Identification of Host Pathways Targeted by Bacterial Effector Proteins using Yeast Toxicity and Suppressor Screens

Summary

Bacterial pathogens secrete proteins into the host that target crucial biological processes. Identifying the host pathways targeted by bacterial effector proteins is key to addressing molecular pathogenesis. Here, a method using a modified yeast suppressor and toxicity screen to elucidate host pathways targeted by toxic bacterial effector proteins is described.

Abstract

Intracellular bacteria secrete virulence factors called effector proteins into the host cytosol that act to subvert host proteins and/or their associated biological pathways to the benefit of the bacterium. Identification of putative bacterial effector proteins has become more manageable due to advances in bacterial genome sequencing and the advent of algorithms that allow in silico identification of genes encoding secretion candidates and/or eukaryotic-like domains. However, identification of these important virulence factors is only an initial step. Naturally, the goal is to determine the molecular function of effector proteins and elucidate how they interact with the host. In recent years, techniques like the yeast two-hybrid screen and large-scale immunoprecipitations coupled with mass spectrometry have aided in the identification of protein-protein interactions. Although identification of a host binding partner is the crucial first step toward elucidating the molecular function of a bacterial effector protein, sometimes the host protein is found to have multiple biological functions (e.g., actin, clathrin, tubulin), or the bacterial protein may not physically bind host proteins, depriving the researcher of crucial information about the precise host pathway being manipulated. A modified yeast toxicity screen coupled with a suppressor screen has been adapted to identify host pathways impacted by bacterial effector proteins. The toxicity screen relies on a toxic effect in yeast caused by the effector protein interfering with the host biological pathways, which often manifests as a growth defect. Expression of a yeast genomic library is used to identify host factors that suppress the toxicity of the bacterial effector protein and thus identify proteins in the pathway that the effector protein targets. This protocol contains detailed instructions for both the toxicity and suppressor screens. These techniques can be performed in any lab capable of molecular cloning and cultivation of yeast and Escherichia coli.

Introduction

The first report of procedures similar to those presented here characterized the Legionella pneumophila type IV effector SidD, a deAMPylase that modifies Rab1¹. Comparable techniques were used for the characterization of several L. pneumophila effectors^1,2,3. The assay was adapted to characterize a Coxiella burnetii type IV effector protein⁴, and recently the utility of this technique was expanded for the characterization of Chlamydia trachomatis inclusion membrane proteins⁵.

This protocol can be broken into two major parts: 1) the yeast toxicity screen, in which the bacterial effector protein of interest is expressed in yeast and clones are screened for a toxic phenotype as evidenced by a growth defect, and 2) the yeast suppressor screen, in which the toxic phenotype is suppressed by expression of a yeast genomic library in the toxic strain. Thus, the toxicity screen is a screen for toxic phenotypes that manifest as growth defects when the bacterial effector of interest is overexpressed. Toxic clones, successfully transformed with and expressing the bacterial effector, are selected and saved for the next step. The second major step involves overexpressing a partially digested yeast genomic library in the toxic yeast clone. Plasmids making up the yeast genomic library suggested for the use in this protocol carry 5−20 kb inserts, usually corresponding to 3−13 yeast open reading frames (ORF) of an average gene size of ~1.5 kb across all plasmids, representing the whole yeast genome covered approximately 10x. This part of the assay is called the suppressor screen, as the goal is to suppress the toxicity of the bacterial effector protein. Potential suppressor plasmids are isolated from yeast, sequenced, and the suppressing ORFs identified. The rationale underlying the suppressor screen is that the effector protein binds, interacts with, and/or overwhelms components of the host pathway it targets, and that providing those host proteins back in excess can rescue the toxic effect on the pathway and thus, the growth defect. Thus, identified ORFs that suppress toxicity often represent multiple participants of a host pathway. Orthogonal experiments are then performed to verify that the bacterial effector indeed interacts with the implicated pathway. This is especially necessary if a binding partner such as clathrin or actin has been identified, because these proteins are involved in a multitude of host processes. Further experiments can then elucidate the physiological function of the effector protein during infection. The toxicity and suppressor screens are also powerful tools for deciphering the physiological function of bacterial effector proteins that do not physically bind host proteins with affinities sufficient to detect by immunoprecipitation or that interact with the host in enzymatic hit-and-run interactions that may not be detected by a yeast-two hybrid screen.

