A Quantitative Dot Blot Assay for AAV Titration and Its Use for Functional Assessment of the Adeno-associated Virus Assembly-activating Proteins

Summary

This manuscript details a straightforward dot blot assay for quantitation of adeno-associated virus (AAV) titers and its application to study the role of assembly-activating proteins (AAPs), a novel class of non-structural viral proteins found in all AAV serotypes, in promoting the assembly of capsids derived from cognate and heterologous AAV serotypes.

Abstract

While adeno-associated virus (AAV) is widely accepted as an attractive vector for gene therapy, it also serves as a model virus for understanding virus biology. In the latter respect, the recent discovery of a non-structural AAV protein, termed assembly-activating protein (AAP), has shed new light on the processes involved in assembly of the viral capsid VP proteins into a capsid. Although many AAV serotypes require AAP for assembly, we have recently reported that AAV4, 5, and 11 are exceptions to this rule. Furthermore, we demonstrated that AAPs and assembled capsids of different serotypes localize to different subcellular compartments. This unexpected heterogeneity in the biological properties and functional roles of AAPs among different AAV serotypes underscores the importance of studies on AAPs derived from diverse serotypes. This manuscript details a straightforward dot blot assay for AAV quantitation and its application to assess AAP dependency and serotype specificity in capsid assembly. To demonstrate the utility of this dot blot assay, we set out to characterize capsid assembly and AAP dependency of Snake AAV, a previously uncharacterized reptile AAV, as well as AAV5 and AAV9, which have previously been shown to be AAP-independent and AAP-dependent serotypes, respectively. The assay revealed that Snake AAV capsid assembly requires Snake AAP and cannot be promoted by AAPs from AAV5 and AAV9. The assay also showed that, unlike many of the common serotype AAPs that promote heterologous capsid assembly by cross-complementation, Snake AAP does not promote assembly of AAV9 capsids. In addition, we show that the choice of nuclease significantly affects the readout of the dot blot assay, and thus, choosing an optimal enzyme is critical for successful assessment of AAV titers.

Introduction

Adeno-associated virus (AAV) is a small, non-enveloped, single-stranded DNA virus with a genome of approximately 4.7 kilobases (kb). The AAV genome contains open-reading frames (ORFs) for the rep and cap genes. In 2010, a previously unidentified nonstructural protein encoded by a +1 frame-shifted ORF within the AAV2 cap gene was discovered by Sonntag et al. and found to play a critical role in the assembly of AAV2 capsid VP monomer proteins into a viral capsid¹. This novel protein has been named assembly-activating protein (AAP) after the role it plays in promoting capsid assembly¹.

The ORFs for AAP have been identified bioinformatically in the genomes of all parvoviruses within the genus Dependoparvovirus, but not within the genomes of viruses of different genera of the parvovirus family^1,2. Functional studies of this novel protein were initially focused on the AAP from the prototype AAV2 (AAP2), which has established the essential role of AAP2 in targeting unassembled VP proteins to the nucleolus for their accumulation and formation into fully assembled capsids^1,3,4. The inability of the AAV2 capsids to assemble in the absence of AAP expression has been independently confirmed by multiple groups, including ours^1,2,3,4,5. Subsequent studies on AAV serotypes 1, 8, and 9 corroborated the critical role of AAPs in capsid assembly, as VP3 monomer proteins of AAV1, 8, and 9 were unable to form a fully assembled capsid in the absence of co-expression of AAP².

Recently, through approaches that include the use of quantitative dot blot assays, we investigated the ability of AAV1 to 12 VP3 monomers to assemble into capsids in the absence of AAP expression and the ability of AAP1 to 12 to promote assembly of VP3 monomers from heterologous serotypes. This study has revealed that AAV4, 5, and 11 VP3 monomers can assemble without AAP. Additionally, it was found that eight out of the twelve AAP serotypes we examined (i.e., all but AAP4, 5, 11, and 12) displayed a broad ability to support capsid assembly of heterologous AAV serotype capsids, while AAP4, 5, 11 and 12 displayed a substantially limited ability in this regard⁶. These four serotypes are phylogenetically distant from the other AAP serotypes^2,3. Moreover, the study has uncovered significant heterogeneity in subcellular localizations of different AAPs⁶. Furthermore, the study has suggested that the tight association of AAP with assembled capsids and the nucleolus, the hallmark of AAV2 capsid assembly, cannot necessarily be extended to other serotypes including AAV5, 8, and 9, which display nucleolar exclusion of assembled capsids⁶. Thus, the information gained from the study of any particular serotype AAP is not broadly applicable to all AAP biology. Such puzzling nature of AAP biology underscores the need to investigate the role and function of each AAP from both canonical and non-canonical AAV serotypes.

