Methode voor het labelen van afschriften in individuele Escherichia coli cellen voor Single-molecuul fluorescentie In Situ hybridisatie experimenten
Summary
Dit manuscript beschrijft een methode voor het labelen van individuele boodschapper-RNA (mRNA) afschriften met fluorescently-geëtiketteerden DNA sondes, voor gebruik in single-molecuul fluorescentie in situ hybridisatie (smFISH) proeven in E. coli. smFISH is een visualisatie methode waarmee de simultane detectie-, lokalisatie- en kwantificering van afzonderlijke mRNA moleculen in vaste afzonderlijke cellen.
Abstract
Een methode is beschreven voor het labelen van individuele boodschapper-RNA (mRNA) afschriften in vaste bacteriën voor gebruik in single-molecuul fluorescentie in situ hybridisatie (smFISH) proeven in E. coli. smFISH kunt de meting van cel naar cel variabiliteit in exemplaaraantal van mRNA van genen van belang, evenals de subcellular locatie van de transcripten. De belangrijkste stappen zijn fixatie van de cultuur van de bacteriële cel, permeabilization van celmembranen en kruising van de afschriften van de doelgroep met sets van verkrijgbare korte fluorescently-geëtiketteerden oligonucleotide sondes. smFISH kunnen de beeldvorming van de transcripties van meerdere genen in dezelfde cel, met de beperkingen die worden opgelegd door de spectrale overlap tussen verschillende fluorescente markeringen. Na voltooiing van het protocol hieronder geïllustreerd, cellen kunnen worden gemakkelijk beeld met behulp van een combinatie met een camera geschikt voor lage-intensiteit fluorescentie Microscoop. Deze beelden, samen met de cel contouren verkregen uit segmentatie van fase contrast frames, of uit het celmembraan kleuring, toestaan dat de berekening van de mRNA kopie nummer verdeling van een steekproef van cellen met behulp van open-source of aangepaste-geschreven software. De hier beschreven labeling methode kan ook worden toegepast op afbeelding chat-kopieën met de wederopbouw van stochastische optische microscopie (STORM).
Introduction
Onzekerheden is een fundamentele en onvermijdelijk aspect van genexpressie en geeft aanleiding tot cel heterogeniteit1, zowel op het niveau van afschriften en eiwitten2,3. Kwantificeren van de variabiliteit tussen de cellen onder welomschreven voorwaarden biedt een uniek venster in de fundamentele processen die ten grondslag liggen van genexpressie en de verordening. Een belangrijke bron van cel-cel heterogeniteit in bacteriën vindt plaats op het transcriptional niveau. De nummers van de transcript variëren niet alleen vanwege de onzekerheden van transcriptie, maar ook voor post-transcriptional processen zoals verordening door kleine RNAs en RNAases2. Unidirectioneel van het direct toegang tot deze heterogeniteit op een kwantitatieve manier is door fluorescently tagging afzonderlijke afschriften van een bepaald gen in smFISH. Deze methode kan de detectie en subcellular localisatie van bepaalde molecules van RNA in vaste, individuele bacteriecellen4. mRNAs zijn gekruist met een set van fluorescently-geëtiketteerden ~ 20 base-lange oligonucleotides, die zijn ontworpen om selectief te binden aan afschriften van belang5,6. Meerdere labeling zorgt voor detectie boven achtergrond fluorescentie en individuele mRNA moleculen als diffractie-limited vlekken onder een fluorescentie Microscoop7 (Zie Figuur 1). Er zijn andere benaderingen voor het labelen van mRNA moleculen, waarin de aanvullende oligomeren sondes voeren geconjugeerd haptens (b.v., biotine of Heksenkruid) die met behulp van secundaire fluorescently-geëtiketteerden verslaggever technieken8worden gedetecteerd.
