, vises på toppen. Tidlige reaksjons gener, Egr1 og Fosvises nederst (se diskusjon). Vennligst klikk her for å se en større versjon av dette tallet.

Reagens Volum (μL)
Cellelyse 4
Omvendt transkriptase (100 U/μL) 0,95
Rnase-hemmer 0,25
5x første strand buffer 2
Dithiotreitol (DTT; 100 mM) 0,5
Betaine (5 M) 2
MgCl2 (1 M) 0,06
Mal-bryter oligo (TSO; 100 μM) 0,1
H2O 0,14
Totalt 10

Tabell 1: omvendt transkripsjon tilstand. Reagens volumer for en omvendt transkripsjon reaksjon er gitt.

Reagens Volum (μL)
Omvendt transkripsjon produkt 10
2x PCR Master Mix 12,5
ISPCR primer (10 μM) 0,25
Lambda exonuclease 0,1125
H2O 2,1375
Totalt 25

Tabell 2: PCR forsterknings tilstand. Reagens volumer for en PCR forsterkning av cDNA fra en enkelt celle er gitt.

Plate BAS ert (denne protokollen) Dråpe BAS ert (10x Genomics)
Følsomhet Flere gener oppdaget Færre gener oppdaget
Full lengde ja Nei (5 ' eller 3 ' slutten)
Fleksibilitet for celle tall/populasjoner Egnet for karakterisering av små eller sjeldne subpopulasjoner Passer for bred kategorisering av store celle populasjoner
Gjennomstrømming Opptil flere tusen celler Hundrevis til titusenvis av celler
Unik molekyl-ID nei ja
Kostnad per celle $1 − $5 mindre enn $1
Eksperimentell vanskelighetsgrad Flere trinn og krever vanligvis væskehåndtering robotikk Enkel å utføre med kommersialisert maskiner
Celle populasjoner Målrettet av FACS sortering Upartisk

Tabell 3: sammenligning mellom plate BAS ert og dråpe BAS ert scRNA-SEQ-metoder. I denne artikkelen, den plate-baserte full lengde scRNA-SEQ prosedyren er gitt, som har fordelene med høyere følsomhet, full lengde sekvensering og fleksibilitet for lite antall celler som innganger. Dråpe BAS ert metoder gir fordeler av høyere gjennomstrømning, lavere kostnad, enkel å utføre og data i unike molekylære identifikatorer. De er komplementære avhengig av formålet med eksperimentene.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Mikroglia aktivt samhandle med andre celletyper i CNS, og de er svært følsomme for miljømessige stimuli. For å minimere inflammatoriske reaksjoner og avvikende endringer i deres genuttrykk i løpet av isolasjons prosessen, har denne protokollen blitt strømlinjeformet fra en tidligere publisert metode9, og det er nå egnet til å isolere mikroglia fra flere regioner av en enkelt mus hjerne halvkule parallelt. Vev og reagenser holdes ved kald temperatur og eksperimenter utføres innen rimelig tid (ca 3,5 h fra disseksjon til sortering) med færre vasker og mindre reagenser basert på begrensede vevs størrelser. Vi velger douncing over andre homogenisering metoder, slik som enzymatisk fordøyelse, fordi mekaniske dissosiasjon kan drepe og dermed fjerne neurons og andre gliacellene celler mens forårsaker liten skade eller aktivering til mikroglia9,18. Over-douncing, men kan redusere utbyttet av mikroglia og bør unngås. Det har tidligere blitt vist at mekaniske dissosiasjon og perler-baserte myelin fjerning etterfulgt av FACS sortering innføre mindre aktivisering å mikroglia, basert på minimal uttrykk for klassiske inflammatoriske gener, for eksempel, TNF, Il1b, Nos2, og Nfkb29 (Figur 4e). Likevel kan mikroglia fortsatt svare på ex vivo-forholdene under dissosiasjon og sortering ved oppregulering tidlige reaksjons gener som Fos og Egr1 (Figur 4E), som vanligvis ikke uttrykkes av mikroglia in vivo2,19, og slike endringer fra transcriptomic studier bør alltid valideres på histologi seksjoner.