Although the suppressor screen can be a powerful method to reveal potential physiological interactions between bacterial effector proteins and host pathways, the bacterial effector protein must induce a growth defect in yeast, otherwise using it in the suppressor screen will be of little use. Furthermore, the toxic phenotype must result in at least a 2−3 log₁₀ deficit in growth or it will be difficult to identify suppressors. If a laboratory is set up for cell culture, screening effector proteins for toxicity in common cell lines such as HeLa can often give insight as to whether it is worth the effort to proceed with the yeast toxicity screen. Ectopic expression of the effector protein in HeLa cells sometimes results in toxicity that correlates very strongly with toxicity in the yeast strain used for these screens⁴. Observable hallmarks of stress in HeLa cells include loss of stress fibers, cell detachment from the plate, and nuclear condensation indicating apoptosis. Any visual indication of stress in HeLa cells make the protein of interest a good candidate for inducing a growth defect in yeast, which replicate much more rapidly and are thus more responsive to perturbation of essential pathways.

It should be noted that the suppressor screen does not always identify host binding partners as suppressors, but it can still implicate critical components of the host pathway(s) targeted, yielding a holistic view of the biological processes being hijacked by the bacterial effector protein. On the surface, this seems counterintuitive, because providing the binding partner of the effector protein in excess would be expected to rescue the growth defect. In efforts to identify pathways targeted by the C. trachomatis effector protein CT229 (CpoS), which binds to at least 10 different Rab GTPases during infection⁵, none of the Rab binding partners suppressed the toxicity of CT229. However, numerous suppressors involved in clathrin-coated vesicle (CCV) trafficking were identified, which led to further work demonstrating that CT229 specifically subverts Rab-dependent CCV trafficking. Similarly, when investigating the C. burnetii effector protein Cbu0041 (CirA) several Rho GTPases that rescued the yeast growth defect were identified, and it was later found that CirA functions as a GTPase activating protein (GAP) for RhoA⁴.

The usefulness of the yeast suppressor screen for elucidating host pathways targeted by bacterial effector proteins cannot be overstated, and other researchers attempting to characterize intracellular bacterial effector proteins can greatly benefit from these techniques. These assays are of value if immunoprecipitations and/or yeast-two hybrid screens have failed to find a binding partner and can elucidate which pathways are targeted by the bacterial effector protein. Here, detailed protocols for the toxicity and suppressor screens to identify host biological pathways targeted by intracellular bacterial effector proteins are provided, as well as some of the common obstacles experienced when using these assays and their corresponding solutions.

Protocol

1. Preparation of media and reagents

NOTE: Plates should be prepared before the day of the assay and are good for 1 month. Media and reagents can be made at any point and are good for 1 month.