Er zijn andere methoden die kwantitatieve informatie over afschriften, naast smFISH verschaffen. Sommigen, zoals de noordelijke vlek of kwantitatieve PCR, sonde van de bulk en dus het aantal exemplaren van mRNA, noch hun positie in afzonderlijke cellen kunnen meten. Deze methoden zijn dus niet geschikt om te kwantificeren van cel naar cel variabiliteit. Een recente beeld-gebaseerde techniek die het mogelijk maakt voor de kwantificering van zowel het exemplaaraantal van RNAs binnen cellen evenals hun intracellulaire locatie, genaamd multiplexed fout-robuuste fluorescentie in situ hybridisatie (MERFISH) ontwikkeld. MERFISH is gebaseerd op de toewijzing van een unieke barcode die bestaat uit een gedefinieerde combinatie van een vast aantal fluorescently-geëtiketteerden oligonucleotide sondes. Deze streepjescodes worden gelezen uit in opeenvolgende ronden van smFISH metingen, met photobleaching na elke ronde van hybridisatie, waardoor de doorvoer door twee ordes van grootte9,10. Deze techniek vereist een geautomatiseerde Vloeistofbehandeling systeem en het juiste ontwerp van de sonde set.
De combinatie van meerdere fluorescentie labeling van afzonderlijke afschriften, samen met roman super resolutie technieken zoals stochastische optische wederopbouw microscopie (STORM)11, maakt een tienvoudige toename van de resolutie in de Subcellular Localisatie van afschriften. In de STORM zorgt een geschikte combinatie van fluorescent sondes en imaging buffer voor meerdere cycli van fluorescentie emissie per sonde molecuul (knippert). STORM kan ook worden gebruikt voor image E. coli transcriptome & genoom-brede ruimtelijke organisatie van RNA, observeren door gelijktijdig alle de transcripties van belang12labeling.
Alle methoden van de eencellige herzien boven zijn gebaseerd op imaging afschriften in vaste cellen. Vandaar, zij bieden niet alle informatie met betrekking tot de kinetische eigenschappen van afschriften binnen cellen. Volg afschriften in levende cellen13en kan mRNAs worden aangeduid door de fusie van het gen van belang zijn voor een matrix van bindende sites. Deze laatste worden vervolgens herkend door een RNA-bindende eiwit, zoals de bacteriofaag MS2 jas-eiwit, dat aan een fluorescente proteïne zoals de groen fluorescente proteïne (GFP)10,14,15is gesmolten.
Hier beschrijven we een methode voor het labelen van individuele mRNAs met een set van fluorescently-geëtiketteerden DNA sondes, voor gebruik in smFISH proeven, met name in E. coli. Bovendien laten we zien dat het dezelfde labelschema mogen worden gebruikt voor STORM metingen met kleine wijzigingen.
Protocol
Representative Results
Discussion
Wij hebben gemeten in ons laboratorium het transcript aantal verschillende genen in E. coli cellen met behulp van de smFISH methode2. Kortom, deze procedure bestaat uit de volgende stappen: cel fixatie, permeabilization van membranen voor sonde penetratie, hybridisatie sonde, en proef de geschikt zijn met behulp van een standaard fluorescentie Microscoop. Deze procedure is gebaseerd op eerder gepubliceerde degenen met enkele wijzigingen6,<sup class="xref…
Disclosures
The authors have nothing to disclose.
Acknowledgements
Dit werk werd gesteund door een subsidie van Israël Science Foundation 514415 (naar J.S.) en een subsidie van de BSF-NSF (MCB) 2016707 (voor J.S.). Steun van een Siegfried en Irma Ullman Professorial stoel (J.S.) wordt ook erkend.
