Påvisning av humant immunsvikt virus type 1 (HIV-1) Antisens protein (ASP) RNA transkripsjoner hos pasienter med strand-spesifikk RT-PCR

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

RNA-pinner og-løkker kan fungere som primere for omvendt transkripsjon (RT) i fravær av sekvens spesifikke primere, forstyrrer studiet av overlappende antisens transkripsjoner. Vi har utviklet en teknikk som er i stand til å identifisere strand-spesifikke RNA, og vi har brukt det til å studere HIV-1 antisens protein ASP.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mancarella, A., Procopio, F. A., Achsel, T., De Crignis, E., Foley, B. T., Corradin, G., Bagni, C., Pantaleo, G., Graziosi, C. Detection of Human Immunodeficiency Virus Type 1 (HIV-1) Antisense Protein (ASP) RNA Transcripts in Patients by Strand-Specific RT-PCR. J. Vis. Exp. (153), e60511, doi:10.3791/60511 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

I retroviruses, antisens transkripsjon er beskrevet i både humant immunsviktvirus type 1 (HIV-1) og Human T-lymfotropt virus 1 (HTLV-1). I HIV-1, antisens protein ASP genet er plassert på den negative strand av env, i lesing ramme-2, som spenner over krysset gp120/gp41. I den forstand orientering, den 3 ' slutten av ASP åpne lese rammen overlapper med gp120 hypervariable regioner v4 og v5. Studiet av ASP RNA har blitt forhindret av et fenomen som kalles RT-Self-priming, der RNA sekundære strukturer har evnen til å prime RT i fravær av den spesifikke primer, genererer ikke-spesifikke cDNAs. Den kombinerte bruken av høy RNA-denaturering med biotinylated omvendt grunning i RT-reaksjonen, sammen med affinitet rensing av cDNA på streptavidin magnetiske perler, har gjort det mulig for oss å selektivt forsterke ASP RNA i CD4 + T-celler avledet fra personer som er smittet med HIV-1. Vår metode er relativt lave kostnader, enkel å utføre, svært pålitelig, og lett reproduserbar. I denne sammenheng representerer det et kraftig verktøy for studiet av antisens transkripsjon ikke bare i HIV-1, men også i andre biologiske systemer.

Introduction

Den antisens protein (ASP) genet er en åpen lese ramme (ORF) ligger på den negative tråden av humant immunsviktvirus type 1 (HIV-1) konvolutt (env) gen, som spenner over krysset gp120/gp411. I løpet av de siste 30 årene har flere rapporter vist at HIV-genet faktisk skrives ut og oversettes med2,3,4,5,6,7,8,9. Selv om ASP-antisens transkripsjoner har blitt fullt ut karakterisert in vitro, inntil nylig informasjon om den faktiske PRODUKSJONEN av ASP RNA hos pasienter manglet fortsatt.

Sekvensen av ASP er omvendt og komplementære til env. Dette representerer en stor hindring når du prøver å oppdage transkripsjoner for ASP. Standard omvendt transkripsjon-polymerase kjedere reaksjon (RT-PCR) metoder bruker gen-spesifikke antisens primere å syntetisere komplementære DNAs (cDNAs) av høyre polaritet. Denne tilnærmingen, men tillater ikke å bestemme retningen (følelse eller antisens) av den første RNA-malen, siden RNA-pinner eller løkker kan Prime RT i begge retninger i fravær av primer10, et fenomen kjent som RT selv-grunning. De fleste ASP etterforskere omgå problemet med RT selv-grunning ved hjelp av primere merket med sekvenser som ikke er relatert til HIV-111,12. Denne strategien eliminerer imidlertid ikke forekomsten av fenomenet, og kan føre til potensiell bæring av ikke-spesifikke cDNAs i PCR-11.

Vi har nylig utviklet en roman tråd-spesifikk RT-PCR-analyse for studiet av antisens RNA, og vi har brukt den til ASP RNA-deteksjon i en kohort av seks HIV-infiserte pasienter, som vist i tabell 1. Prosedyren beskrevet nedenfor har tidligere blitt utgitt av Antonio Mancarella et al.13. I vår protokoll unngår vi produksjon av ikke-spesifikke cDNAs med en dobbel tilnærming. For det første eliminerer vi RNA sekundære strukturer ved denaturering RNA ved høy temperatur (94 ° c), og for det andre reverserer vi transkribere ASP RNA ved hjelp av en biotinylated ASP-spesifikk primer og affinitet-renser den resulterende cDNA. Ved denne tilnærmingen er vi i stand til å forsterke bare våre mål cDNA, siden andre ikke-spesifikke RT produkter er enten forhindret fra å bli generert (høy temperatur denaturering av RNA) eller eliminert før PCR (affinitet rensing).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Denne studien ble godkjent av den institusjonelle Review styret i Centre Hospitalier universitaire Vaudois (CHUV).