Her gir vi prosedyrer for å isolere mikroglia fra cortex, lillehjernen, hippocampus og striatum fra en voksen muse hjerne halvkule, og denne protokollen kan enkelt tilpasses til andre regioner eller etapper. Dette er nyttig for situasjoner, for eksempel når sykdoms-berørte mikroglia er begrenset til visse områder av hjernen som kan dissekert ut, eller i aldring studier, der pooling prøvene er upassende på grunn av betydelige individuelle variasjoner. Med tilgjengeligheten av antistoffer mot mikrogliaaggregater (eller Pan medfødt immun) epitopes, denne protokollen kan også tilpasses for å isolere mikroglia i rotte eller menneskelig vev9. Når du justerer for større eller eldre vev, er det viktig å vurdere og teste volumet av myelin og hvilken type kolonner som brukes. En alternativ tilnærming for myelin fjerning er ved tetthet gradient sentrifugering i kommersielle lav viskositet Media20. Samlet disse to metodene er sammenlignbare i sin effektivitet, selv om tettheten gradient sentrifugering metoden kan gi litt høyere avkastning, og på den annen side, magnetiske perler metoden er mindre sannsynlighet for å innføre endotoksiner, som kan aktivere mikroglia21,22.

På grunn av den lille prosentandelen av mikroglia blant totale hjerneceller, er det ofte viktig å berike eller rense mikroglia før du utfører enkelt celle transcriptomic studier. Vi bruker FACS som en følsom tilnærming for å fange ydmyk representert celletyper, og velg mikroglia basert på CD11b og CD45 overflate uttrykk. Fra en halvkule, vi rutinemessig få ~ 30 000 mikroglia for cortex, og ~ 5 000 mikroglia for lillehjernen, hippocampus eller striatum. Disse rentene er tilstrekkelige for de fleste enkelt celle applikasjoner, samt bulk RNA-SEQ (3 000 eller flere celler kan brukes). Det er verdt å nevne at mikroglia kan upregulate CD45 immunoreactivity under utbygging eller sykdom2, i så fall celler med både lave og høye nivåer av CD45 bør registreres og indeks sorteres for analyse. Et annet alternativ for berikende mikroglia er å bruke CD11b perler-mediert magnetisk-aktivert celle sortering etter myelin fjerning, men dette ville begrense scRNA-SEQ til dråpe metoder.

For å studere mikrogliaaggregater genuttrykk ved en enkelt celle oppløsning, sorterer vi vanligvis celler i minst 2 − 3 96-brønn plater per prøve og utfører biblioteks forberedelser med væske håndteringsmaskiner. Det har blitt vist at denne plate-baserte full-lengde biblioteket forberedelse tilnærming er en av de mest følsomme scRNA-SEQ metoder i deteksjon grense, slik at nøyaktig kvantifisering av sjeldne transkripsjoner, for eksempel transkripsjon faktorer13,14,16. På grunn av full lengde sekvensering, denne tilnærmingen er ikke underlagt 5 ' eller 3 ' bias og kan brukes til å analysere skjøting varianter (tabell 3). I tillegg, i motsetning til dråpe BAS ert metoder, som vanligvis krever hundrevis eller tusenvis av celler i en reaksjon, har denne plate-baserte protokollen fleksibiliteten til å inkludere et lite antall celler i hvert eksperiment, og gradvis utvide Befolkningsstørrelsen ved å legge til flere plater i utformingen senere. Dette er en fordel når man studerer små undergrupper av mikroglia i visse forhold som embryoutvikling.

Stund denne protokollen reproduserbar utvikler høy-kvalitet scRNA-SEQ biblioteker for hjerne område mikroglia, det er en ofte bare egnet til liten-skalaen studier på grunn av det relativt høy bekostning (om $5/cellen for bibliotek forberedelse, fremdeles billigere enn $23/cellen hvis benytter det av det hylle SmartSeq v4 utstyr). Flere strategier kan bidra til å redusere kostnadene og øke gjennomstrømningen. Først kan celler sorteres i 384-brønn plater med så lite som 0,5 μL av lyseringsbuffer, og dette krever bare 1/8 reagens volumer for den første omvendte transkripsjon og PCR forsterkning trinn. For det andre er det mulig å produsere in-House Tn5 transposase som har lignende kvalitet som den i en kommersielt tilgjengelig Kit23. Disse to modifikasjoner kan redusere bibliotekets forberedelse kostnadene ned til $1/Cell. Tredje, ved hjelp av tilpassede indekser, kan tusenvis av celler samles sammen for sekvensering på et system uten å ofre sekvensering dybden (> 1 million leser/celle)17. Disse forbedringene sammen med inkorporering av automatiserte væskehåndtering roboter, vil muliggjøre høy gjennomstrømming dyp scRNA-SEQ av mikroglia isolert fra nesten alle definerte regioner.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Vi takker Mariko L. Bennett, Liana Nicole bonanno, og Spyros Darmanis for deres hjelp under utviklingen av denne protokollen. Vi takker også Stanford Shared FACS Facility, særlig Meredith Weglarz og Lisa Nichols; Yen Tran, Michael Eckart fra Stanford protein og nukleinsyre acid Facility (PAN) for sin store støtte til filming. Dette arbeidet er finansiert av JPB Foundation og Vincent J. Coates Foundation.