The biological role of AAP in capsid assembly can be assessed by determining the fully-packaged AAV viral particle titers produced in human embryonic kidney (HEK) 293 cells, the most commonly used cell line for AAV vector production, with or without AAP protein expression. The standard methods for AAV quantitation are quantitative PCR (qPCR)-based assays^7,8 and quantitative dot blot-based assays⁹. Other methods for AAV viral particle quantitation such as enzyme-linked immunosorbent assay^10,11 or optical density measurement¹² are not ideal for samples derived from many different AAV serotypes or samples contaminated with impurities (crude lysates or culture media), which are often the samples used for AAV research. Currently, qPCR is most widely used for AAV quantitation; however, it is necessary to acknowledge potential caveats of the qPCR-based assay, as the assay can result in systemic errors and significant titer variations^13,14. PCR-based assays are affected by a number of potentially confounding factors, such as the presence of covalently closed terminal hairpins in PCR templates that inhibit amplification¹³. Even an experienced individual can introduce potential confounding factors into a qPCR-based assay unknowingly¹³. In contrast, quantitative dot blot assays are a classical molecular biology technique that does not involve genome amplification and uses a much simpler principle with a minimal risk of errors as compared to qPCR-based assays. The method is less technically challenging; therefore, the assay results are reasonably reproducible even by inexperienced individuals.

In this report, we describe the methodological details of a quantitative dot blot assay we routinely use for AAV vector quantitation and provide an example of how to apply the assay to study the assembly-promoting role of AAPs in common serotypes (AAV5 and AAV9) and a previously uncharacterized AAP from Snake AAV¹⁴. In nature, AAV VP proteins and AAP proteins are expressed in cis from a single gene (i.e., VP-AAP cis-complementation), while in the assay described here, VP and AAP proteins are supplied in trans from two separate plasmids (i.e., VP-AAP trans-complementation). Since each VP or AAP protein from different serotypes can be expressed from each independent plasmid, it becomes possible to test heterologous VP-AAP combinations for capsid assembly (i.e., VP-AAP cross-complementation). Briefly, AAV VP3 from various serotypes is expressed in HEK 293 cells by plasmid DNA transfection to package an AAV vector genome in the presence or absence of the cognate serotype AAP, or in the presence of a heterologous serotype AAP. Following production, culture media and cell lysates are subjected to a dot blot assay to quantify the viral genome within the capsid shell. The first step of the dot blot assay is to treat samples with a nuclease to remove contaminating plasmid DNAs and unpackaged AAV genomes in samples. Failure to do so would increase the background signals in particular when unpurified samples are assayed. This is then followed by a protease treatment to break viral capsids and release nuclease-resistant viral genomes into sample solutions. Next, viral genomes are denatured, blotted on a membrane, and hybridized with a viral genome-specific DNA probe for quantitation. In the example assay reported here, we demonstrate that Snake AAV VP3 requires Snake AAP for capsid assembly and that Snake AAP does not promote the assembly of AAV9 capsids unlike many of the AAPs derived from AAP-dependent serotypes that can also promote assembly of heterologous serotype capsids. Lastly, we report an important caveat to qPCR or dot blot-based AAV quantitation assays that the choice of nuclease significantly affects the assay results.

Protocol

NOTE: Recipes for the solutions and buffers needed for this protocol are provided in Table 1. The protocol described below is for the VP-AAP cross-complementation dot blot assay to study the roles of the AAP proteins in capsid assembly. The method for the more generic quantitative dot blot assay for purified AAV vector titration is explained in the Representative Results section.