1. infeksjon av perifere blod mononukleære celler (Pbmc) med HIV-1HXB2 stamme

  1. Dag 1: Pbmc STIMULERING
    1. Isolere Pbmc fra en sunn donor Buffy coat.
    2. Count og resuspend Pbmc ved en konsentrasjon av 1x106/ml i komplett Roswell Park Memorial INSTITUTE (RPMI) 1640 medium som inneholder 10% fosterets storfe serum (FBS) og 1% penicillin/Streptomycin (R-10), med tillegg av 50 U/ml av interleukin-2 (Il-2) og 3 μg/ml PHYTOHAEMAGGLUTININ (Pha).
    3. Pipet opp og ned og splitt cellene i 2 6-brønn platene (3 mL celle fjæring/brønn).
    4. Ruge i 3 dager ved 37 ° c og 5% CO2.
  2. Dag 3: Pbmc infeksjon
    Merk: Bruk en av de to platene som i trinn 1.1.3 som negativ kontroll (ikke infisere disse cellene).
    FORSIKTIG: Utfør hele prosedyren i et biosafety nivå III-laboratorium (P3).
    1. Pool Pbmc fra en plate i en 50 mL Falk rør og sentrifuger på 300 x g i 10 min.
    2. Kast supernatanten og resuspend cellene i 2,2 mL R-10 inneholdende 20 U/mL av IL-2 og 2 μg/mL polybrene.
    3. Tin hetteglass som inneholder HIV-1HXB2 -viruset og tilsett 1,8 ml av viral suspensjon (0,376 ng/μL) til cellene.
    4. Ruge cellene i 2 timer ved 37 ° c, og virvler forsiktig inn røret hver 30 min.
    5. Sentrifuger cellene ved 300 x g i 10 min.
    6. Kast supernatanten og resuspend cellene ved 1x106/ml i R-10 som inneholder Il-2 (50 U/ml).
    7. Overfør celle suspensjonen til en 24-brønn plate ved en konsentrasjon på 1 mL/brønn og ruge i 5 dager ved 37 ° c og 5% CO2.
    8. Harvest 1 godt hver dag og overføre cellene til 1,5 mL Tube (merket med dagen for smitte).
      Merk: før sentrifugering, overføring 150 μL av celle fjæring til en strømnings flowcytometri slange for Pbmc-smitte kvalitetskontroll (se trinn 1,3)
    9. Sentrifuger rørene ved 400 x g i 10 min og kast supernatanten.
    10. Frys celle pellets ved-80 ° c til bruk.
  3. Pbmc infeksjon: kvalitetskontroll
    1. For hver dag med infeksjon, samle 150 μL av infiserte Pbmc og overføre dem til en Flow flowcytometri tube.
    2. Tilsett 1 mL fosfat-bufret saltvann (PBS) og sentrifuger ved 400 x g i 5 min.
    3. Kast supernatanten og tilsett 50 μL av PBS som inneholder 1 μL av Aqua Live/Dead Dye (tidligere fortynnet 1:10 med PBS).
    4. Ruge ved 4 ° c i 15 min.
    5. Tilsett 1 mL PBS, sentrifuger på 400 x g i 5 min, og kast supernatanten.
    6. Tilsett 250 μL av fiksering/Permeabilization-oppløsning og ruge i 20 minutter ved romtemperatur i mørket.
    7. Tilsett 1 mL 1x perm/vaske buffer (10x lagerløsning som inneholder både FBS og saponin fortynnet 1:10) og sentrifuger ved 400 x g i 5 min.
    8. Kast supernatanten og tilsett 50 μL av PBS som inneholder HIV gag p24 fluorescein isothiocyanate (FITC)-bøyd antistoff (fortynnet 1:10).
    9. Ruge i 20 minutter ved romtemperatur i mørket.
    10. Tilsett 1 mL PBS, sentrifuger på 400 x g i 5 min, og kast supernatanten.
    11. Tilsett 150 μL av x CellFIX (10x lagerløsning som inneholder 10% formaldehyd, 3,55% metanol, 0,93% natrium Natriumazid fortynnet 1:10) og analysere celler ved flyt flowcytometri.

2. stimulering av menneskelig CD4 + T-celler med anti-CD3/CD28 antistoffer

  1. Isolere CD4 + T-celler fra Pbmc av både HIV-1 infiserte pasienter og sunne donorer.
  2. Forbered menneskelige anti-CD3/CD28 antistoff Mix ved fortynning anti-CD3 (1:100) og anti-CD28 (1:50) i PBS.
  3. Coat en 48 brønn plate ved å tilsette 200 μL av antistoff blanding per brønn til et passende antall brønner og ruge ved 37 ° c for 2 timer.
  4. Aspirer antistoff løsningen og tilsett 1 mL CD4 + T celler ved 1x106/ml til anti-CD3/CD28 antistoff-belagte brønner.
    Merk: stimulere CD4 + T-celler opp til 5 dager.

3. omvendt transkripsjon

Merk: for å få pasientspesifikke primere, proviral DNA isolert fra CD4 + T celler fra hver pasient ble forsterket ved hjelp av HIV-1HXB2 Pan ASP primere. Pasientspesifikke primere ble utformet ved hjelp av proviral sekvensen internt i Pan ASP-primere. Alle primere og sonder som brukes i denne studien er listet opp i tabell 2.

