A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

48.3K views

⸱

DOI:

10.3791/4057

⸱

November 12th, 2012

In This Article

Summary

Affinity purification of tagged proteins in combination with mass spectrometry (APMS) is a powerful method for the systematic mapping of protein interaction networks and for investigating the mechanistic basis of biological processes. Here, we describe an optimized sequential peptide affinity (SPA) APMS procedure developed for the bacterium Escherichia coli that can be used to isolate and characterize stable multi-protein complexes to near homogeneity even starting from low copy numbers per cell.

Abstract

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the identification of the subunit composition of multi-protein complexes can provide insight into gene function and enhance understanding of biological systems1, 2. Physical interactions can be mapped with high confidence vialarge-scale isolation and characterization of endogenous protein complexes under near-physiological conditions based on affinity purification of chromosomally-tagged proteins in combination with mass spectrometry (APMS). This approach has been successfully applied in evolutionarily diverse organisms, including yeast, flies, worms, mammalian cells, and bacteria1-6. In particular, we have generated a carboxy-terminal Sequential Peptide Affinity (SPA) dual tagging system for affinity-purifying native protein complexes from cultured gram-negative Escherichia coli, using genetically-tractable host laboratory strains that are well-suited for genome-wide investigations of the fundamental biology and conserved processes of prokaryotes1, 2, 7. Our SPA-tagging system is analogous to the tandem affinity purification method developed originally for yeast8, 9, and consists of a calmodulin binding peptide (CBP) followed by the cleavage site for the highly specific tobacco etch virus (TEV) protease and three copies of the FLAG epitope (3X FLAG), allowing for two consecutive rounds of affinity enrichment. After cassette amplification, sequence-specific linear PCR products encoding the SPA-tag and a selectable marker are integrated and expressed in frame as carboxy-terminal fusions in a DY330 background that is induced to transiently express a highly efficient heterologous bacteriophage lambda recombination system10. Subsequent dual-step purification using calmodulin and anti-FLAG affinity beads enables the highly selective and efficient recovery of even low abundance protein complexes from large-scale cultures. Tandem mass spectrometry is then used to identify the stably co-purifying proteins with high sensitivity (low nanogram detection limits).

Here, we describe detailed step-by-step procedures we commonly use for systematic protein tagging, purification and mass spectrometry-based analysis of soluble protein complexes from E. coli, which can be scaled up and potentially tailored to other bacterial species, including certain opportunistic pathogens that are amenable to recombineering. The resulting physical interactions can often reveal interesting unexpected components and connections suggesting novel mechanistic links. Integration of the PPI data with alternate molecular association data such as genetic (gene-gene) interactions and genomic-context (GC) predictions can facilitate elucidation of the global molecular organization of multi-protein complexes within biological pathways. The networks generated for E. coli can be used to gain insight into the functional architecture of orthologous gene products in other microbes for which functional annotations are currently lacking.