1. Prepare 1 L of the glucose solution (10% w/v) by dissolving 100 g of D-(+)-glucose in 800 mL of distilled water in a 1, 000 mL beaker. Adjust the volume to 1 L with distilled water. Filter through a 0.2 µm sterile filter into a sterile 1 L media storage bottle.
2. Prepare 1 L of the galactose solution (10% w/v) by dissolving 100 g of D-(+)- galactose in 800 mL of distilled water in a 1 L beaker. Adjust the volume to 1 mL using distilled water and filter through a 0.2 µm sterile filter into a sterile 1,000 mL media storage bottle.
3. Prepare 1 L of yeast extract peptone dextrose (YPD) agar by dissolving 10 g of yeast extract, 20 g of peptone, 20 g of glucose, and 20 g of agar in 1,000 mL of distilled water. Autoclave for 20 min and cool in 56 ˚C water bath until cooled. Pour into 100 mm plates using ~20 mL of media per plate.
4. Prepare 1 L of YPD broth by dissolving 10 g of yeast extract, 20 g of peptone, and 20 g of glucose in 1,000 mL of distilled water. Autoclave for 20 min.
5. Prepare the synthetic dropout (SD) uracil (Ura^-) glucose agar. For 1 L, dissolve 6.7 g of yeast nitrogen base without amino acids, 1.9 g of dropout supplement without uracil, and 15 g of agar in 800 mL of distilled water. Autoclave for 20 min and cool in a 56 ˚C water bath until the temperature is ~50−60 ˚C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 mL of the glucose solution prepared in step 1.1. Mix well by gently swirling or place on stir plate. Pour into 100 mm plates using ~20 mL of media per plate.
6. Prepare the synthetic dropout (SD) uracil (Ura^-) galactose agar. For 1 L, dissolve 6.7 g of yeast nitrogen base without amino acids, 1.9 g of dropout supplement without uracil, and 15 g of agar in 800 mL of distilled water. Autoclave for 20 min and cool in a 56 ˚C water bath until the temperature is ~50−60 ˚C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 mL of the galactose solution prepared in step 1.2. Mix well by gently swirling or place on the stir plate. Pour into 100 mm plates using ~20 mL of media per plate.
7. Prepare the synthetic dropout (SD) uracil (Ura^-) glucose broth. For 1 L, dissolve 6.7 g of yeast nitrogen base without amino acids and 1.9 g of dropout supplement without uracil in 800 mL of distilled water. Autoclave for 20 min and cool in a 56 ˚C water bath until the temperature is ~50−60 ˚C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 ml of the glucose solution prepared in step 1.1.
8. Prepare the synthetic dropout (SD) uracil (Ura^-) leucine (Leu^-) glucose agar. For 1 L, dissolve 6.7 g of the yeast nitrogen base without amino acids; 1.9 g of dropout supplement without uracil, leucine, and tryptophan; 15 g of agar; and 0.076 g of tryptophan in 800 mL of distilled water. Autoclave for 20 min and cool in a 56 ˚C water bath until the temperature is ~50−60 ˚C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 mL of the glucose solution prepared in step 1.1. Pour into 100 mm plates using ~20 mL of media per plate.
9. Prepare synthetic dropout (SD) uracil (Ura^-) leucine (Leu^-) galactose agar. For 1 L, dissolve 6.7 g of yeast nitrogen base without amino acids; 1.9 g of dropout supplement without uracil, leucine, and tryptophan; 15 g of agar; and 0.076 g of tryptophan in 800 mL of distilled water. Autoclave for 20 min and cool in a 56 ˚C water bath until the temperature is ~50−60 ˚C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 mL of the galactose solution prepared in step 1.2. Mix well by gently swirling or placing on a stir plate. Pour into 100 mm plates using ~20 mL of media per plate.
10. Prepare synthetic dropout (SD) uracil (Ura^-) leucine (Leu^-) glucose broth. For 1 L, dissolve 6.7 g of yeast nitrogen base without amino acids; 1.9 g of dropout supplement without uracil, leucine, tryptophan; and 0.076 g of tryptophan in 800 mL of distilled water. Autoclave for 20 min and cool in a 56−60 ˚C water bath until the temperature is ~50 ˚C. Using a 50 mL serological pipette or a sterile graduated cylinder, add 200 mL of the glucose solution prepared in step 1.1.
11. Prepare polyethylene glycol (PEG) solution. Add 50% w/v of polyethylene glycol 3350 in distilled water. Sterilize by autoclaving.
12. Prepare 1 M lithium acetate (LiAc) by dissolving 10.2 g of lithium acetate dehydrate in 200 mL of distilled water. Sterilize by autoclaving.
13. Prepare herring sperm DNA. Dilute 10 mg/mL herring sperm DNA to 2 mg/mL using distilled water. Heat at 100 ˚C for 5 min and immediately place on ice for 5 min.

2. Cloning the gene of interest into the yeast toxicity plasmid pYesNTA-Kan

NOTE: Currently, there are a variety yeast toxicity vectors available both commercially and academically. The yeast suppressor screen can be used in conjunction with many of these vectors provided the plasmid expressing the effector protein of interest uses a dropout selection other than uracil and an antibiotic marker other than Bla^R. This work used a modified pYesNTA vector^4,5 that includes a kanamycin resistance cassette for easier screening for potential suppressors. The cloning scheme must allow for the effector protein to be in-frame with the Gal promoter and His-Tag. The Chlamydia trachomatis inclusion membrane protein CT229 was used as a proof of principle for these assays.