  1. Isolere total RNA fra celler
    1. Kvantifisere RNA og Eliminer DNA-forurensning ved å behandle prøver med DNase.
    2. Utfør RT-reaksjoner i et volum på 50 μL. Overfør 0,1-1 μg av total RNA til et passende antall brønner av en 96-brønn PCR-plate. Klargjør RNA-blandingen ved å legge til følgende komponenter i RNA:
      5 μL av biotinylated ASP omvendt primer (20 μM)
      2,5 μL av deoxynucleotides triphosphates (dNTPs) (10 mM)
      25 μL av diethylpyrocarbonate (DEPC)-behandlet destillert vann (dH2O).
      Klargjør de endogene RT-kontrollene ved å legge til 5 μL av nuklease vann i stedet for den biotinylated ASP-omvendte primer.
    3. Plasser 96-brønnen til PCR-platen i en thermocycler, og varm opp RNA-blandingen til 94 ° c i 5 minutter.
    4. Kjøl ned RNA-blandingen umiddelbart i avkjølt vann i minst 1 min.
    5. Klargjør reaksjonsblandingen ved å legge til følgende komponenter i et 1,5 mL rør (Beregn det totale antallet prøver pluss 1):
      10 μL av 5x RT-buffer
      2,5 μL av 0,1 M av 1, 4-dithiotreitol (DTT)
      2,5 μL av RNase ut (40 enheter/μL)
      2,5 μL av RT-enzym (200 enheter/μL)
    6. Overfør 17,5 μL av denne blandingen til hver av de RNA-inneholdende brønnene. Klargjør RT-minus-kontrollene som erstatter revers transkriptase med 2,5 μL av nuklease vann.
    7. Bland forsiktig og ruge platen ved 55 ° c i 60 min ved hjelp av en thermocycler.
    8. Deaktiver reaksjonene ved å varme ved 70 ° c i 15 minutter.

4. affinitet rensing av ASP biotinylated cDNA

Merk: ikke rens RT-minus-reaksjoner.

  1. Forbered 1 L av 2x vaske/binding buffer som inneholder 10 mM Tris-HCl (pH 7,5), 1 mM ethylenediaminetetraacetic acid (EDTA) og 2 M NaCl. Filtrer løsningen.
    1. Klargjør 50 mL 1x vaske-og bindings buffer ved bruk av PCR-grade vann.
    2. For hver reaksjon, bruk 10 μL av streptavidin magnetiske perler. Basert på antall reaksjoner, overføre et passende volum av perler til en 1,5 mL tube.
    3. Vask perlene ved å legge til et lik volum på 2x vask/binding buffer og Vortex for 15 s.
    4. Plasser røret i en magnetisk separasjon rack og ruge i 3 min ved romtemperatur.
    5. Fjern forsiktig supernatanten uten å forstyrre perlene og tilsett samme volum av vask/binding 2x buffer som det opprinnelige volumet av perler.
    6. Vortex for 30 s og overføre 10 μL av perler suspensjon til et passende antall 1,5 mL rør.
    7. Plasser rørene i et magnetisk skille stativ og ruge i 3 minutter ved romtemperatur.
    8. Kast supernatanten og tilsett 50 μL av vask/binding 2x buffer.
    9. Tilsett 50 μL av biotinylated cDNA til tilsvarende rør som inneholder perlene.
    10. Ruge i 30 minutter ved romtemperatur som roterer forsiktig.
    11. Skill perlene fra supernatanten med et magnet skille stativ i 3 minutter ved romtemperatur.
    12. Vask perlene ved å tilsette 200 μL av 1x vask/binding buffer. Plasser rørene i et magnet skille stativ i 3 minutter ved romtemperatur og kast supernatanten. Gjenta to ganger.
    13. Resuspend perlene i 10 μL av PCR-grade vann.

5. standard PCR

Merk: Målet med standard PCR er å forsterke hele ORF av ASP-genet. Forsterknings produktene blir deretter klonet til pCR 2.1-plasmider for å utvikle standard kurver for ASP RNA-kvantifisering med PCR i sanntid (se PCR i sanntid).

  1. Utfør standard PCRene med et total volum på 50 μL. klargjør et passende volum av PCR Master mix (antall prøver pluss 1). For hver prøve legger du til følgende komponenter i et 1,5 mL rør:
    1 μL av ASP-primere 10 μM (forover og bakover)
    1 μL av 10 mM dNTPs
    Magnesium klorid (MgCl2) (konsentrasjon avhenger av grunning brukes)
    dH2O til et endelig volum på 49 μL
    1. Bland godt, raskt spinne ned innholdet og overføre 49 μL/brønn av PCR Master Mix til en 96-brønn PCR plate.
    2. Forsiktig Vortex rørene som inneholder perlene brukes for ASP cDNA affinitet rensing for 15 s.
    3. Tilsett 1 μL av perler i de tilsvarende brønnene og Kjør PCR ved hjelp av følgende program: 95 ° c i 2 min, 40 sykluser på 95 ° c i 30 s, 55 ° c for 30 s, og 68 ° c for 40 s, deretter 68 ° c i 7 min.
    4. Skill PCR-produktene til 1% agarose gel, skjær båndene og klone de forsterkede produktene til pCR 2.1-plasmider.
    5. Sekvens og analysere sekvenser av hver klone.