Materials
| Dextran sulfate sodium salt | Sigma-Aldrich | D8906 | |
| Pure Ethanol, 99.5%, ACS reagent, absolute | Mallinckrodt Baker – Avantor | 8025.25 | |
| Diethylpyrocarbonate (DEPC) | Sigma-Aldrich | D5758 | |
| RNase-free 20X SSC | Life Technologies/Ambion | AM9763 | |
| RNase-free 10X PBS | Life Technologies/Ambion | AM9625 | |
| TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) BioUltra, for molecular biology | Sigma-Aldrich | 93283 | |
| nuclease-free water | Thermo Fisher Scientific | 10977035 | |
| Formaldehyde solution for molecular biology, 36.5-38% in water | Sigma-Aldrich | F8775 | |
| Deionized formamide, nuclease free | Thermo Fisher Scientific/Ambion | AM9342 | |
| E. coli tRNA (ribonucleic acid, transfer type xx from escherichia) | Sigma-Aldrich | R1753-500UN | |
| UltraPure BSA (50mg/ml) | Thermo Fisher Scientific/Ambion | AM2616 | |
| Vanadyl-ribonucleoside complex,VRC, 200 mM | New England Biolab | S1402S | |
| Poly-L-Lysine | Sigma | P4707 | |
| Cysteamine and oxygen | Sigma-Aldrich | 30070 | |
| Glucose Oxidase from Aspergillus niger, Type VII, 50KU | Sigma-Aldrich | G2133 | |
| Catalase | Sigma-Aldrich | C40 | |
| D-glucose | Sigma-Aldrich | G8270 | |
| D-fucose | Sigma-Aldrich | F8150 | |
| Vybrant DiO Cell-Labeling Solution | Life Technologies | V2286 | |
| Agarose,low melting reagent | Sigma-Aldrich | A9414 | |
| Adhesive silicone isolator 24-2mm Dia. X 1.8 mm depth JTR24R-A2-2.0 | Grace Bio-Labs | JTR24R-A2-2.0 666208 | |
| poly-D-lysine-coated glass bottom Glass Bottom Culture Dishes | MatTek Corporation | P35GC-1.5-14-C | |
| Super life nitrile powder free examination gloves | Supermax | TC-N-9889 | |
| Brand sterilization incubator tape | Sigma-Aldrich | BR61750 | |
| Microcentrifuge tubes (1.8 ml) | Axygen – Corning Life Sciences | MCT-175C | |
| Falcon round-bottom polypropylene tubes (14 ml) | BD Biosciences | 352059 | |
| Conical-bottom centrifuge polypropylene tubes (50 ml) | Corning | 430828 | |
| Serological pipettes (Corning 5 ml) | Corning Life Sciences | 4051 | |
| Serological pipettes (Corning 10 ml) | Corning Life Sciences | 4488 | |
| Serological pipettes (Corning 25 ml) | Corning Life Sciences | 4251 | |
| Spectrophotometer cuvettes | Sarstedt | 67.742 | |
| RNase-free pipette tips 0.2 – 20 μl | FroggaBio | FT20 | |
| RNase-free pipette tips 10 – 200 μl | Axigene/corning | TF-200 | |
| RNase-free pipette tips 100 – 1000 μl | FroggaBio | FT1000 | |
| RNase-free pipette tips 100 – 1000 μl | Sorenson | 14200 | |
| Syringe disposile 10 mL needle G-21 | Becton Dickinson, Biosciences | BD-309643 | |
| Minisart 0.2 um Syringe Filter | Sartorius | 16534 K | |
| Nikon instruments microscope type A immersion oil A, 8cc | Nikon | MXA20233 | |
| Microscope slides 76 x26, 3"x1"x1mm | Thermo Fisher Scientific | 421-004ET | |
| #0 coverslip slide 24×60 | Thermo Fisher Scientific/Menzel | BNBB024060A0 | |
| Orbital shaker | M.R.C | TOU-50 | |
| Hot block | M.R.C | ||
| Vortex | Fried Electric Company | G-560-E | |
| Microcentrifuge | Eppendorf | 5427R | |
| Centrifuge | Eppendorf | 5810R | |
| Portable Pipet-Aid XP2, Pipette Controller | Drummond Scientific Company | 4-000-501-I | |
| OD600 Spectrophotometer for Bacterial Growth Rates DiluPhotometer | Midsci | OD600-10 | |
| iXon X3 EMCCD camera | Andor | DU-897E-CS0-#BV | |