1. Use PCR to amplify CT229 from C. trachomatis genomic DNA following the manufacturer's instructions using CT229 +1 Kpn F (CCGGTACCAATGAGCTGTTCTAATGTTAATTCAGGT) and CT229 XhoI R (CCCTCGAGTTTTTTACGACGGGATGCC) primers. Use the following PCR conditions: (1) 98 °C for 30 s; (2) 98 °C for 10 s, 55 °C for 30 s, 72 °C for 2 min; (3) repeat step 2 for a total of 25x; (4) 72 °C for 10 min; and (5) 4 °C hold.
2. Analyze 5 µL of the PCR product on a 1% agarose gel (Figure 1).
3. Purify the remaining 45 µL of DNA using a PCR purification kit following the manufacturer's instructions.
4. Digest the 50 µL of purified PCR insert and pYesNTA-Kan (Figure 2) for 1 h at 37 °C in a water bath using KpnI-HF and XhoI-HF.
   NOTE: For pYesNTA-Kan, digest 5 µg of plasmid using 5 µL of KpnI-HF, 5 µl of XhoI-HF, and 6 µL of buffer in a total volume of 60 µL. For the insert, digest the entire 50 µL of purified PCR product using 2 µL of KpnI-HF, 2 µL of XhoI-HF, and 6 µL of buffer.
5. Run the entire plasmid digest on a 1% agarose gel. Perform purification of the digested plasmid using a gel extraction kit following the manufacturer's instructions.
6. Purify the digested PCR insert using a PCR purification kit following the manufacturer's instructions.
7. Clone the insert into pYesNTA-Kan using 2 µL of pYesNTA-Kan (step 2.5), 2 µL of DNA ligase buffer, 1 µL of T4 ligase, and 15 µL of insert (step 2.6). Incubate at room temperature for 1 h.
8. Add the entire cloning reaction to 50 µL of E. coli competent cells and perform the transformation reaction.
9. Plate the entire transformation reaction on an LB plate containing 100 µg/mL of carbenicillin.
10. Inoculate 10 mL of the LB containing 100 µg/mL of carbenicillin with three individual colonies. Incubate overnight at 37 ˚C with shaking at 150 rpm.
11. Isolate the plasmid using a plasmid miniprep kit following the manufacturer's instructions.
12. Sequence the isolated plasmids using gene-specific primers (step 2.1).

3. Test the protein of interest for toxicity in yeast

1. Streak Saccharomyces cerevisiae W303 on YPD agar (step 1.3) to obtain isolated colonies. Incubate at 30 °C for 24 h.
2. Inoculate 10 mL of YPD broth (step 1.4) with a single colony from the agar plate (step 3.1). Incubate at 30 °C with shaking at 150 rpm overnight.
3. Add 0.5 mL of the overnight culture to 10 mL of YPD broth (step 1.4) and incubate at 30 °C with shaking at 150 rpm for 4 h.
   1. Pellet the 10 mL of culture at 3,000 x g for 10 min at 4 °C.
   2. Resuspend the pellet in 1 mL of sterile water, transfer to the microcentrifuge tube, and pellet at 3,000 x g for 1 min at room temperature.
   3. Resuspend the pellet in 1 mL of 1 mM lithium acetate (LiAc) and pellet at 3,000 x g for 1 min at room temperature.
   4. Repeat the LiAc wash 2x.
   5. Remove the wash. Resuspend the pellet in 2.4 mL of 50% PEG 3350. Add 360 µL of 1M LiAc, 500 µL of 2 mg/mL of herring sperm DNA, and 400 µL of sterile water.
      NOTE: This is sufficient for 20 transformations.
   6. Add 180 µL of the transformation mix from step 3.3.5 to a microcentrifuge tube containing 5 µL of pYesNTA-Kan CT229 plasmid DNA (100−500 ng) from step 2.12.
   7. Incubate in a water bath at 30 °C for 30 min.
   8. Incubate in a water bath at 42 °C for 30 min.
   9. Pellet at 3,000 x g for 1 min at room temperature.
   10. Remove the transformation mix with the pipette. Resuspend the pellet in 100 µL of sterile water. Plate the transformation on SD Ura^- agar with glucose (step 1.5).
   11. Incubate plates at 30 ˚C for 48 h.
4. Inoculate 5 mL of SD Ura^- broth containing glucose (step 1.7) with a single colony from the plate. Incubate overnight at 30 °C with shaking at 150 rpm. Include yeast transformed with the vector alone as a negative control.
   1. Add 180 µL of sterile water to 5 wells of a 96 well plate (A2−A6).
   2. Vortex the overnight culture to mix.
   3. Add 180 µL of yeast to the first well (A1). Serially dilute 1:10 (six samples in total including undiluted).
   4. Using a multichannel pipette, spot 5 µL of each dilution on SD Ura^- glucose (step 1.5) and Ura^- galactose (step 1.6) agar plates. Incubate at 30 °C for 48 h.
5. Assess the toxicity by comparing the growth of the yeast expressing the effector protein of interest grown on the galactose-containing media to the growth of yeast expressing the vector alone.
6. Confirm the expression of the His-tag fusion protein by Western blotting.