6. sann tids kvantitativ PCR (qPCR)

Merk: utvikle pasientspesifikke primere og sonder ved hjelp av tilnærmingen beskrevet i trinn 3 "reverse transkripsjon". For qPCR inkluderer ASP-plasmider fortynninger for standard kurver. Plasmider som inneholder pasientspesifikke innsatser, utvikles som nevnt i notatet i begynnelsen av trinn 5 "standard PCR".

  1. Klargjør standardkurven ved hjelp av 1:10 ASP-plasmider seriell fortynninger som starter fra 3 x 106 eksemplarer/μL ned til 3 eksemplarer/μL.
    1. Første runde PCR (pre-amp). Utfør reaksjoner med et total volum på 25 μL. Forbered et passende volum av PCR Master mix (antall prøver pluss 1). For hver prøve legger du til følgende komponenter i et 1,5 mL rør:
      0,5 μL av ASP eller env primer mix (endelig konsentrasjon 0,2 μM hver) (forover og bakover)
      0,5 μL av dNTPs mix (siste konsentrasjon 0,2 mM hver)
      MgCl2 (konsentrasjon avhenger av primer parene)
      dH2O til et endelig volum på 24 μL
    2. Overføring 24 μL av PCR Master Mix til et passende antall brønner av en 96-brønn PCR plate.
    3. Forsiktig Vortex rørene som inneholder perlene med cDNA for 15 s.
    4. Tilsett 1 μL av perler til de tilsvarende brønnene. Gjør det samme for plasmider fortynninger.
    5. Kjør PCR ved hjelp av følgende algoritme: denaturering for 2 min ved 95 ° c; 30 s ved 95 ° c, 30 s ved 55 ° c, 40 s ved 68 ° c i 18 sykluser; forlengelse ved 68 ° c i 7 min.
    6. Fortynne første runde PCRene reaksjoner 1:5 med PCR grade vann.
    7. Andre runde qPCR. Utfør reaksjoner i et samlet volum på 20 μL. Forbered et passende volum av PCR Master mix (antall prøver pluss 1). For hver prøve legger du til følgende komponenter i et 1,5 mL rør:
      1,8 μL 10 μM-primere (forover og bakover)
      1 μL av 5 μM-sonde
      6,2 μL av dH2O
    8. Overfør 19 μL av qPCR Master Mix til et passende antall brønner på en 96-brønn qPCR plate og tilsett 1 μL av de fortynnede første runde PCR-reaksjonene på de tilsvarende brønnene. Gjør det samme for plasmider fortynninger.
    9. Kjør qPCR med følgende algoritme: denaturering for 10 min ved 95 ° c; 15 s ved 95 ° c, 1 min ved 60 ° c for 40 sykluser.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Høy temperatur RNA denaturering koplet til affinitet rensing av biotinylated cDNA hindrer forsterkning av ikke-spesifikke ASP-produkter under PCR i Pbmc smittet in vitro og i CD4 + T celler isolert fra pasienter. RT Self-priming har vist seg å skje under omvendt transkripsjon av antisens RNAs10,14,15,16,17. For å unngå dette fenomenet utviklet vi en ny tilnærming ved hjelp av teknikken som opprinnelig ble beskrevet av Heist et al.10. Vår prosedyre innebærer høy temperatur denaturering av RNA før RT og bruk av biotinylated primere til å utføre RT, etterfulgt av affinitet-rensing av biotinylated cDNAs på streptavidin-belagte magnetiske perler13. CDNAs innhentet av denne metoden kan brukes til nedstrøms applikasjoner, inkludert standard PCR eller qPCR.

Den eksperimentelle forhold for antisens transkripsjon ble først testet i Pbmc fra en sunn donor smittet in vitro med HIV-1HXB2, referanse sekvensen for HIV-1 under type B (alle våre pasienter er smittet med isolat av denne under typen). Tabell 2 viser sekvenser av primere og sonder som brukes i denne studien. Våre første RT reaksjoner ble gjort ved hjelp av en vanlig, ikke-biotinylated antisens primer (ASP R1) og resulterte i vellykket forsterkning av ASP (ASP F1-R1 primer par) (figur 1a, Lanes 1-3). Men ved denne tilnærmingen, vi også forsterket et band av samme molekylvekt i primer-minus RT reaksjoner kontroller (Lanes 4-6). Den komplette mangelen på signal i våre negative kontroller (Lanes 7-8) indikerte at den ikke-spesifikke malen kom fra RT reaksjonen og ikke fra kryss-forurensning av prøvene.

For å omgå problemet opprettet av RT selv-grunning, bestemte vi oss for å bruke en metode som tidligere beskrevet av Haist et al.10, der den spesifikke antisens primer er merket med biotin slik at den resulterende biotinylated cDNA tilsvarende antisens orientering kan renses før PCR og selektivt forsterket. Ved denne tilnærmingen, var vi i stand til å forsterke ASP sekvensen (figur 1B, Lanes 1-3) med sterkt redusert forurensning fra den ikke-spesifikke cDNA i primer-minus kontroller (figur 1b, Lanes 4-6).