| Eclipse Ti microscope | Nikon | MEA53100 | |
| CFI plan apochromat DM 100X oil objective lambda PH-3 N.A 1.45 WD 0.13 | Nikon | MRD31905 | |
| Filter set (TRITC/CY3): EX – ET545/30X; EM – ET620/60M; BS – T570LP | Nikon | 49005 | |
| Filter set (CY5): EX – ET640/30X; EM – ET690/50M; BS – T660P | Nikon | 49009 | |
| Nis-elements AR auto reaserch software | Nikon | MQS31000 | |
| STORM microscope | Vutara | SR-200 | |
| NA 1.2 water immersion objective | Olympus | ||
| SRX image acquisition and analysis software | Vutara | ||
| Evolve 512 EMCCD camera | Photometrics | ||
| Stellaris® FISH Probes, Custom Assay with CAL Fluor® Red 590 Dye | Biosearch Technologies Inc | SMF-1083-5 | |
| Probe Sequence for galK mRNA: | |||
| gtgttttttctttcagactc | |||
| tagccaaatgcgttggcaaa | |||
| ctgaatggtgtgagtggcag | |||
| caccaatcaaattcacgcgg | |||
| acgaaaccgtcgttgtagtc | |||
| tgataatcaatcgcgcaggg | |||
| gtggtgcacaactgatcacg | |||
| acgcgaactttacggtcatc | |||
| gctgattttcataatcggct | |||
| gcatcgagggaaaactcgtc | |||
| gttttcatgtgcgacaatgg | |||
| cacgccacgaacgtagttag | |||
| ttacgcagttgcagatgttt | |||
| tccagtgaagcggaagaact | |||
| tgctgcaatacggttccgac | |||
| gtccagcggcagatgataaa | |||
| tgaccgttaagcgcgatttg | |||
| agcctacaaactggttttct | |||
| gcggaaattagctgatccat | |||
| aaggcatgatctttcttgcc | |||
| cagtgagcggcaatcgatca | |||
| tgggcatggaaactgctttg | |||
| gatgatgacgacagccacac | |||
| gggtacgtttgaagttactg | |||
| gtgttgtattcgctgccaac | |||
| ggtttcgcactgttcacgac | |||
| tggctgctggaagaaacgcg | |||
| ttcaatggtgacatcacgca | |||
| catgcgcaacagcgttgaac | |||
| ggcgttttcagtcagtatat | |||
| atacgtttcaggtcgccttg | |||
| tgagactccgccatcaactc | |||
| gaaatcatcgcgcatagagg | |||
| caatttgcggcacggtgatt | |||
| ttgacgatttctaccagagt | |||
| acctttgtcgccaatcacag | |||
| ggatcagcgcgacgatacag | |||
| atattgttcagcgacagctt | |||
| gtctctttaatacctgtttt | |||
| ctccttgtgatggtttacaa | |||
| Stellaris® FISH Probes, Custom Assay with Quaser Fluor® Red 670 Dye | Biosearch Technologies Inc | SMF-1083-5 | |
| Probe Sequence for sodB mRNA: | |||
| gtgttttttctttcagactc | |||
| tagccaaatgcgttggcaaa | |||
| ctgaatggtgtgagtggcag | |||
| caccaatcaaattcacgcgg | |||
| acgaaaccgtcgttgtagtc | |||
| tgataatcaatcgcgcaggg | |||
| gtggtgcacaactgatcacg | |||
| acgcgaactttacggtcatc | |||
| gctgattttcataatcggct | |||
| gcatcgagggaaaactcgtc | |||
| gttttcatgtgcgacaatgg | |||
| cacgccacgaacgtagttag | |||
| ttacgcagttgcagatgttt | |||
| tccagtgaagcggaagaact | |||
| tgctgcaatacggttccgac | |||
| gtccagcggcagatgataaa | |||
| tgaccgttaagcgcgatttg | |||
| agcctacaaactggttttct | |||
| gcggaaattagctgatccat | |||
| aaggcatgatctttcttgcc | |||
| cagtgagcggcaatcgatca | |||
| tgggcatggaaactgctttg | |||
| gatgatgacgacagccacac | |||
| gggtacgtttgaagttactg | |||
| gtgttgtattcgctgccaac | |||
| ggtttcgcactgttcacgac | |||
| tggctgctggaagaaacgcg | |||
| ttcaatggtgacatcacgca | |||
| catgcgcaacagcgttgaac | |||
| ggcgttttcagtcagtatat | |||
| atacgtttcaggtcgccttg | |||
| tgagactccgccatcaactc | |||
| gaaatcatcgcgcatagagg | |||
| caatttgcggcacggtgatt | |||
| ttgacgatttctaccagagt | |||
| acctttgtcgccaatcacag | |||
| ggatcagcgcgacgatacag | |||
| atattgttcagcgacagctt | |||
| gtctctttaatacctgtttt | |||
| ctccttgtgatggtttacaa |
References
- Tsimring, L. S. Noise in biology. Reports Prog. Phys. 77 (2), 26601 (2014).
- Arbel-Goren, R., et al. Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli. Nucleic Acids Res. 44 (14), 6707-6720 (2016).
- Arbel-Goren, R., et al. Effects of post-transcriptional regulation on phenotypic noise in Escherichia coli. Nucleic Acids Res. 41 (9), 4825-4834 (2013).
- van Gijtenbeek, L. A., Robinson, A., van Oijen, A. M., Poolman, B., Kok, J. On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins. PLOS Genet. 12 (12), e1006523 (2016).
- Raj, A., vanden Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. Imaging individual mRNA molecules using multiple singly labeled probes. Nat. Methods. 5 (10), 877-879 (2008).
- Raj, A., Tyagi, S. Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes. Methods Enzymol. 472 (10), (2010).
- Skinner, S. O., La Sepúlveda, ., Xu, H., Golding, I. Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization. Nat. Protoc. 8 (6), 1100-1113 (2013).
- Barakat, T. S., Gribnau, J. Combined DNA-RNA fluorescent in situ hybridization (FISH) to study X chromosome inactivation in differentiated female mouse embryonic stem cells. J. Vis. Exp. (88), e51628 (2014).
- Chen, K. H., Boettiger, A. N., Moffitt, J. R., Wang, S., Zhuang, X. RNA imaging. Spatially resolved, highly multiplexed RNA profiling in single cells. Science. 348 (6233), aaa6090 (2015).
- van Gijtenbeek, L. A., Kok, J. Illuminating messengers: An update and outlook on RNA visualization in bacteria. Front. Microbiol. 8, 1-19 (2017).
- Fei, J., et al. Determination of in vivo target search kinetics of regulatory noncoding RNA. Science. 347 (6228), 1371-1374 (2015).
- Moffitt, J. R., Pandey, S., Boettiger, A. N., Wang, S., Zhuang, X. Spatial organization shapes the turnover of a bacterial transcriptome. Elife. 5, 1-22 (2016).
- Ong, W. Q., Citron, Y. R., Sekine, S., Huang, B. Live Cell Imaging of Endogenous mRNA Using RNA-Based Fluorescence “Turn-On” Probe. ACS Chem. Biol. , (2016).
- Golding, I., Paulsson, J., Zawilski, S. M., Cox, E. C. Real-time kinetics of gene activity in individual bacteria. Cell. 123 (6), 1025-1036 (2005).
- Golding, I., Cox, E. C. Chapter 8 Spatiotemporal Dynamics in Bacterial Cells: Real-Time Studies with Single-Event Resolution. Methods Cell Biol. 89 (8), (2008).
- So, L. H., Ghosh, A., Zong, C., Sepulveda, L. A., Segev, R., Golding, I. General properties of transcriptional time series in Escherichia coli. Nat. Genet. 43 (6), 554-560 (2011).
- Spahn, C., Endesfelder, U., Heilemann, M. Super-resolution imaging of Escherichia coli nucleoids reveals highly structured and asymmetric segregation during fast growth. J. Struct. Biol. 185 (3), 243-249 (2014).
- Sliusarenko, O. Microbetracker software. Mol Microbiol. 80 (3), 612-627 (2012).
- Baba, T., et al. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2, 8 (2006).
- Arbel-Goren, R., et al. Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli. Nucleic Acids Res. 44 (14), 6707-6720 (2016).
- Brandt, U. A two-state stabilization-change mechanism for proton-pumping complex I. Biochimica et Biophysica Acta (BBA) – Bioenergetics. 1807 (10), 1364-1369 (2011).