4. Transform toxic yeast with the yeast genomic library

1. Inoculate 100 mL of SD Ura^- glucose broth (step 1.7) using 1 mL of the stock from step 3.4. Incubate for 16−24 h at 30 °C with shaking at 150 rpm. Place 900 mL of SD Ura^- glucose broth at 30 °C overnight to prewarm the media.
2. Add the entire 100 mL of the overnight culture to the prewarmed 1 L flask. Incubate for 4−5 h at 30 °C with shaking at 150 rpm.
   1. Pellet the culture at 6,000 x g for 10 min at 4 °C.
   2. Discard the supernatant. Resuspend the pellet in 250 mL of sterile water. Pellet the culture at 6,000 x g for 5 min at 4 °C.
   3. Discard the supernatant. Resuspend the pellet in 250 mL of 1 mM LiAc. Pellet the culture at 6,000 x g for 5 min at 4 °C.
   4. Remove LiAc and resuspend the pellet in 9.6 mL of 50% PEG 3350. Add 1.44 mL of 1M LiAc, 2 mL of 2 mg/mL herring sperm DNA, 50 µg of the pYep13 genomic library (ATCC 37323). Adjust the volume to 15 mL with sterile water. Mix gently by inversion.
   5. Incubate in a water bath at 30 °C for 30 min.
   6. Add 750 µL of dimethyl sulfoxide (DMSO) to enhance the transformation efficiency. Incubate in a water bath at 42 °C for 30 min. Mix by gentle inversion every 10 min.
   7. Pellet the yeast at 3,000 x g for 5 min at room temperature.
   8. Discard the supernatant and resuspend the pellet in 10 mL of sterile water. Pellet at 3,000 x g for 5 min at room temperature.
   9. Resuspend the pellet in 8 mL of sterile water.
   10. To determine the transformation efficiency, dilute 1:10 and plate 100 µL of each dilution on SD Ura^- Leu^- glucose agar (step 1.8).
   11. Plate 200 µL of the sample on SD Ura^- Leu^- galactose agar (step 1.9) plates. Use 50 plates in total.
   12. Incubate at 30 °C for 48−96 h or until colonies appear.
       NOTE: Colonies generally appear on glucose agar plates at 48−72 h and galactose agar plates at 72−96 h.
3. Patch colonies (potential rescues) on SD Ura^- Leu^- galactose agar (step 1.9) to expand and make stock. Incubate at 30 °C for 24−48h.
4. Inoculate 5 mL of SD Ura^- Leu^- glucose broth (step 1.10) using the part of the patch. Incubate overnight at 26 °C with shaking at 150 rpm.
   1. Add 180 µL of the sterile water to 5 wells of a 96 well plate (A2−A6).
   2. Vortex the overnight culture to mix.
   3. Add 180 µL of yeast to the first well (A1). Serially dilute 1:10 (six samples in total including undiluted).
   4. Using a multichannel pipette, spot 5 µL of each dilution on SD Ura^- glucose and SD Ura^- galactose agar plates. Include toxic effector alone as a control.
   5. Incubate at 30 °C for 48 h.
5. Compare the growth of the yeast expressing the toxic effector alone to yeast containing the potential suppressors. Only proceed with potential suppressors that have diminished toxicity compared to the yeast expressing the effector alone.

5. Identify and confirm suppressors

1. Inoculate 5 mL of SD Ura^- Leu^- glucose broth (step 1.10) with 100 µL of yeast from step 4.4 and incubate overnight at 30 °C with shaking at 150 rpm.
   1. Pellet the yeast at 3,000 x g for 2 min at room temperature. Gently discard the supernatant using a pipette.
   2. Isolate the plasmid with a yeast plasmid miniprep kit following the manufacturer's instructions.
2. Transform the isolated plasmid into the E. coli competent cells and plate the entire transformation on LB agar with 100 µg/mL of carbenicillin. Incubate at 37 °C for 24 h.
3. Inoculate 10 mL of LB broth containing 100 µg/mL of carbenicillin, with three colonies from the plate and incubate at 37 °C overnight with shaking at 150 rpm.
   1. Pellet cultures at 3,000 x g for 10 min at room temperature. Isolate plasmid using a miniprep kit following the manufacturer's instructions.
4. Retransform the toxic yeast with the isolated plasmids from step 5.3.1 following the steps in part 3 of the protocol.
   1. Inoculate 5 mL of SD Ura^- Leu^- glucose broth with a colony from the transformation plate. Incubate overnight at 30 °C with shaking at 150 rpm.
   2. Spot on Ura^- Leu^- glucose and galactose agar to confirm suppression of toxicity.
5. Sequence using pYep13 F (ACTACGCGATCATGGCGA) and pYep13 R (TGATGCCGGCCACGATGC) primers to identify yeast ORFs.

Results

Before the actual yeast suppressor screen can be performed, the effector protein of interest must be tested for toxicity in yeast. This is accomplished by expressing the protein of interest in yeast under the control of a galactose-inducible promoter. Growth on glucose (noninducing conditions) should first be compared to ensure toxicity is specifically due to the expression of the protein of interest and is not a general defect. As shown in Figure 3, toxicity manifests as smaller colonies an...

Discussion

This protocol outlines step-by-step procedures for identifying host biological pathways targeted by bacterial effector proteins using a modified yeast toxicity and suppressor screen. The yeast strain used, S. cerevisiae W303, is auxotrophic for both uracil and leucine. Uracil auxotrophy of the strain is used to select yeast carrying the protein of interest on the pYesNTA-Kan vector while leucine auxotrophy is used to select for the yeast genomic library vector pYep13. The yeast genomic library plasmids carry 3&#...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Agar	Fisher Scientific	BP2641500
Galactose	MilliporeSigma	G0750-1KG
GeneJet Gel extraction kit	ThermoFisher Scientific	K0691
GeneJet PCR purification kit	ThermoFisher Scientific	K0701
GeneJet plasmid miniprep kit	Thermo	K0503
Glucose	MilliporeSigma	G8270-1KG
Herring Sperm DNA	Promega	D1811
KpnI-HF	New England Biolabs	R3142S
Lithium acetate dihydrate	MilliporeSigma	L6883-250G
Peptone	Fisher Scientific
Phusion High-Fidelity DNA Polymerase	New England Biolabs	M0530
Poly(ethylene glycol) 3350	MilliporeSigma	1546547-1G
pYep13	ATCC	37323
T4 DNA ligase	New England Biolabs	M0202S
Tryptophan	MilliporeSigma	470031-1G
XhoI-HF	New England Biolabs	R0146S
Yeast extract	Fisher Scientific	BP1422-500
Yeast miniprep kit	Zymo	D2001
Yeast nitrogen base without amino acids	MilliporeSigma	Y0626-250G
Yeast Synthetic Drop-out Medium Supplements	MilliporeSigma	Y1501-20G	without uracil
Yeast Synthetic Drop-out Medium Supplements	MilliporeSigma	Y1771-20G	without uracil, leucine, tryptophan