Optimalisering av denne metoden ble oppnådd ved fullstendig denaturering av RNA før RT ved 94 ° c, etterfulgt av umiddelbar kjøling på avkjølt vann. Som vist i figur 2A, B, er ASP-båndet effektivt forsterket, mens de ikke-spesifikke produktene har forsvunnet.

ASP RNA oppdages i CD4 + T-celler fra pasienter med synlig viraemia og i fravær av terapi, etter stimulering med anti-CD3/CD28. ASP RNA var umulig å oppdage i enten ufraksjonert Pbmc eller unstimulated CD4 + T celler isolert fra HIV-pasienter (data ikke vist). Imidlertid kan det være lett oppdages i CD4 celler isolert fra tre HIV-positive, MP135, MP140, og MP148 (tabell 1), etter stimulering med anti-CD3/CD28. Kinetics av ASP RNA-uttrykk målt av qPCR i disse tre pasientene er vist i Figur 3.

CD4 celler isolert fra pasienter som GJENNOMGÅR Art og med ikke-synlig viraemia, kan produsere små mengder ASP RNA når stimulert med anti-CD3/CD28. Kvantifisering av ASP RNA-nivåer hos to av disse pasientene (MP071, MP146) av qPCR viser at i disse forholdene er ASP RNA påvist i lave nivåer (10-15 eksemplarer/million CD4 + T-celler) ved 3-5 dager etter stimulering (Figur 4). I én pasient (MP069) kunne ingen ASP RNA oppdages når som helst (data ikke vist).

ASP og env RNAs har lignende uttrykks mønstre i en ubehandlet pasient med synlig viraemia (MP140). To pasienter ble analysert, en ubehandlet (MP140) og en behandlet (MP146). I MP140 vi kunne oppdage både ASP og env. Selv om deres nivåer av transkripsjon var ulik (figur 5a), var uttrykket kurve av disse to genene over tid identiske, noe som kan visualisere plotting data på en logaritmisk skala (figur 5B). I pasient MP146, som ble behandlet og hvis viraemia var under nivåene av deteksjon, ASP og env var knapt synlig og bare etter flere dager med stimulering (figur 5c).

Figure 1
Figur 1: uttrykk for ASP RNA i Pbmc fra en HIV-negativ person smittet in vitro med HIV-1HXB2 av standard og modifisert RT-PCR. (A) påvisning av ASP RNA ved bruk av standard RT-PCR. ASP forsterkes fra cDNA syntetisert i nærvær av den ikke-biotinylated ASP-spesifikke antisens primer ASP R1 (Lanes 1 – 3). Det samme bandet er også funnet i primer-minus RT kontroller (Lanes 4 – 6). (B) VISUALISERING av ASP RNA ved biotinylation av antisens primer og cDNA rensing (Lanes 1-3). Et band med redusert intensitet er fortsatt påvist i primer-minus kontroller (Lanes 4 – 6). Ingen bånd finnes i negative kontroller. Tidligere publisert i artikkelen "påvisning av antisens protein (ASP) RNA transkripsjoner i individer smittet med humant immunsviktvirus type 1 (HIV-1)", av Mancarella et al.13 (J gen Virol 100 (5): 863-876. doi: 10.1099/jgv. 0.001244). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: ASP RNA uttrykkes i PMBCs av en HIV-negativ person etter infeksjon med HIV-1HXB2. (A) ASP-båndet er lett oppdages RNA som har blitt fullstendig denaturert og omvendt-skrives ut ved hjelp av biotinylated RT PRIMER (ASP R1) (Lanes 1 – 3), men ikke i renset cDNA fra primer minus kontroller (Lanes 4 – 6). (B) ingen signal tilsvarende ASP OPPDAGES i RT-minus kontroller av RNA fra infiserte pbmc, infisert pbmc eller vann, selv om et klart bånd er synlig i gag positiv kontroll fra ACH-2 celler. Tidligere publisert i artikkelen "påvisning av antisens protein (ASP) RNA transkripsjoner i individer smittet med humant immunsviktvirus type 1 (HIV-1)", av Mancarella et al.13 (J gen Virol 100 (5): 863-876. doi: 10.1099/jgv. 0.001244). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: i anti-CD3/CD28-STIMULERT CD4 + T celler isolert fra tre ubehandlede pasienter, ASP RNA produksjon er lett oppdages og topper mellom dag 2 og 4 etter stimulering. I MP135 og MP140 ble uttrykket av ASP toppet på dag 4 etter stimulering, mens det i MP148 toppet seg på dag 2. ASP-nivåer uttrykkes som RNA-Kopier/millioner CD4 + T-celler. Poeng i den tiden kurset tilsvarer gjennomsnittet verdien av tre eksemplarer PCR reaksjoner. Tidligere publisert i artikkelen "påvisning av antisens protein (ASP) RNA transkripsjoner i individer smittet med humant immunsviktvirus type 1 (HIV-1)", av Mancarella et al.13 (J gen Virol 100 (5): 863-876. doi: 10.1099/jgv. 0.001244). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 4: i to aviremic pasienter som GJENNOMGÅR Art, er ASP knapt synlig bare etter noen få dager med stimulering. I begge våre pasienter kunne ikke ASP oppdages på dag 0. I pasient MP071 kan det oppdages lave nivåer av ASP på dag 3, mens i pasient MP146 måtte vi vente til dag 5 for å se noen nivåer av RNA. ASP-nivåer uttrykkes som RNA-Kopier/millioner CD4 + T-celler. Poeng i den tiden kurset tilsvarer gjennomsnittet verdien av tre eksemplarer PCR reaksjoner. Tidligere publisert i artikkelen "påvisning av antisens protein (ASP) RNA transkripsjoner i individer smittet med humant immunsviktvirus type 1 (HIV-1)", av Mancarella et al.13 (J gen Virol 100 (5): 863-876. doi: 10.1099/jgv. 0.001244). Vennligst klikk her for å se en større versjon av dette tallet.