Materials

Name Company Catalog Number Comments
5 M Betaine Sigma-Aldrich Cat# B0300-5VL
10 mM dNTP mix Thermo Fisher Scientific Cat# R0192
0.5 M EDTA, pH 8.0 Thermo Fisher Scientific Cat# 15575020
10X Hanks’ Balanced Salt Solution Thermo Fisher Scientific Cat# 14185-052
1 M HEPES Thermo Fisher Scientific Cat# 15630080
1X KAPA HIFI Hotstart Master Mix Kapa Biosciences Cat# KK2602
5 mL Round Bottom Polystyrene Tube, with Cell Strainer Cap Corning Cat# 352235
AATI, High Sensitivity NGS Fragment Analysis Kit (1 bp – 6,000 bp) Advanced Analytical Cat# DNF-474-1000
Bovine Serum Albumin Sigma Aldrich Cat# A8806
DNase I Worthington Cat# LS002007 Working solution: 12500 units/ml
DTT, Molecular Grade Promega Cat# P1171
ERCC RNA Spike-In Mix Thermo Fisher Scientific Cat# 4456740
Fetal Bovine Serum Thermo Fisher Scientific Cat# 10437-028
Illumina XT Index Kit v2 Set A (96 indexes) Illumina Cat# FC-131-2001
Illumina XT Index Kit v2 Set B (96 indexes) Illumina Cat# FC-131-2002
Illumina XT Index Kit v2 Set C (96 indexes) Illumina Cat# FC-131-2003
Illumina XT Index Kit v2 Set D (96 indexes) Illumina Cat# FC-131-2004
Lambda Exonuclease (5 U/μl) New England BioLabs Cat# M0262S
Mouse Fc block BD Pharmingen Cat# 553142
Myelin removal beads Miltenyl Biotec Cat# 130-096-433
Nextera XT DNA Sample Prep Kit Illumina Cat# FC-131-1096
NextSeq 500/550 High Output Kit v2.5 (150 Cycles) Illumina Cat# 20024907
PBS (10X), pH 7.4 Thermo Fisher Scientific Cat# 70011044
PCRClean DX beads Aline Biosciences Cat# C-1003-50
Propidium Iodide Thermo Fisher Scientific Cat# P3566 Staining: 1:1000
Qubit dsDNA HS Assay Kit Thermal Fisher Scientific Cat# Q32851
Rat monoclonal anti mouse/human CD11b, Brilliant Violet 421 (clone M1/70) BioLegend Cat# 101236; RRID: AB_11203704 Staining: 1:300
Rat monoclonal anti mouse CD45, PE/Cy7 (clone 30-F11) Thermo Fisher Scientific Cat# 25-0451-82; RRID: AB_469625 Staining: 1:300
Recombinant RNase Inhibitor Takara Bio Cat# 2313B
SMARTScribe Reverse Transcriptase (100 U/μl) Clontech Cat# 639538 Containing 5x First strand buffer
Oligonucleotides
0.1 μM ISPCR Oligo: 5' - AAGCAGTGGTATCAA
CGCAGAGT-3'
(Picelli et al., 2014)
Oligo-dT30VN primer: 5' - AAGCAGTGGTATCAACGCA
GAGTACT 30 VN-3'
(Picelli et al., 2014)
TSO 5' - AAGCAGTGGTATCAACGCAGA
GTACATrGrG+G-3' ("r" is forribobases and "+" is for an LNA base)
(Picelli et al., 2014)
Solutions
FACS buffer Recipe: sterile-filtered 1% FBS, 2 mM EDTA, 25 mM HEPES in 1X PBS
MCS buffer Recipe: sterile-filtered 0.5% BSA, 2 mM EDTA in 1X PBS
Medium A Recipe: 15 mM HEPES, 0.5% glucose in 1X HBSS without phenol red
Plates
384-well Rigi-Plate PCR Microplates, Axygen Scientific VWR 89005-556
Hard-shell 96-well PCR plates Bio-Rad HSP9631
Others
Dumont #55 forceps Fine Science Tools 11295-51
Dounce homogenizer, 2 ml Wheaton 357422
Large depletion column Miltenyi Biotec 130-042-901
Large selection column Miltenyi Biotec 130-042-401
MACS MultiStand Miltenyi Biotec 130-042-303
QuadroMACS Separator Miltenyi Biotec 130-090-976
RNAzap Thermo Fisher Scientific AM9780
Strainer (70 μm) Falcon 352350
Equipment
BD FACSAria II BD Biosciences http://www.bdbiosciences.com/
Bioanalyzer Agilent 2100
Fragment Analyzer Agilent 5300
Mosquito HTS nanoliter pipetting robot TTP Labtech https://www.ttplabtech.com/
Qubit 4 Fluorometer Thermo Fisher Scientific Q33226