1. Construction of VP3, AAP, and AAV2 Rep Expressing Plasmids

1. Construction of pCMV-AAVx-VP3 (x = serotypes)
   1. PCR-amplify the entire VP3 ORF (1.6 kb) using a high-fidelity DNA polymerase and the following primer pair: VP3 forward, CTAA-RE1-CACC-N₂₅ (the first 25 nucleotides of the VP3 ORF); VP3 reverse, TCTT-RE2-N₂₅ (the last 25 nucleotides of the VP3 ORF).
      NOTE: RE1 and RE2 are sites for restriction enzymes (REs) for cloning. CTAA and TCTT are the terminal 5' and 3' tetranucleotides added to facilitate restriction enzyme digestion near the end of double-stranded DNA. CACC is a Kozak consensus sequence.
   2. Clone the RE-digested PCR products between the corresponding RE sites of a mammalian expression vector that uses the human cytomegalovirus immediately-early (CMV-IE) enhancer-promoter for high-level expression.
      NOTE: For molecular cloning, digest 5 µg of the backbone plasmid DNA with a restriction enzyme(s) at a concentration of 4 U/µg DNA for 1 h at an optimal temperature. For PCR fragments, increase the units of enzymes used (e.g., 10 U/µg of the 1.6 kb VP3 ORF PCR product) and a longer incubation time (e.g., 4 h) due to an increase of the number of restriction enzyme recognition sites per unit length. Helpful information in molecular biology enzymes and cloning procedures including bacterial transformation can be found elsewhere^15,16,17.
2. Construction of pCMV-FLAG-AAPx (x = serotypes)
   1. PCR-amplify the entire AAP ORF (0.6 kb) except for the first amino acid using a high-fidelity DNA polymerase and the following primer pair: AAP forward, CTAA-RE1-CACCATGGACTACAAGGACGACGATGACAAA-N₂₅ (the 25 nucleotides from the 4th nucleotide in the AAP ORF); AAP reverse, TCTT-RE2-N₂₅ (the last 25 nucleotides of the AAP ORF).
      NOTE: GACTACAAGGACGACGATGACAAA codes a FLAG tag, which has been shown to have no detrimental effects^4,5 but can be omitted if unnecessary.
   2. Clone the RE-digested PCR products between the corresponding sites of a mammalian expression vector with the CMV-IE enhancer-promoter^15,16,17.
3. Construction of pHLP-Rep
   1. Digest 5 µg of the pAAV-RC2 plasmid (7.3 kb) with 20 units each of Xho I and Xcm I, and purify the DNA using a commercial DNA purification kit or by phenol-chloroform extraction.
      NOTE: Removal of the 1.8 kb Xho I-Xcm I fragment from the 7.3 kb pAAV-RC2 plasmid results in a loss of capsid VP protein expression while preserving the Rep protein expression.
   2. Blunt the DNA ends with 6 units of T4 DNA Polymerase, agarose gel-purify the 5.5 kb DNA fragment, and self-ligate the purified fragment using 50 to 100 ng of DNA and 400 units of T4 DNA ligase according to the manufacturer's recommendation¹⁵.
   3. Follow the standard bacterial transformation procedure referenced in step 1.1.2 Note.
4. Verify the plasmid constructs by restriction enzyme digestion and sequencing^15,18.
5. Perform plasmid minipreps or maxipreps using commercially available kits to obtain a sufficient amount of plasmid DNA for the downstream AAV production experiments.

2. Production of AAV in HEK 293 Cells by Plasmid DNA Transfection (Cross-complementation Assay)

1. Culture HEK 293 cells in Dulbecco's Modified Eagle Medium (DMEM)-high glucose (4.5 g/L) supplemented with 10% fetal bovine serum (FBS), 1% Penicillin & Streptomycin Mix, and 1 mM L-glutamine, in a 37 °C incubator with 5% carbon dioxide (CO₂).
   NOTE: AAV titers significantly vary depending on the source of HEK 293 cells.
   Caution: Although AAV can be handled at biosafety level 1 (BSL1) containment, BSL2 containment is recommended for HEK 293 cell work.
2. On Day -1 (24 h prior to transfection), plate 6–7 x 10⁵ HEK 293 cells/well in 2 mL of the complete medium described in step 2.1 in a 6-well plate(s). This generally achieves ~90% confluency the next day.
3. Day 0: Transfection
   1. Preparation for DNA transfection
      1. Make sure that cells have reached ~90% confluency.
      2. Warm up DMEM supplemented with 1% Penicillin & Streptomycin Mix and 1 mM L-glutamine but without 10% FBS (i.e., serum-free medium) in a 37 °C water bath.
      3. Allow the polyethylenimine (PEI) solution to reach room temperature.
   2. Preparation of plasmid DNA mixture
      1. Mix the plasmids in 96 µL of phosphate buffered saline (PBS) without CaCl₂ or MgCl₂ in sterile 1.5 mL microcentrifuge tubes as indicated in Table 2. The total amount of DNA is 2 µg/well.
         NOTE: The volumes for plasmid DNA solution can be disregarded if they are nominal. Volume adjustment is recommended if the total volume of the plasmid DNA solutions is ≥10 µL.
   3. PEI transfection
      1. Add 4 µL of PEI solution (1 mg/mL) to the PBS-plasmid DNA mix (prepared as above). The final volume is approximately 100 µL (5% volume of the culture medium). Vortex the tubes briefly and incubate the DNA:PEI mixture for 15 min at room temperature.
      2. While waiting for the 15 min incubation to complete, replace the culture medium with prewarmed serum-free medium described in step 2.3.1.2.
      3. Once the 15-min incubation of the DNA: PEI mixture is complete, briefly spin the tubes with a microcentrifuge to collect the liquid to the bottom of the tubes, and add the DNA:PEI mixture dropwise to the culture medium in each well of the HEK 293 culture plate. Gently agitate the plates and return them to a 37 °C incubator with 5% CO₂.
      4. Maintain the cells in this transfection medium until the harvest at Day 5 (no medium change is required).
4. On Day 1 and Day 2, observe cells transfected with pCMV-GFP plasmid under an inverted fluorescence microscope to assess transfection efficiency.
   NOTE: For fluorescence microscopy, here a 10X/0.25 numerical aperture objective in combination with a 10× eyepiece was used, and 450–490 nm excitation bandpass filter and 515–565 nm bandpass emission filter were employed. The above condition normally yields more than 70% transfection efficiency. Cells may exhibit some morphologic changes (e.g. cells have become slim) due to the serum-free condition.
5. On Days 3–5, continue to culture the transfected cells in a 37 °C incubator with 5% CO₂.
6. On Day 5, collect both cells and virus-containing medium into 15 mL polypropylene conical tubes by pipetting up and down or by scraping with a cell scraper.
7. Store the samples at -80 °C until use.

3. Dot Blot Assay for AAV Quantitation

1. Recovery of viral particles
   1. Quickly thaw the frozen tubes in a 37 °C water bath. Vortex the tubes vigorously for 1 min to maximize the recovery of AAV from cells.
   2. Pellet the cell debris by centrifuging at 3,700 x g at 4 °C for 10 min. Take 200 µL of the supernatant from each tube and transfer it into a labeled microcentrifuge tube with a screw cap for the dot blot assay.
      NOTE: Aliquot the remaining supernatant into microcentrifuge tubes and store them frozen at -80 °C for future use. Here, polypropylene microcentrifuge tubes attached with screw caps and an O-ring were used. Tight sealing is required to prevent spills of AAV and phenol-chloroform.
2. Treatment with Serratia marcescens endonuclease
   1. Prepare Mix A and Mix B reagents (Table 3). Add 10 µL of Mix A and 10 µL of Mix B into each tube. Vortex the tubes for 5 s, briefly spin the tubes to collect the liquid to the bottom of the tubes and incubate the tubes at 37 °C at least for 1 h.
      NOTE: Mix A contains NaOH and optimizes pH for treatment with S. marcescens endonuclease. Mix B supplements magnesium. Concentration of S. marcescens endonuclease in commercially available enzyme stocks may vary. The volume of S. marcescens endonuclease needs to be adjusted accordingly to make 200 U/mL after adding Mix A and Mix B into tubes in step 3.2.1.
      NOTE: A longer incubation time, up to 4 h, can decrease background signals.
   2. At the end of the incubation, briefly spin the tubes with a benchtop centrifuge to collect condensation and solution from the top and sides of the tubes.
      NOTE: The protocol can be paused here. The samples can be stored frozen at -20 °C or -80 °C.
3. Proteinase K treatment
   1. Prepare the Mix C reagent (Table 3). Add 180 µL of Mix C into each tube. Vortex the tubes for 5 s, briefly spin the tubes and incubate the tubes at 55 °C for 1 h.
      NOTE: The EDTA in the Mix C reagent chelates free magnesium ions and inactivates S. marcescens endonuclease.
   2. At the end of the incubation, allow samples to reach room temperature, and briefly spin the tubes with a benchtop centrifuge to collect condensation and solution from the top and sides of the tubes.
      NOTE: The protocol can be paused here. The samples can be stored frozen at -20 °C or -80 °C. To resume the protocol, incubate the tubes at 55 °C for 5 to 10 min to dissolve SDS crystals contained in the buffer completely.
4. Phenol-chloroform extraction and ethanol precipitation
   1. Add 200 µL of phenol-chloroform to the samples and vortex them for 1 min. Spin the samples in a microcentrifuge at ≥16,100 x g for ≥5 min at room temperature.
      CAUTION: Phenol-chloroform should be handled in a chemical fume hood with appropriate personal protective equipment (PPE; i.e., nitrile gloves, goggles or face shield, and lab coat with long sleeves).
   2. Transfer 320 µL of the aqueous layer (160 µL twice with a P200 pipette) to a new standard microcentrifuge tube (80% of aqueous fluid volume).
      NOTE: It is vitally important to take the same volume of aqueous solution between samples, otherwise the assay loses quantitative accuracy.
   3. Prepare the Mix D reagent (Table 3). Add 833 µL of Mix D into each tube. Vortex the tubes for 5 s, and incubate the tubes at -80 °C for ≥20 min.
      NOTE: Mix D is a mixture of ethanol, sodium acetate, and glycogen for convenient ethanol precipitation of DNA. Samples can be stored at -80 °C at this step and the protocol can be resumed later.
   4. Centrifuge samples with a microcentrifuge at ≥16,100 x g at 4 °C for ≥15 min. Pour off supernatant and blot once on a clean paper towel. Put approximately 500 µL of 70% ethanol into each tube, vortex the tubes for 5 s, and centrifuge the tubes with a benchtop microcentrifuge at ≥16,100 x g at 4 °C for ≥5 min.
   5. Pour off the supernatant and blot once on a clean paper towel. Dry pellets at 65 °C; pellets can be dried completely.
      NOTE: Do not use a pipette to remove excess ethanol that remains after blotting the tubes. Pellets can also be dried at room temperature overnight. The protocol can be paused here and dried DNA pellets can be stored at room temperature for several days with the tube lid closed.
5. Resuspension of viral DNA in TE buffer
   1. Dissolve the DNA pellets in 120 µL each of TE buffer by shaking each tube for 30 min to 1 h at room temperature.
6. Dot blot
   1. Preparation of plasmid DNA standards
      1. Dilute AAV vector genome plasmid DNA to 10 ng/µL in water or Tris-HCl buffer (10 mM, pH 8.0). Take 25 µL of this dilution and digest with an appropriate restriction enzyme for 1 h to linearize the plasmid DNA, in a reaction volume of 50 µL.
         NOTE: We make a duplicated set of digestion (see step 3.6.4.1). The appropriate enzyme should be one that cuts the plasmid DNA outside the dot blot probe-binding region. For convenience, the diluted plasmid DNA can be aliquoted (25 µL/tube) and stored frozen at -20 °C for future use. Digest the plasmid DNA while the tubes are shaking in step 3.5.1. Do not over-digest the plasmid DNA standard.
      2. Add 450 µL of water or TE to the tube containing the digested plasmid DNA standard and mix thoroughly. Transfer 70 µL of this mixture to a new 1.5 mL microcentrifuge tube with 1,330 µL of water or TE to make a diluted plasmid standard (25 pg/µL).
      3. Follow Table 4 to create a set of two-fold serial dilutions (600 µL/tube). Mix the dilutions thoroughly by vortexing for 5 s.
   2. Denaturing of standards and viral DNA samples
      1. Add 600 µL of 2x Alkaline Solution to each standard dilution. Mix well by vortexing for 5 to 10 s. Incubate at room temperature for 10 min.
      2. Add 120 µL of 2x Alkaline Solution to each viral DNA sample. Mix well by vortexing for 5 to 10 s. Incubate at room temperature for 10 min.
   3. Setting up the dot blot apparatus
      1. Using scissors, cut a blotting (e.g., zeta-probe) membrane to an appropriate size for the number of samples and standards. Soak the membrane with water for 10 min before placing it on a dot blot apparatus. Cover unused wells on the membrane apparatus.
         NOTE: Handle the membrane with clean tweezers. To cover empty wells, the light blue protection sheet that comes with the membrane can be used. Do not allow the membrane to dry prior to binding samples and standards. For more details on the assembly and use of the apparatus, please refer to the user manual¹⁹.
      2. Add water to the wells to which samples will be loaded. Apply vacuum and pull water through the wells to check for errors and retest when fixed. Re-tighten the screws while applying vacuum to ensure tight sealing.
         NOTE: Incomplete sealing may cause sample leakage between the wells.
      3. Once water is completely pulled through, release the vacuum completely (i.e., the vacuum manifold should be open to air pressure).
   4. Loading standards and samples to the dot blot apparatus
      1. Apply 400 µL of each diluted plasmid DNA standard to each well, and run four lanes of standard dilutions. Use two separate aliquots of the standard digest and load each in duplicate. Apply 200 µL/well of each viral DNA sample.
         NOTE: Using the remaining ~40 µL of denatured samples, diluted samples can be prepared (e.g., 10-fold diluted samples using 20 µL of sample plus 180 µL of 1x Alkaline Solution) and blotted if necessary.
      2. Apply gentle vacuum to pull the DNA solutions through the well.
         NOTE: Vacuum pressure needs to be adjusted by partially opening a three-way valve so that the vacuum pressure is applied to the dot blot apparatus as well as the atmosphere (i.e., with the stopcock arms positioned at an approximately 45° angle where it makes a louder suction noise).
      3. Once all the wells have emptied, release the vacuum by adjusting the three-way valve. Add 400 µL of 1x Alkaline Solution to each well that contained standards and samples. Wait for 5 min before re-applying vacuum to empty the wells.
      4. Re-apply the vacuum in the same way (see step 3.6.4.2).
      5. Disassemble the dot blot apparatus under vacuum, remove the membrane, and rinse it with 2x SSC. Place the membrane on a clean paper towel with the DNA-bound side facing up to remove excess 2x SSC.
      6. UV-crosslink the blotted DNA to the membrane with an appropriate UV crosslinker; the membrane is now ready for hybridization.
         NOTE: Wet membranes can be used for UV crosslinking. The dried, UV-crosslinked membranes can be stored at room temperature. Further information can be found in the Table of Materials.
7. Hybridization and washing
   1. Warm up the Hybridization Buffer in a 65 °C water bath.
   2. Enzymatically label a DNA probe with radioactive α-³²P dCTP and purify it using commercially available kits according to the manufacturer's recommendation.
      NOTE: We use a probe of 0.5–2.0 kb in length from an enhancer-promoter region or a protein-coding sequence in the viral genome. Although this protocol utilizes ³²P-labeled radioactive probes for signal detection, non-radioactive chemiluminescent or fluorescent probes can also be used (please refer to the Discussion section).
   3. Place the membrane in a hybridization bottle with the DNA-bound side up, rinse the membrane with 5 mL prewarmed Hybridization Buffer, and discard the buffer. Then add 10 mL of prewarmed Hybridization Buffer and place the bottle in a rotating hybridization oven set at 65 °C. Rotate for ≥5 min.
   4. Heat-denature 20 µL of 10 mg/mL sheared herring or salmon sperm DNA solution and the ³²P-labeled probe (≥10⁷ cpm) for 5 min by placing the tubes on a heat block set at 100 °C. Then snap-chill them on ice for ≥2 min, spin briefly, and keep on ice until use.
      Caution: For radioactive DNA probes, 1.5 mL tubes with screw cap and O-ring must be used.
   5. Quickly add the denatured sperm DNA and radioactive probe to the Hybridization Buffer in the hybridization bottle and shake the bottle for 10 s to mix. Return the bottle to the 65 °C oven and incubate the bottle with rotation at 65 °C for ≥4 h.
   6. Once hybridization is complete, stop the rotation, remove the hybridization bottle, and then pour the radioactive probe solution into a 50 mL conical tube with a leak-proof plug seal cap. Store the probe in an appropriate container placed in a refrigerator designated for radioactive materials.
      NOTE: Used Hybridization Buffer with a probe that is stored at 4 °C can be re-used at least 5 times by placing the 50 mL conical tube with a leak-proof plug seal cap that contains Hybridization Buffer in a 100 °C water bath for 5 min.
   7. Wash the membrane with Wash Buffer heated to 65 °C. Add 20 to 30 mL of Wash Buffer to the hybridization bottle and rotate for 5 min. Repeat this wash 2 more times.
      NOTE: Measure radioactivity of wash solutions and record it if required by the local institute.
   8. While washing the membrane, place a phosphor imaging screen on an image eraser for 5 min.
   9. After the third wash, remove the membrane from the hybridization bottle, remove excess buffer on the membrane with paper towels, and place the membrane in a clear plastic paper holder. Check radioactive signals on the membrane using a Geiger counter. Expose the erased phosphor imaging screen to the membrane for 10 min to overnight depending on the signal intensity.
   10. Scan the screen using a phosphor image scanning system and obtain the data on signal intensity of each dot.
8. Data analysis
   1. Draw a standard curve using spreadsheet and data analysis software (e.g., Excel).
      NOTE: Log-log linear regression was used to draw a standard curve.
   2. Determine nanogram-equivalent (ng-eq) for each of the viral DNA samples by interpolation. The ng-eq is the amount of the plasmid DNA used to draw a standard curve that is equivalent to the number of viral DNA molecules. When the length of the plasmid DNA is 8,000 bp, 1 ng-eq of single-stranded AAV viral DNA corresponds to 2.275 x 10⁸ particles.
      NOTE: The ng-eq can be converted to the number of viral particles by the following equations:
      
      
      The number of AAV particles are conventionally expressed as "vg" (vector genomes) or "DRP" (DNase I-resistant particles).
   3. Calculate the AAV concentrations of the starting materials. Because the blotted viral DNA represents 66.7% of the viral DNA in the starting materials, 1 ng-eq corresponds to 1.7 x 10⁹ particles/mL .
      NOTE: This correction is not needed if all the viral DNA contained in the starting material is blotted on a membrane without loss (see Figure 1).

Results

A representative result of quantitative dot blots for quantitation of purified AAV vector stocks produced on a large scale is shown in Figure 1. With this dot blot assay, the titer of a double-stranded AAV2G9-CMV-GFP vector stock was determined. The vector was purified by two rounds of cesium chloride (CsCl) density-gradient ultracentrifugation followed by dialysis as previously described²⁰. In general, for purified AAV vector stocks, ...

Discussion

In this report, the utility of quantitative dot blot assays to study AAV AAPs and their role in capsid assembly is described. Knowledge gained from these studies can provide detailed insights into the innate differences in the process of AAV capsid assembly and the functional role of AAPs between different serotypes. In this respect, the AAV VP3-AAP cross-complementation dot blot assay revealed that Snake AAV VP3 displayed a strict dependency on the co-expression of its cognate AAP for capsid assembly and that Snake AAP ...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Benzonase	MilliporeSigma	1016970001	Referred to as Serratia marcescen endonuclease in the main text.
DNase I	Roche	4716728001	Referred to as DNase I Enzyme A in the main text.
DNase I	Invitrogen	18047019	Referred to as DNase I Enzyme B in the main text.
DNase I	New England Biolabs	M0303L	Referred to as DNase I Enzyme C in the main text.
1.5 mL Attached O-Ring Screw Cap Microcentrifuge Tubes	Corning	430909
1.5 mL Microcentrifuge Tubes	Thermo Fisher Scientific	05-408-129
15 mL Polypropylene Conical Tube	Corning	352097
3 M Sodium Acetate	Teknova	S0298
50 mL Polypropylene Conical Tube	Corning	430291
AAV-293 Cells	Agilent	240073	HEK-293 cell line optimized for the packaging of AAV virions.
AccuGENE 0.5 M EDTA Solution	Lonza	51234
AccuGENE 1 M Tris-HCl pH 8.0	Lonza	51238
AccuGENE 10% SDS	Lonza	51213
AccuGENE 1X TE Buffer	Lonza	51235
Bio-Dot Apparatus	Bio-Rad	1706545
Bovine Serum Albumin	MilliporeSigma	A3294
Cell Lifter	Corning	3008
Chloroform	MilliporeSigma	372978
DNA Extractor Kit	Wako Pure Chemical Industries	295-50201	This is used for quantitative dot blots on purified virus. We use only a half volume of all the reagents in each step recommended for the Protocol Scheme 2 in the manual provided by the manufacturer.
Dulbecco’s Modified Eagle Medium (DMEM)-high glucose (4.5 g/L)	Lonza	12-614F
ElectroMAX DH10B Cells	Thermo Fisher Scientific	18290015
Ethanol 200 Proof	Decon Labs	2716
Fetal Bovine Serum	VWR	1500-500
Ficoll 400	Alfa Aesar	B22095	Referred to as Polysucrose 400.
Fluorescence Microscope	Zeiss	Axiovert 40 CFL
Glycogen	Roche	10901393001
Herring Sperm DNA	Invitrogen	15634-017
Hybridization Tubes	Thermo Fisher Scientific	13-247-150
ImageQuant TL	GE Healthcare Life Sciences	ImageQuant TL
L-glutamine 200 mM	Lonza	17-605E
Magnesium Chloride Hexahydrate	MilliporeSigma	M0250
MicroPulser Electroporator	Bio-Rad	1652100
Mini Quick Spin DNA Columns	MilliporeSigma	11814419001
pAAV-RC2 Vector	Cell Biolabs Inc	VPK-422
Penicillin/Streptomycin 10K/10K	Lonza	17-602E
Phosphate Buffered Saline	Lonza	17-516F
Phosphorimaging Exposure Cassette	GE Healthcare Life Sciences	Various
Phosphorimaging Screen	GE Healthcare Life Sciences	Various
Plasmid Maxi Kit	QIAGEN	12162
Platinum Pfx DNA Polymerase	Invitrogen	11708013
Polyethylenimine	Polysciences Inc	23966-2
Polyvinylpyrrolidone	MilliporeSigma	P5288
Prime-It II Random Primer Labeling Kit	Agilent Technologies	300385
Primer AAP Forward (N25 nucleotides from the 4th nucleotide in the AAP ORF, RE1 is a restriction enzyme site for cloning): CTAA-RE1-CACCATGGACTACAAGGA CGACGATGACAAA-N25	MilliporeSigma	Custom Primer
Primer AAP Reverse (N25 is the last 25 nucleotides of the AAP ORF, RE2 is a restriction enzyme site for cloning): TCTT-RE2-N25	MilliporeSigma	Custom Primer
Primer VP3 Forward (N25 the first 25 nucleotides of the VP3 ORF, RE1 is a restriction enzyme site for cloning): CTAA-RE1-CACC-N25	MilliporeSigma	Custom Primer
Primer VP3 Reverse (N25 is the last 25 nucleotides of the AAP ORF, RE2 is a restriction enzyme site for cloning): TCTT-RE2-N25	MilliporeSigma	Custom Primer
Proteinase K Solution	Invitrogen	25530-049
Restriction Enzymes	New England Biolabs	Various
Salmon Sperm DNA	Invitrogen	15632011
Serological Pipettes	Thermo Fisher Scientific	13-678-11D / 13-678-11E / 13-678-11
Sodium Chloride	Thermo Fisher Scientific	S271-10
Sodium Citrate Tribasic Dihydrate	MilliporeSigma	C8532
T4 DNA Polymerase	New England Biolabs	M0203L
Thermal Cycler	Eppendorf	6321000515
Tissue-culture Treated 6-well Plate	Corning	353046
Tris Base	Thermo Fisher Scientific	BP152-5
Typhoon FLA 7000	GE Healthcare Life Sciences	28955809
UltraPure Buffer-Saturated Phenol	Invitrogen	15513-047
UV Crosslinker	Spectroline	XLE-1000	Optimal Crosslink mode is used, providing a UV energy dosage of 120 mJ/cm2.
Zeta-Probe Membrane	Bio-Rad	162-0165