Protocol

1. Construction of Gene-specific SPA-tagging in E. coli DY330 Strain

  1. The plasmid pJL148 encompassing the SPA-tag DNA sequence and the kanamycin antibiotic resistance marker cassette (KanR) are used as a template in polymerase chain reaction (PCR) amplification7. A 45 nt gene-specific forward primer, located immediately upstream of the target gene stop codon in frame with a 27 bp (5'- AGCTGGAGGATCCATGGAAAAGAGAAG -3') tag specific forward primer, and a 45 nt gene-specific reverse primer, located immediately downstream of the target gene stop codon in frame with a 27 bp (5'- GGCCCCATATGAATATCCTCCTTAGTT -3') tag specific reverse primer, are used to amplify the SPA-tag and KanR cassette from the pJL148 using the following PCR cycling conditions: 94 °C for 5 min; 30 cycles of 94 °C for 1 min, 55 °C for 1 min, 68 °C for 2 min 10 sec, followed by 68 °C for 10 min. These amplified sequences serve as substrates for the ectopically introduced λ-Red homologous recombination machinery (see below).
  2. The PCR product is purified using a Qiaquick PCR purification kit to remove salts that may interfere with the electroporation. The purified PCR product is subsequently targeted to integrate at the 3' end (immediately upstream of the native stop codon) of a specific gene in DY330 strain in which the λ-Red recombination machinery is expressed10.
  3. The DY330 λ-Red expressing strain is grown overnight in 2 ml Luria-Bertani (LB) medium at 32 °C by shaking at 180 rpm. 1 ml of the overnight culture is subsequently inoculated into 70 ml fresh LB medium in 500 ml conical flask. The inoculum is grown at 32 °C by shaking at 180 rpm until the OD600 reaches ~0.8.
  4. The culture is transferred into a fresh 250 ml conical flask, where the cells are induced by incubating the flask in a water bath at 42 °C by gently shaking at 180 rpm for 15 min. Immediately after the induction, the flask is incubated in an ice water slurry bath for at least 30 min with shaking.
  5. The ice-cold culture is immediately transferred into pre-chilled 50 ml polypropylene tube and subjected to centrifugation at 3,993 x g for 6 min at 4 °C. The cell pellet is resuspended in 50 ml ice-cold sterile water and centrifuged once again at 3,993 x g for 6 min at 4 °C. The cell pellet is then resuspended in 1 ml of cold water and transferred to a 1.5 ml Effendorf tube, and centrifuged at maximum speed for 20 sec at 4 °C. After two or three washing steps with ice cold water, the cell pellet is resuspended finally in 700 μl of ice-cold sterile water, resulting in electro-competent cells.
  6. Through electroporation, one μl of the purified amplicon is introduced into 40 μl of the electro-competent cells. The cells are electroporated in a Bio-Rad GenePulser II with following settings: 2.5 kV, 25 μF with pulse controller of 200 Ω. After homologous recombination and integration, the transformants that successfully recombined the tag/cassette into the chromosome are selected based on resistance to Kan (Figure 1A). Multiple transformants are selected for Western blotting to verify the correct generation (i.e. positive signal) of SPA-tagged fusion proteins with anti-FLAG M2 antibody that is selective against the FLAG epitopes of the SPA-tag.
  7. Confirmed carboxy terminal SPA-tag fusion strain is cultured on a large-scale to isolate soluble protein complexes from harvested cells using the SPA purification protocol. The outline of the steps involved in the affinity tag purification procedure is shown in Figure 1B.

2. Culturing and Sonication

  1. Inoculate 100 μl of a SPA-tagged E. coli glycerol stock into 50 ml terrific broth (TB) liquid medium supplemented with 50 μl of 25 μg/ml of Kan solution in a 250 ml conical flask. Grow the culture overnight at 32 °C.
    Note: Since the temperature-inducible λ Red cassette in strain DY330 is under the control of a temperature-sensitive repressor10, the SPA-tagged E. coli strain is grown at 32 °C.
  2. Transfer 10 ml of the overnight culture into 990 ml fresh TB supplemented with 25 μg/ml of Kan in a 4 liter flask. The culture is grown at 32 °C with constant shaking at 250 rpm, for 5 to 6 hr, until the OD600 reaches to ~ 2 to 3.
  3. Transfer the 1 liter E. coli SPA-tag culture to clean centrifugation bottles and spin the cells at 4 °C in Beckman J6-HC centrifuge @ 3993 x g for 15 min.
  4. The supernatant is removed from the centrifugation bottles. Resuspend the E. coli cell pellets with 25 ml of sonication buffer. Ensure to keep the centrifugation bottles on ice at all times.
  5. The resuspended pellet is transferred to 50 ml polypropylene Falcon tube and frozen using liquid nitrogen. The frozen cells are stored at -80 °C for long-term use.
  6. Prior to sonication, thaw the frozen cells completely by keeping the pellets on ice. The thawed samples are transferred to a sterile stainless steel cup placed on ice for sonication. The probe is submerged into the sample and sonicated for 3 min. An additional 2 min is allowed to cool the sample from overheating.
  7. The sonicated cell lysate is transferred into the pre-chilled sterile centrifugation tube, and subjected to centrifugation at 4 °C in Beckman centrifuge using a JA-17 rotor @ 35,267 x g (16,000 rpm) for 15 min twice.
    Note: In the case of membrane protein purification, the sonicated cell lysate is centrifuged only once for 15 min because we do not know in which fraction the membrane proteins are, that is, either in the pellet or in the supernatant fraction. So to avoid excess loss of membrane proteins, we spin the cells for 15 min at high-speed centrifugation and the supernatant is subsequently processed for purification (see steps below) where 1% detergent is used to solubilize the membrane proteins.
  8. The supernatant from the centrifugation tube is carefully transferred to a 50 ml polypropylene Falcon tube and frozen using liquid nitrogen. The sonicated frozen cell extract is stored for a maximum period of 6 months at -80 °C for future use.