DOWNLOAD MATERIALS LIST

References

  1. Li, Q., Barres, B. A. Microglia and macrophages in brain homeostasis and disease. Nature Reviews Immunology. 18, (4), 225-242 (2018).
  2. Li, Q., et al. Developmental Heterogeneity of Microglia and Brain Myeloid Cells Revealed by Deep Single-Cell RNA Sequencing. Neuron. 101, (2), 207-223 (2019).
  3. Keren-Shaul, H., et al. A Unique Microglia Type Associated with Restricting Development of Alzheimer's Disease. Cell. 169, (7), 1276-1290 (2017).
  4. Bohlen, C. J., et al. Diverse Requirements for Microglial Survival, Specification, and Function Revealed by Defined-Medium Cultures. Neuron. 94, (4), 759-773 (2017).
  5. Guerreiro, R., et al. TREM2 variants in Alzheimer's disease. New England Journal of Medicine. 368, (2), 117-127 (2013).
  6. Jonsson, T., et al. Variant of TREM2 associated with the risk of Alzheimer's disease. New England Journal of Medicine. 368, (2), 107-116 (2013).
  7. Zhang, Y., et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. Journal of Neuroscience. 34, (36), 11929-11947 (2014).
  8. Colonna, M., Butovsky, O. Microglia Function in the Central Nervous System During Health and Neurodegeneration. Annual Review of Immunology. 35, 441-468 (2017).
  9. Bennett, M. L., et al. New tools for studying microglia in the mouse and human CNS. Proceedings of the National Academy of Sciences of the United States of America. 113, (12), 1738-1746 (2016).
  10. Hammond, T. R., et al. Single-Cell RNA Sequencing of Microglia throughout the Mouse Lifespan and in the Injured Brain Reveals Complex Cell-State Changes. Immunity. 50, (1), 253-271 (2019).
  11. Van Hove, H., et al. A single-cell atlas of mouse brain macrophages reveals unique transcriptional identities shaped by ontogeny and tissue environment. Nature Neuroscience. 22, (6), 1021-1035 (2019).
  12. Chen, G., Ning, B., Shi, T. Single-Cell RNA-Seq Technologies and Related Computational Data Analysis. Frontiers in Genetics. 10, 317 (2019).
  13. Svensson, V., et al. Power analysis of single-cell RNA-sequencing experiments. Nature Methods. 14, (4), 381-387 (2017).
  14. Picelli, S., et al. Full-length RNA-seq from single cells using Smart-seq2. Nature Protocols. 9, (1), 171-181 (2014).
  15. Macosko, E. Z., et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell. 161, (5), 1202-1214 (2015).
  16. Ziegenhain, C., et al. Comparative Analysis of Single-Cell RNA Sequencing Methods. Molecular Cell. 65, (4), 631-643 (2017).
  17. Tabula Muris, C., et al. Single-cell transcriptomics of 20 mouse organs creates a Tabula Muris. Nature. 562, (7727), 367-372 (2018).
  18. Bohlen, C. J., Bennett, F. C., Bennett, M. L. Isolation and Culture of Microglia. Current Protocols in Immunology. 125, (1), 70 (2018).
  19. Haimon, Z., et al. Re-evaluating microglia expression profiles using RiboTag and cell isolation strategies. Nature Immunology. 19, (6), 636-644 (2018).
  20. Collins, H. Y., Bohlen, C. J. Isolation and Culture of Rodent Microglia to Promote a Dynamic Ramified Morphology in Serum-free Medium. Journal of Visualized Experiments. (133), e57122 (2018).
  21. Nikodemova, M., Watters, J. J. Efficient isolation of live microglia with preserved phenotypes from adult mouse brain. Journal of Neuroinflammation. 9, 147 (2012).
  22. Swartzlander, D. B., et al. Concurrent cell type-specific isolation and profiling of mouse brains in inflammation and Alzheimer's disease. Journal of Clinical Investigation Insight. 3, (13), 121109 (2018).
  23. Hennig, B. P., et al. Large-Scale Low-Cost NGS Library Preparation Using a Robust Tn5 Purification and Tagmentation Protocol. G3. 8, (1), Bethesda. 79-89 (2018).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics