Method Article

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

DOI:

10.3791/4057

⸱

November 12th, 2012

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Affinity purification of tagged proteins in combination with mass spectrometry (APMS) is a powerful method for the systematic mapping of protein interaction networks and for investigating the mechanistic basis of biological processes. Here, we describe an optimized sequential peptide affinity (SPA) APMS procedure developed for the bacterium Escherichia coli that can be used to isolate and characterize stable multi-protein complexes to near homogeneity even starting from low copy numbers per cell.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the identification of the subunit composition of multi-protein complexes can provide insight into gene function and enhance understanding of biological systems1, 2. Physical interactions can be mapped with high confidence vialarge-scale isolation and characterization of endogenous protein complexes under near-physiological conditions based on affinity purification of chromosomally-tagged proteins in combination with mass spectrometry (APMS). This approach has been successfully applied in evolutionarily diverse organisms, including yeast, flies, worms, mammalian cells, and bacteria1-6. In particular, we have generated a carboxy-terminal Sequential Peptide Affinity (SPA) dual tagging system for affinity-purifying native protein complexes from cultured gram-negative Escherichia coli, using genetically-tractable host laboratory strains that are well-suited for genome-wide investigations of the fundamental biology and conserved processes of prokaryotes1, 2, 7. Our SPA-tagging system is analogous to the tandem affinity purification method developed originally for yeast8, 9, and consists of a calmodulin binding peptide (CBP) followed by the cleavage site for the highly specific tobacco etch virus (TEV) protease and three copies of the FLAG epitope (3X FLAG), allowing for two consecutive rounds of affinity enrichment. After cassette amplification, sequence-specific linear PCR products encoding the SPA-tag and a selectable marker are integrated and expressed in frame as carboxy-terminal fusions in a DY330 background that is induced to transiently express a highly efficient heterologous bacteriophage lambda recombination system10. Subsequent dual-step purification using calmodulin and anti-FLAG affinity beads enables the highly selective and efficient recovery of even low abundance protein complexes from large-scale cultures. Tandem mass spectrometry is then used to identify the stably co-purifying proteins with high sensitivity (low nanogram detection limits).

Here, we describe detailed step-by-step procedures we commonly use for systematic protein tagging, purification and mass spectrometry-based analysis of soluble protein complexes from E. coli, which can be scaled up and potentially tailored to other bacterial species, including certain opportunistic pathogens that are amenable to recombineering. The resulting physical interactions can often reveal interesting unexpected components and connections suggesting novel mechanistic links. Integration of the PPI data with alternate molecular association data such as genetic (gene-gene) interactions and genomic-context (GC) predictions can facilitate elucidation of the global molecular organization of multi-protein complexes within biological pathways. The networks generated for E. coli can be used to gain insight into the functional architecture of orthologous gene products in other microbes for which functional annotations are currently lacking.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. Construction of Gene-specific SPA-tagging in E. coli DY330 Strain

  1. The plasmid pJL148 encompassing the SPA-tag DNA sequence and the kanamycin antibiotic resistance marker cassette (KanR) are used as a template in polymerase chain reaction (PCR) amplification7. A 45 nt gene-specific forward primer, located immediately upstream of the target gene stop codon in frame with a 27 bp (5'- AGCTGGAGGATCCATGGAAAAGAGAAG -3') tag specific forward primer, and a 45 nt gene-specific reverse primer, located immediately downstream of the target gene stop codon in frame with a 27 bp (5'- GGCCCCATATGAATATCCTCCTTAGTT -3') tag specific reverse ....

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Once tagged bait proteins, which are expressed at endogenous levels are affinity-purified from logarithmic phase cultures the samples were run on a silver-stain gel to visualize the individual polypeptide components of the isolated stable complexes. We also subjected a second portion of the affinity-purified protein samples to gel-free tandem mass spectrometry (LCMS) to identify the corresponding polypeptide sequences. The effectiveness of this APMS procedure is shown with a representative SDS-PAGE analysis of the compon.......