3. Affinity Purification

  1. Prior to use, 100 μl of anti-flag M2 beads are washed by 10 volumes of AFC buffer (30 mM Tris-HCl, 150 mM NaCl, 0.1% detergent, and 0.1-0.5 mM TCEP [tris (2-carboxyethyl) phosphine-hydrochloric acid]) without the detergent and the reducing agent TCEP (tris (2-carboxyethyl) phosphine).
  2. The frozen, sonicated cell extract is thawed by placing the tube in cold water. The thawed cell extract is incubated with 3 μl of benzonase nuclease for 30 min at 4 °C. To this mixture, add non-ionic detergent Triton X-100 (final concentration of the detergent should be 0.1%) and 200 μl suspensions of anti-flag M2 agarose beads.
    Note: For all soluble protein purifications, 0.1% Triton X-100 is used to minimize non-specific adsorption, where as for purifying a membrane protein, different mild non-ionic detergents, such as C12E8 (Octaethylene glycol dodecyl ether), DDM (n-Dodecyl β-D-maltoside) and Maltose-neopentyl glycol (MNG) can be used at a 1% detergent concentration to enhance solubilization. Since different detergents have varying solubilization efficiency of membrane proteins, it is recommended to perform independent protein purifications using more than one detergent.
  3. The content is gently mixed by rotating the tube for 3 hr at 4 °C using a LabQuake shaker. After 3 hr of rotation, the tube is centrifuged at 1,700 x g for 6 min. The supernatant is then removed carefully, as much as possible, without disturbing the loose bead pellet.
  4. The pellet is resuspended in the remaining supernatant and then transferred into a 0.8 x 4 cm Bio-Rad polypropylene prep column. Ensure to remove the bottom outlet plugs of the column, to allow the eluates to drain by gravity flow. Wash the column 5 times with TEV cleavage step.
  5. After draining the washed eluates, the bottom outlet of the column is closed. To the same column, cleavage is performed by adding ~5 to 10 μl (50 units) of TEV protease and 400 μl of 1X AFC buffer onto the column. Ensure to close the top of the column with a cap. The column containing the beads are rotated gently overnight at 4 °C overnight using a LabQuake shaker.
  6. Remove the cap on the top and the outlet plug at the bottom of the column, and drain the eluates recovered after TEV cleavage into a fresh column containing 200 μl suspensions of calmodulin-sepharose beads, which is washed by 10 volumes of calmodulin binding buffer.
  7. Both the top and the bottom of the column are fastened tightly, and the contents in the column are mixed gently by rotating for 3 hr at 4 °C using a LabQuake shaker.
  8. After 3 hr of rotation, the eluate is drained by removing the top cap and the bottom plug of the column. The column is washed four times with 200 μl of 1X calmodulin binding buffer followed by one stringent wash with 400 μl of calmodulin wash buffer.
  9. The bound protein is eluted in four fractions of 50 μl in a fresh Eppendorf tube using 1X calmodulin elution buffer. The eluted fraction is distributed in two clean Eppendorf tubes in equal volumes. Both the tubes are subsequently dried using a speed vacuum.
  10. The dried eluate from one tube is used for running a silver staining gel, while the other is stored in -80 °C, prior to using mass spectrometry.

4. Silver Staining

  1. For silver staining, half the volume of 3X SDS (sodium dodecyl sulfate) sample buffer is added to 50 μl of the dried eluate. After boiling the mixture for 5 min, the samples are loaded onto a SDS polyacrylamide gel.
  2. After the gel has finished running, it is carefully placed into fixing solution (50% methanol and 10% acetic acid) and agitated gently on a rotary shaker for 20 min. The gel is then rinsed in 20% ethanol for 10 min.
  3. The fixed gel is washed twice thoroughly with 500 ml of double distilled water for 10 min to ensure low uniform background.
  4. The gel is then agitated gently in 500 ml sodium-thiosulfate for 1 min, followed by two washing steps with distilled water for 20 sec.
  5. The water is discarded, and the gel is incubated in 200 ml of 0.1% silver nitrate for 30 min. After that time, the silver nitrate is removed and the gel is washed with distilled water for 20 sec to remove the excess silver nitrate.
  6. The gel is finally hand agitated in 75 ml of the developing solution. When the desired intensity is achieved, the developing solution is discarded and 80 ml of acetic acid is added to stop the reaction. Ensure to incubate the gel in acetic acid for a minimum of 20 min for proper visualization of gel bands.

5. Proteolysis and Sample Preparation for Mass Spectrometry

  1. To the dried sample, add 50 μl of the digestion buffer and 0.9 μl of 100 mM TCEP-HCl (tris (2-carboxyethyl) phosphine-hydrochloric acid) and incubate the mixture for 45 min at room temperature for the reduction step. Next, 1 μl of 500 mM iodoacetamide is added and incubated in dark for another 40 min to allow for sample alkylation.
  2. After the second round of incubation, add 1 μg of immobilized trypsin to the mixture and incubate either at 37 °C for 5 hr or overnight at room temperature. Ensure to stop the reaction by adding 1 μl of acetic acid.
  3. Pre-wet the Millipore Zip-Tip pipette tip by aspirating 10 μl of the wetting and equilibration solution. Dispense the solution to waste. Subsequently aspirate 10 μl of the washing solution and dispense the solution to waste. Repeat this step twice.
  4. For efficient binding of the peptide mixture to the tip, pipette mix the peptide mixture 20 times. The peptide mixture that adhered to the tip is washed off by aspirating and dispensing the washing solution. Repeat this procedure twice for efficient binding of the peptide mixture to the tip.
  5. With the tip containing the bound peptide, aspirate 10 μl of the wetting and equilibration solution, and dispense into a clean eppendorf tube. Repeat this step two times. After drying the eluted samples in speed vacuum, the samples can be analyzed immediately by mass spectrometry or stored at -80 °C prior to use.

6. Protein Identification by LTQ Orbitrap Velos Mass Spectrometer

The polypeptide components of the isolated complexes are identified using an LTQ Orbitrap Velos hybrid tandem mass spectrometer. The Orbitrap has exceptional resolving power (>60,000 Full Width Half Maximum, or FWHM) and mass accuracy (<2 ppm) that minimizes MS/MS sampling of irrelevant non-specific background contaminants detected in control purifications, while the high speed Velos ion trap component can detect and fragment low abundance peptides using both electron transfer dissociation and collision-induced dissociation modes. High confidence matches among resulting MS/MS spectra are mapped to reference E. coli protein sequences using database search algorithm like SEQUEST and each matching sequence evaluated during a probability algorithm like STATQUEST11. The total spectra number, peptide sequence uniqueness and common background contaminants detected in negative control (i.e. mock) purifications are considered to achieve a low empirical false-discovery rate. The following steps are performed for protein identification:

  1. The micro-columns are packed with ~10 cm of 3 μm Luna-C18 resin and are interfaced to a Proxeon nanoelectrospray ion source that is placed in line with the Orbitrap instrument.
  2. A Proxeon nano flow binary HPLC pump is used to deliver a stable tip flow rate of ~300 nl min-1 during the peptide separations.
  3. To achieve peptide elution, an organic buffer gradient is set up according to the sample complexity. For example, the following gradient is typically set up for E. coli SPA samples: solvent B is increased from 2% to 6% in 1 min, to 24% in 38 min, to 100% in next 4 min, held at 100% for 1 min, then decreased to 2% in 1 min, and final hold at 2% for 15 min. The mobile phase solvent A has 95% HPLC gradient water and 5% ACN with 0.1% formic acid, while solvent B has 5% HPLC gradient water and 95% ACN with 0.1% formic acid. The flow rate at tip of the needle is set to 300 nl min-1 for 60 min.
  4. As the mass spectrometer cycles run through one full mass scan at 60,000 resolutions, 10 concomitant tandem fragmentation mass scans are collected for the most intense precursor ions. Dynamic exclusion, monoisotopic mass selection, and real time data-dependent acquisition instrument features are enabled.
  5. The spectra are searched using a database search algorithm such as SEQUEST against a database of E. coli protein sequences, and the result is statistically filtered using a probability algorithm such as STAQUEST11 to ensure a low false discovery rate. Only high confidence (99% probability) candidates are selected, while matches showing more than 10 ppm mass error compared to the theoretical peptide mass are eliminated from further consideration.

Access restricted. Please log in or start a trial to view this content.

Results

Once tagged bait proteins, which are expressed at endogenous levels are affinity-purified from logarithmic phase cultures the samples were run on a silver-stain gel to visualize the individual polypeptide components of the isolated stable complexes. We also subjected a second portion of the affinity-purified protein samples to gel-free tandem mass spectrometry (LCMS) to identify the corresponding polypeptide sequences. The effectiveness of this APMS procedure is shown with a representative SDS-PAGE analysis of the compon...

Access restricted. Please log in or start a trial to view this content.

Discussion

A key aspect of the SPA-based APMS approach described here is that tagging is performed within the natural chromosomal context, thereby ensuring normal gene regulation is maintained (i.e. native bait promoter preserved, hence expression levels is not perturbed) and native stably-associated protein complexes are recovered at near-endogenous levels. Operon polarity issues are also avoided by including an outwardly oriented promoter in the selectable marker. This SPA-tagging approach is effective enough to purify t...

Access restricted. Please log in or start a trial to view this content.

Disclosures

No conflicts of interest declared.

Acknowledgements

This work was supported by funds from the Canadian Foundation for Innovation, Genome Canada, the Ontario Genomics Institute, the Ontario Ministry of Innovation, and the Canadian Institutes of Health Research grant to J.G. and A.E. The Red-expressing E. coli strain DY330 was a kind gift from Donald L. Court (National Cancer Institute, Frederick, MD).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
I. Antibiotics
KanamycinBioshop#KAN201
AmpicillinBioshop#AMP201
2. Terrific-Broth medium
Bio-TryptoneBioshop#TRP 402
Yeast extractBioshop#YEX 555
GlycerolBioshop#GLY 002
K2HPO4Bioshop#PPM 302
KH2PO4Bioshop#PPM 303
3. Bacterial Strain and Plasmid
DY330Yu et al. (2000)10
pJL148Zeghouf et al. (2004)7
4. PCR and Electrophoresis Reagents
Taq DNA polymeraseFermentas# EP0281
10 X PCR bufferFermentas# EP0281
10 mM dNTPsFermentas# EP0281
25 mM MgCl2Fermentas# EP0281
AgaroseBioshop# AGA002
Loading dyeNEB#B7021S
Ethidium bromideBioshop# ETB444
10X TBE bufferThermo Scientific#28355
Tris BaseBioshop#TRS001
Boric acidBioshop#BOR001
0.5 M EDTA (pH 8.0)Sigma# E6768
DNA ladderNEB#N3232L
5. Plasmid isolation and Clean-up Kits
Plasmid Midi kitQiagen#12143
QIAquick PCR purification kitQiagen#28104
6. PCR and Transformation Equipments
Thermal cyclerBioRadiCycler
Agarose gel electrophoresisBioRad
ElectroporatorBio-RadGenePulser II
0.2 cm electroporation cuvetteBio-Rad
42 °C water bath shakerInnova 3100
Beckman Coulter TJ-25 centrifugeBeckman CoulterTS-5.1-500
32 °C ShakerNew Brunswick Scientific, USA
32 °C large ShakerNew Brunswick Scientific, USA
32 °C plate incubatorFisher Scientific
7. Electrophoresis and Western blotting
Acrylamide monomer, N,N'- methylenebis-acrylamideBio-Rad#161-0125
Ammonium persulfateBioshop# AMP001
n-butanolSigma# B7906
TEMEDBioshop#TEM001
Whatman No. 1 filter paperFischer Scientific#09-806A
Mini protean 3 cellBio-Rad#165-3301
iBlot gel transfer deviceInvitrogen#IB1001
Nitrocellulose membranesBio-Rad#162-0115
Monoclonal Anti-Flag M2 antibodySigma#F3165
Horseradish peroxidaseAmersham#NA931V
Pre-stained protein molecular weight standardsBio-Rad#161-0363
Chemiluminescence reagentPIERCE#1856136
Autoradiography filmClonex Corp#CLEC810
Quick Draw blotting paperSigma#P7796
C2 platform rocking shakerNew Brunswick Scientific, USA
8. Sonication Equipment and Reagents
SonicatorBranson Ultrasonic#23395
NaClBioshop#SOD001
Protease inhibitorsRoche#800-363-5887
0.5 mM TCEP-HClThermo Scientific#20490
9. Affinity Purification Reagents and Equipment
0.8 x 4 cm Bio-Rad polypropylene columnBio-Rad#732-6008
Benzonase nucleaseNovagen#70746
Anti-FLAG M2 agarose beadsSigma#A2220
Calmodulin-sepharose beadsGE Healthcare#17-0529-01
TEV proteaseInvitrogen#12575-015
Triton X-100Sigma#T9284
CaCl2Sigma#C2661
EGTASigma#E3889
LabQuake ShakerThermolyne#59558
10. Silver Staining Reagents
MethanolBioshop#MET302
Acetic acidBioshopt#ACE222
Sodium-thiosulfateSigma#S-7143
Silver nitrateFischer Scientific#S181-100
FormaldehydeBioshop#FOR201
Sodium carbonateBioshop#SOC512
11. Reagents and Equipment for Protein Identification
Trypsin Gold, Mass Spectrometry GradePromega# V5280
50 mM NH4HCO3Bioshop#AMC555
1 mM CaCl2Bioshop#CCL302
AcetonitrileSigma#A998-4
Formic acidSigma#F0507
HPLC grade waterSigma#95304
IodoacetamideSigma#16125
Millipore Zip-TipMillipore# ZTC18M960
~10 cm of 3 μm Luna-C18 resinPhenomenex
Proxeon nano HPLC pumpThermo Fisher Scientific
LTQ Orbitrap Velos mass spectrometerThermo Fisher Scientific
12. Labware
4 liter conical flasksVWR#89000-372
50 ml polypropylene falcon tubesAny Vendor
1.5 ml micro-centrifuge tubesAny Vendor
250 ml conical flaksVWR#29140-045
15 ml sterile culture tubesThermo Scientific#366052
Cryogenic vialsVWR#479-3221
-80 °C freezerFisher Scientific#13-990-14
Speed vacuum systemThermo Scientific

Buffers and Solutions

1. 1 liter Terrific Broth (TB) media

11 g Bio-Tryptone
22 g Yeast Extract
2% Glycerol
50 ml potassium salt stock solution

2. Potassium Salt Stock Solution

1.5 M K2HPO4
0.35 M KH2PO4

3. Sonication Buffer

20 mM Tris-HCl (pH 7.9)
150 mM NaCl
0.2 mM EDTA
10% Glycerol
Before use add protease inhibitor (PI) and 0.1-0.5 mM TCEP