Figure 5
Figur 5: uttrykk for ASP og env i anti-CD3/CD28-STIMULERT CD4 + T celler i behandlet (MP146) og ubehandlet (MP140) pasienter. (A) i den ubehandlede pasienten (MP140), er env uttrykt på høyere nivåer enn ASP; (B) de samme dataene som tegnes inn på en logaritmisk skala, viser at ASP-og env-uttrykk kjennetegnes av en lignende profil over tid. (C) uttrykk KINETICS av ASP og env i en pasient med undetectable viraemia og gjennomgår Art (MP146). Tidligere publisert i artikkelen "påvisning av antisens protein (ASP) RNA transkripsjoner i individer smittet med humant immunsviktvirus type 1 (HIV-1)", av Mancarella et al.13 (J gen Virol 100 (5): 863-876. doi: 10.1099/jgv. 0.001244). Vennligst klikk her for å se en større versjon av dette tallet.

Pasient-ID Alder sex Stadium av HIV-smitte Klade Viral belastning (Kopier/ml) CD4 count (celler/μL) ART-status
MP135 44 M C3 B 1,6 x105 176 Ubehandlet
MP140 23 M A2 B 3.6 x104 427 Ubehandlet
MP148 37 M A1 B 2,0 x104 717 Ubehandlet
MP069 42 M A1 B < 20 1309 Behandlet
MP071 47 M C3 B < 20 167 Behandlet
MP146 59 M C3 B < 20 385 Behandlet

Tabell 1: pasientens funksjoner. Tidligere publisert i artikkelen "påvisning av antisens protein (ASP) RNA transkripsjoner i individer smittet med humant immunsviktvirus type 1 (HIV-1)", av Mancarella et al.13 (J gen Virol 100 (5): 863-876. doi: 10.1099/jgv. 0.001244).

Navn på primer/sonde Primer sekvens (5 ' til 3 ')
ASP F1 TTAGGAGTAGCACCCACCAA
ASP R1 GAACCCAAGGAACAAAGCTC
PANORER ASP F ACCAAGCCTCCTACTATCATTATG
PANORER ASP R GCACATTGTAACATTAGTAGAGCA
ASP MP135, 146, 071 F CCCAAGAACCCAAGGAACATAG
ASP MP135, 146, 071 R CATTAGGAATAGCACCCACCAA
ASP MP135, 146, 071 probe FAM/TAMRA TCTCTGCACCACTCTTCTCTTTGCC
ASP MP140 F CCCATAGTGCTTCCTGCTATTC
ASP MP140 R AGAAGAGTGGTGCAGAGAGA
ASP MP140 probe FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT
ASP MP148 F CTCTCTGCACCACTCTTCTTT
ASP MP148 R AGACCTGGAGGAGGAGATATG
ASP MP148 probe FAM/TAMRA TGGTGGGTGCTACTCCTAATGGTT
ENV MP140 F AGAAGAGTGGTGCAGAGAGA
ENV MP140 R CCCATAGTGCTTCCTGCTATTC
ENV MP140 probe FAM/TAMRA AGCTCCTATTGTTCCCACTGCTCT
ENV MP146 F CATTAGGAATAGCACCCACCAA
ENV MP146 R CCCAAGAACCCAAGGAACATAG
ENV MP146 probe FAM/TAMRA TCTCTGCACCACTCTTCTCTTTGCC

Tabell 2: RT-PCR-primere og-sonder

Subscription Required. Please recommend JoVE to your librarian.

Discussion

I denne rapporten beskriver vi en tråd-spesifikke RT analysen brukes til påvisning av ASP RNA i CD4 + T celler isolert fra personer smittet med HIV-1. Forekomsten av ikke-spesifikk priming under RT hemmer påvisning av RNA transkripsjoner med høyre polaritet, som fører til feil tolkning av resultatene. Tidligere grupper har utviklet flere strategier rettet mot å forebygge primer-uavhengig cDNA syntese under RT reaksjonen. Merking omvendt primer på 3 ' end med sekvenser som ikke er relatert til HIV har vist seg effektiv i å oppnå strand-spesifikk forsterkning6,8,9. Imidlertid gir denne tilnærmingen bare for å gjøre feilaktig primet cDNA undetectable snarere enn å unngå det, med risiko for det lekker inn i PCR reaksjonen, forårsaker forsterkning av ikke-spesifikke DNA-produkter (dvs. env i stedet for ASP).