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

A key aspect of the SPA-based APMS approach described here is that tagging is performed within the natural chromosomal context, thereby ensuring normal gene regulation is maintained (i.e. native bait promoter preserved, hence expression levels is not perturbed) and native stably-associated protein complexes are recovered at near-endogenous levels. Operon polarity issues are also avoided by including an outwardly oriented promoter in the selectable marker. This SPA-tagging approach is effective enough to purify t.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

No conflicts of interest declared.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

This work was supported by funds from the Canadian Foundation for Innovation, Genome Canada, the Ontario Genomics Institute, the Ontario Ministry of Innovation, and the Canadian Institutes of Health Research grant to J.G. and A.E. The Red-expressing E. coli strain DY330 was a kind gift from Donald L. Court (National Cancer Institute, Frederick, MD).

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
I. Antibiotics
KanamycinBioshop#KAN201
AmpicillinBioshop#AMP201
2. Terrific-Broth medium
Bio-TryptoneBioshop#TRP 402
Yeast extractBioshop#YEX 555
GlycerolBioshop#GLY 002
K2HPO4Bioshop#PPM 302
KH2PO4Bioshop#PPM 303
3. Bacterial Strain and Plasmid
DY330Yu et al. (2000)10
pJL148Zeghouf et al. (2004)7
4. PCR and Electrophoresis Reagents
Taq DNA polymeraseFermentas# EP0281
10 X PCR bufferFermentas# EP0281
10 mM dNTPsFermentas# EP0281
25 mM MgCl2Fermentas# EP0281
AgaroseBioshop# AGA002
Loading dyeNEB#B7021S
Ethidium bromideBioshop# ETB444
10X TBE bufferThermo Scientific#28355
Tris BaseBioshop#TRS001
Boric acidBioshop#BOR001
0.5 M EDTA (pH 8.0)Sigma# E6768
DNA ladderNEB#N3232L
5. Plasmid isolation and Clean-up Kits
Plasmid Midi kitQiagen#12143
QIAquick PCR purification kitQiagen#28104
6. PCR and Transformation Equipments
Thermal cyclerBioRadiCycler
Agarose gel electrophoresisBioRad
ElectroporatorBio-RadGenePulser II
0.2 cm electroporation cuvetteBio-Rad
42 °C water bath shakerInnova 3100
Beckman Coulter TJ-25 centrifugeBeckman CoulterTS-5.1-500
32 °C ShakerNew Brunswick Scientific, USA
32 °C large ShakerNew Brunswick Scientific, USA
32 °C plate incubatorFisher Scientific
7. Electrophoresis and Western blotting
Acrylamide monomer, N,N'- methylenebis-acrylamideBio-Rad#161-0125
Ammonium persulfateBioshop# AMP001
n-butanolSigma# B7906
TEMEDBioshop#TEM001
Whatman No. 1 filter paperFischer Scientific#09-806A
Mini protean 3 cellBio-Rad#165-3301
iBlot gel transfer deviceInvitrogen#IB1001
Nitrocellulose membranesBio-Rad#162-0115
Monoclonal Anti-Flag M2 antibodySigma#F3165
Horseradish peroxidaseAmersham#NA931V
Pre-stained protein molecular weight standardsBio-Rad#161-0363
Chemiluminescence reagentPIERCE#1856136
Autoradiography filmClonex Corp#CLEC810
Quick Draw blotting paperSigma#P7796
C2 platform rocking shakerNew Brunswick Scientific, USA
8. Sonication Equipment and Reagents
SonicatorBranson Ultrasonic#23395
NaClBioshop#SOD001
Protease inhibitorsRoche#800-363-5887
0.5 mM TCEP-HClThermo Scientific#20490
9. Affinity Purification Reagents and Equipment
0.8 x 4 cm Bio-Rad polypropylene columnBio-Rad#732-6008
Benzonase nucleaseNovagen#70746
Anti-FLAG M2 agarose beadsSigma#A2220
Calmodulin-sepharose beadsGE Healthcare#17-0529-01
TEV proteaseInvitrogen#12575-015
Triton X-100Sigma#T9284
CaCl2Sigma#C2661
EGTASigma#E3889
LabQuake ShakerThermolyne#59558
10. Silver Staining Reagents
MethanolBioshop#MET302
Acetic acidBioshopt#ACE222
Sodium-thiosulfateSigma#S-7143
Silver nitrateFischer Scientific#S181-100
FormaldehydeBioshop#FOR201
Sodium carbonateBioshop#SOC512
11. Reagents and Equipment for Protein Identification
Trypsin Gold, Mass Spectrometry GradePromega# V5280
50 mM NH4HCO3Bioshop#AMC555
1 mM CaCl2Bioshop#CCL302
AcetonitrileSigma#A998-4
Formic acidSigma#F0507
HPLC grade waterSigma#95304
IodoacetamideSigma#16125
Millipore Zip-TipMillipore# ZTC18M960
~10 cm of 3 μm Luna-C18 resinPhenomenex
Proxeon nano HPLC pumpThermo Fisher Scientific
LTQ Orbitrap Velos mass spectrometerThermo Fisher Scientific
12. Labware
4 liter conical flasksVWR#89000-372
50 ml polypropylene falcon tubesAny Vendor
1.5 ml micro-centrifuge tubesAny Vendor
250 ml conical flaksVWR#29140-045
15 ml sterile culture tubesThermo Scientific#366052
Cryogenic vialsVWR#479-3221
-80 °C freezerFisher Scientific#13-990-14
Speed vacuum systemThermo Scientific

Buffers and Solutions

1. 1 liter Terrific Broth (TB) media

11 g Bio-Tryptone
22 g Yeast Extract
2% Glycerol
50 ml potassium salt stock solution

2. Potassium Salt Stock Solution

1.5 M K2HPO4
0.35 M KH2PO4

3. Sonication Buffer

20 mM Tris-HCl (pH 7.9)
150 mM NaCl
0.2 mM EDTA
10% Glycerol
Before use add protease inhibitor (PI) and 0.1-0.5 mM TCEP

4. AFC buffer

30 mM Tris-HCl (pH 7.9)
150 mM NaCl
0.1% detergent
Before use add PI and 0.1-0.5 mM TCEP

5. TEV cleavage buffer

30 mM Tris-HCl (pH 7.9)
150 mM NaCl
0.2 mM EDTA
0.1% detergent
Before use add PI and 0.1-0.5 mM TCEP

6. Calmodulin binding buffer

30 mM Tris-HCl (pH 7.9)
150 mM NaCl
2 mM CaCl2
0.1% detergent
Before use add PI and 0.1-0.5 mM TCEP

7. Calmodulin wash buffer

30 mM Tris-HCl pH 7.9
150 mM NaCl
2 mM CaCl2
0.1-0.5 mM TCEP

8. Calmodulin elution buffer

30 mM Tris-HCl (pH 7.9)
100 mM NaCl
10 mM EGTA
0.1-0.5 mM TCEP

9. Developing solution (1L)

37% Formaldehyde
30 g sodium carbonate
1000 ml distilled water

10. Digestion buffer

50 mM NH4HCO3
1 mM CaCl2

11. Wetting and Equilibration solution

70% acetonitrile (ACN) in 0.1% formic acid

12. Washing solution

100% H2O in 0.1% formic acid

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Butland, G., et al. Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature. 433, 531-537 (2005).
  2. Hu, P., Janga, S. C., Babu, M., Diaz-Mejia, J. J., Butland, G. Global functional atlas of ....

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Protein Complex IdentificationSequential Peptide Affinity PurificationTandem Mass SpectrometryEscherichia coliAffinity Purification Mass SpectrometryProtein Protein InteractionsSPA Tagging SystemCalmodulin Binding PeptideAnti FLAG Affinity BeadsTEV Protease Cleavage

Related Articles