4. AFC buffer

30 mM Tris-HCl (pH 7.9)
150 mM NaCl
0.1% detergent
Before use add PI and 0.1-0.5 mM TCEP

5. TEV cleavage buffer

30 mM Tris-HCl (pH 7.9)
150 mM NaCl
0.2 mM EDTA
0.1% detergent
Before use add PI and 0.1-0.5 mM TCEP

6. Calmodulin binding buffer

30 mM Tris-HCl (pH 7.9)
150 mM NaCl
2 mM CaCl2
0.1% detergent
Before use add PI and 0.1-0.5 mM TCEP

7. Calmodulin wash buffer

30 mM Tris-HCl pH 7.9
150 mM NaCl
2 mM CaCl2
0.1-0.5 mM TCEP

8. Calmodulin elution buffer

30 mM Tris-HCl (pH 7.9)
100 mM NaCl
10 mM EGTA
0.1-0.5 mM TCEP

9. Developing solution (1L)

37% Formaldehyde
30 g sodium carbonate
1000 ml distilled water

10. Digestion buffer

50 mM NH4HCO3
1 mM CaCl2

11. Wetting and Equilibration solution

70% acetonitrile (ACN) in 0.1% formic acid

12. Washing solution

100% H2O in 0.1% formic acid

References

  1. Butland, G., et al. Interaction network containing conserved and essential protein complexes in Escherichia coli. Nature. 433, 531-537 (2005).
  2. Hu, P., Janga, S. C., Babu, M., Diaz-Mejia, J. J., Butland, G. Global functional atlas of Escherichia coli encompassing previously uncharacterized proteins. PLoS Biol. 7, e1000096(2009).
  3. Krogan, N. J., et al. Global landscape of protein complexes in the yeast Saccharomyces cerevisiae. Nature. 440, 637-643 (2006).
  4. Mak, A. B., et al. A lentiviral functional proteomics approach identifies chromatin remodeling complexes important for the induction of pluripotency. Mol. Cell Proteomics. 9, 811-823 (2010).
  5. Polanowska, J., et al. Tandem immunoaffinity purification of protein complexes from Caenorhabditis elegans. Biotechniques. 36, 778-782 (2004).
  6. Veraksa, A., Bauer, A., Artavanis-Tsakonas, S. Analyzing protein complexes in Drosophila with tandem affinity purification-mass spectrometry. Dev. Dyn. 232, 827-834 (2005).
  7. Zeghouf, M., et al. Sequential Peptide Affinity (SPA) system for the identification of mammalian and bacterial protein complexes. J. Proteome Res. 3, 463-468 (2004).
  8. Puig, O., et al. The tandem affinity purification (TAP) method: a general procedure of protein complex purification. Methods. 24, 218-229 (2001).
  9. Rigaut, G., et al. A generic protein purification method for protein complex characterization and proteome exploration. Nat. Biotechnol. 17, 1030-1032 (1999).
  10. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 97, 5978-5983 (2000).
  11. Kislinger, T., et al. PRISM, a generic large scale proteomic investigation strategy for mammals. Mol. Cell Proteomics. 2, 96-106 (2003).
  12. Vlasblom, J., et al. GenePro: a Cytoscape plug-in for advanced visualization and analysis of interaction networks. Bioinformatics. 22, 2178-219 (2006).
  13. de Berardinis, V., et al. A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1. Mol. Syst. Biol. 4, 174(2008).
  14. Babu, M., et al. Sequential peptide affinity purification system for the systematic isolation and identification of protein complexes from Escherichia coli. Methods Mol. Biol. 564, 373-400 (2009).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Protein Complex IdentificationAffinity Purification Mass SpectrometryProtein-Protein InteractionsSPA Tagging SystemCalmodulin Binding PeptideAnti-FLAG Affinity BeadsTEV Protease Cleavage