Våre første RT-PCR forsøk på å oppdage ASP RNA ble utført ved hjelp av en standard antisens primer. Presiseringer var vellykket, da vi fikk band av riktig molekylvekt, men band av samme størrelse var også til stede i vår primer-minus kontroller. Basert på disse resultatene, brukte vi en annen tilnærming, utfører RT med en biotinylated spesifikk antisens primer, som beskrevet av Haist et al.10. Selv om våre foreløpige eksperimenter resulterte i en drastisk reduksjon av RT selv-priming, kunne vi ikke helt fjerne ikke-spesifikke produkter av forsterkning. Haist og kollegaer eliminerer ikke-spesifikke cDNA-produkter ved å vaske perlene i høye stringens forhold10. I vår metode, fjernet vi helt kilden til selv-grunning i form av RNA sekundære strukturer ved hjelp av høy denaturering temperaturer til fullt linearize RNA malen.

Vi viser at ASP RNA er uttrykt i anti-CD3/CD28-stimulert CD4 + T-lymfocytter. Påvisning av ASP, men kan ikke oppnås i celler i fravær av stimulering. Våre data er noe ulik fra de av Zapata og kolleger, som har rapportert uttrykk for lave nivåer av ASP i hvile CD4 + celler isolert fra pasienter som gjennomgår ART9. Basert på disse resultatene, foreslår de at ASP RNA kan spille en rolle i å regulere HIV ventetid. Vår oppdagelse at i samme individuelle Kinetics av uttrykk for ASP og env er preget av den samme profilen er ikke forenlig med Zapata ' s modell9. Faktisk, hvis virkelig ASP var involvert i regulering av latency, bør uttrykket profilen være motsatt av en observert for env18.

Vi har også observert at env transkripsjon nivåer er over 2 logger høyere enn ASP, i hvert fall hos pasienter i fravær av terapi. Disse dataene er enige med studier av LAverdure et al.8 viser at i primære CD4 + celler infisert in vitro, 3 ' ltr antisens transkripsjon er mye lavere (opp til 1000-fold) enn 5 ' fornuft transkripsjon. Våre resultater tyder på at ASP uttrykkes i infiserte CD4-lymfocytter uavhengig av stadiet av sykdommen så lenge cellene er skikkelig stimulert. I tillegg viser dataene våre at ASP uttrykkes i celler fra pasienter som gjennomgår ART-behandling, selv om uttrykks nivået i disse cellene er lavere enn i celler fra pasienter som ikke er i behandling.

Oppsummert foreslår vi en pålitelig strand-spesifikk RT-analysen som tar sikte på å forebygge primer uavhengig cDNA-syntese. ASP og env er to gener som overlapper hverandre i motsatt retning, en funksjon som gjør deres studie svært utfordrende. Vår tilnærming, som gjør det mulig å selektivt fange cDNAs retrotranscribed fra RNA med både negativ og positiv polaritet, representerer et optimalt og effektivt verktøy for studiet av disse to genene spesielt, og gener som overlapper hverandre i deres antisens orientering generelt.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer at det ikke er noen interessekonflikter.

Acknowledgments

Vi takker Patrizia Amelio, Alessandra Noto, Craig Fenwick, og Matthieu Perreau for alltid å være tilgjengelig for å diskutere vårt arbeid og alle menneskene i laboratorium for AIDS Immunopathogenesis for deres dyrebare teknisk assistanse. Vi ønsker også å takke John og Aaron Weddle fra VSB Associated Inc. som bidro med gode kunstverk. Til slutt, mange spesiell takk til alle pasientene, uten hvem dette arbeidet ikke ville vært mulig. Dette arbeidet fikk ingen spesifikk bevilgning fra noen finansierings organ.

Materials

Name Company Catalog Number Comments
BD LSR II Becton Dickinson
BigDye Terminator v1.1 Cycle Sequencing Kit Applied Biosystem, Thermo Fisher Scientific 4337450
dNTP Set (100 mM) Invitrogen, Thermo Fisher Scientific 10297018
Dynabeads M-280 Streptavidin Invitrogen, Thermo Fisher Scientific 11205D
EasySep Human CD4+ T Cell Isolation Kit Stemcell Technologies 19052
Fetal Bovine Serum Biowest S1010-500
Fixation/Permeabilization Solution Kit Becton Dickinson 554714
HIV Gag p24 flow cytometry antibody - Kc57-FITC Beckman Coulter 6604665
Human IL-2 Miltenyi Biotec 130-097-743
Lectin from Phaseolus vulgaris (PHA) Sigma-Aldrich 61764-1MG
LIVE/DEAD Fixable Yellow Dead Cell Stain Kit, for 405 nm excitation Invitrogen, Thermo Fisher Scientific L34967
Mouse Anti-Human CD28 Becton Dickinson 55725
Mouse Anti-Human CD3 Becton Dickinson 55329
Primers and Probes Integrated DNA Technologies (IDT)
Penicillin-Streptomycin BioConcept 4-01F00-H
Platinum Taq DNA Polymerase High Fidelity Invitrogen, Thermo Fisher Scientific 11304011
Polybrene Infection / Transfection Reagent Sigma-Aldrich TR-1003-G
RNeasy Mini Kit Qiagen 74104
Roswell Park Memorial Institute (RPMI) 1640 Medium Gibco, Thermo Fisher Scientific 11875093
StepOnePlus Real-Time PCR System Applied Biosystem, Thermo Fisher Scientific 4376600
SuperScript III Reverse Transcriptase Invitrogen, Thermo Fisher Scientific 18080044
TaqMan Gene Expression Master Mix Applied Biosystem, Thermo Fisher Scientific 4369016
TOPO TA Cloning Kit for Subcloning, with One Shot TOP10 chemically competent E. coli cells Invitrogen, Thermo Fisher Scientific K450001
TURBO DNase (2 U/µL) Invitrogen, Thermo Fisher Scientific AM2238
Veriti Thermal Cycler Applied Biosystem, Thermo Fisher Scientific 4375786

DOWNLOAD MATERIALS LIST

References

  1. Miller, R. H. Human immunodeficiency virus may encode a novel protein on the genomic DNA plus strand. Science. 239, (4846), 1420-1422 (1988).
  2. Vanheebrossollet, C., et al. A Natural Antisense Rna Derived from the Hiv-1 Env Gene Encodes a Protein Which Is Recognized by Circulating Antibodies of Hiv+ Individuals. Virology. 206, (1), 196-202 (1995).
  3. Briquet, S., Vaquero, C. Immunolocalization studies of an antisense protein in HIV-1-infected cells and viral particles. Virology. 292, (2), 177-184 (2002).
  4. Clerc, I., et al. Polarized expression of the membrane ASP protein derived from HIV-1 antisense transcription in T cells. Retrovirology. 8, 74 (2011).
  5. Landry, S., et al. Detection, characterization and regulation of antisense transcripts in HIV-1. Retrovirology. 4, 71 (2007).
  6. Kobayashi-Ishihara, M., et al. HIV-1-encoded antisense RNA suppresses viral replication for a prolonged period. Retrovirology. 9, 38 (2012).
  7. Barbagallo, M. S., Birch, K. E., Deacon, N. J., Mosse, J. A. Potential control of human immunodeficiency virus type 1 asp expression by alternative splicing in the upstream untranslated region. DNA Cell Biol. 31, (7), 1303-1313 (2012).
  8. Laverdure, S., et al. HIV-1 Antisense Transcription Is Preferentially Activated in Primary Monocyte-Derived Cells. Journal of Virology. 86, (24), 13785-13789 (2012).
  9. Zapata, J. C., et al. The Human Immunodeficiency Virus 1 ASP RNA promotes viral latency by recruiting the Polycomb Repressor Complex 2 and promoting nucleosome assembly. Virology. 506, 34-44 (2017).
  10. Haist, K., Ziegler, C., Botten, J. Strand-Specific Quantitative Reverse Transcription-Polymerase Chain Reaction Assay for Measurement of Arenavirus Genomic and Antigenomic RNAs. PLoS One. 10, (5), 0120043 (2015).
  11. Lerat, H., et al. Specific detection of hepatitis C virus minus strand RNA in hematopoietic cells. The Journal of Clinical Investigation. 97, (3), 845-851 (1996).
  12. Tuiskunen, A., et al. Self-priming of reverse transcriptase impairs strand-specific detection of dengue virus RNA. J Gen Virol. 91, Pt 4 1019-1027 (2010).
  13. Mancarella, A., et al. Detection of antisense protein (ASP) RNA transcripts in individuals infected with human immunodeficiency virus type 1 (HIV-1). Journal of General Virology. (2019).
  14. Peyrefitte, C. N., Pastorino, B., Bessaud, M., Tolou, H. J., Couissinier-Paris, P. Evidence for in vitro falsely-primed cDNAs that prevent specific detection of virus negative strand RNAs in dengue-infected cells: improvement by tagged RT-PCR. J Virol Methods. 113, (1), 19-28 (2003).
  15. Boncristiani, H. F., Di Prisco, G., Pettis, J. S., Hamilton, M., Chen, Y. P. Molecular approaches to the analysis of deformed wing virus replication and pathogenesis in the honey bee, Apis mellifera. Virol J. 6, 221 (2009).
  16. Boncristiani, H. F., Rossi, R. D., Criado, M. F., Furtado, F. M., Arruda, E. Magnetic purification of biotinylated cDNA removes false priming and ensures strand-specificity of RT-PCR for enteroviral RNAs. J Virol Methods. 161, (1), 147-153 (2009).
  17. Craggs, J. K., Ball, J. K., Thomson, B. J., Irving, W. L., Grabowska, A. M. Development of a strand-specific RT-PCR based assay to detect the replicative form of hepatitis C virus RNA. J Virol Methods. 94, (1-2), 111-120 (2001).
  18. Barbeau, B., Mesnard, J. M. Making sense out of antisense transcription in human T-cell lymphotropic viruses (HTLVs). Viruses. 3, (5), 456-468 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics