Summary
This protocol describes an effective in situ hybridization approach to detect the mRNA expression levels and spatial patterns of target genes in Sipunculus nudus coelomic fluid.
Abstract
In situ hybridization (ISH) is a very informative technique to present cellular distribution patterns of specific genes (e.g., mRNA and ncRNA) in tissues. The sipunculid worm Sipunculus nudus is a crucial fishery resource as it has high nutritional and medicinal values. Currently, the research on the molecular biology of Sipunculus nudus is still in its infancy. The purpose of this article is to develop a sensitive method for localizing specific mRNA in Sipunculus nudus coelomic fluid. The protocol includes detailed steps of ISH, including digoxigenin-labeled antisense and sense riboprobe preparation, coelomic fluid collection and section preparation, specific riboprobe hybridization, antibody incubation, coloration and post-coloration treatments. The representative results obtained from a successful experiment using this method are demonstrated. The protocol should be applicable to other Sipuncula species as well.
Introduction
ISH, using a labeled nucleic acid probe to detect the specific DNA or RNA sequence of interest, is a useful method to describe the spatial expression pattern of target genes in morphologically preserved tissues1,2,3. Normally, the target sequence is generated by polymerase chain reaction (PCR), and then used as the template to synthesize the antisense/sense RNA probe labeled with digoxigenin uridine-5’-triphosphate. Samples are fixed and permeabilized before incubation with riboprobe. After washing off the excess probe, hybridization is visualized by immunohistochemistry using an anti-digoxygenin antibody, which is alkaline phosphatase-conjugated3,4,5,6.
Sipunculus nudus (Phylum Sipuncula; order Sipunculida: Sipunculidae) is an unsegmented, coelomate and bilaterally symmetrical marine worm7,8. Sipunculus nudus is a cosmopolitan species widely distributed in tropical and temperate coastal waters. It is also an important marine fishery resource in southern China because of its high nutritional and medicinal values9,10. However, Sipunculus nudus in molecular biology is still in its infancy. To fully understand the biological role of genes, the investigation of genes expression patterns at a cellular resolution is of great interest. In the non-model organism Sipunculus nudus, the ISH method, which is an ideal method to detect the genes expression patterns, has not yet been established. Its coelomic fluid contains several cell types, including granulocytes, urn cells, vesicular cells, germ cells, erythrocytes, etc11. The double sex/mab-3 related transcription factor-1 (dmrt1), used as a representative gene in this method, is a highly conserved transcriptional regulator of sex determination and differentiation in most species ranging from invertebrates to mammals12,13. In a range of species (i.e., black porgy, etc.)14, dmrt1 was expressed in the Sertoli cells, surrounding the germinal cells, whose function is similar to trophoblast cells of Sipunculus nudus. Therefore, we hypothesized that dmrt1 of Sipunculus nudus is expressed in trophoblast cells of spermatozeugmata, and the result of the ISH method clearly confirmed the hypothesis.
This protocol for the first time describes ISH, with digoxigenin-labeled antisense/sense mRNA probes, to determine mRNA expression patterns in its coelomic fluid smear. The optimal reaction conditions are supplied, which allow very sensitive visualization of mRNA expression at high resolution. The developed ISH method could be potentially applied in more Sipunculida species other than Sipunculus nudus.
Subscription Required. Please recommend JoVE to your librarian.
Protocol
The animal procedure was approved by the Animal Care and Welfare Committee of Huaqiao University.
1. Riboprobe preparation
- Primer design
- Open the program Primer 3 (http://bioinfo.ut.ee/primer3-0.4.0/primer3/). Copy the dmrt1 sequence (GenBank: MK182259) into the sequence window.
- Set primer length (23-25 bp), melting temperature (55-60 °C), and G/C content (40-60%). Click Pick Primers.
NOTE: The minimal size required for the RNA probe is approximately 500 bp. Longer probes normally have higher specificity. - Add the T7 RNA polymerase promoter sequence (5, -TAATACGACTCACTATAGGG-3,) to one of the selected primers. The dmrt1 primer sequences for ISH are shown in Table 1.
NOTE: For sense probes, the T7 RNA polymerase promoter is located at the 5’ end of the forward primers. For antisense probes, the T7 RNA polymerase promoter is located at the 5’-end of the reverse primers.
- PCR amplification
- Place the microfuge tubes on ice, and prepare the following reaction mix (for a 50 µL reaction): 1x Taq DNA polymerase mix, 1 µg of cDNA (which is prepared from 100 µL of coelomic fluid), 1 µM forward primer, 1 µM reverse primer and nuclease-free water.
- Mix the PCR reaction by pipetting and centrifuge briefly.
- Place the reaction tube in a thermal cycler, and run the PCR using the following conditions: initial denaturation at 95 °C for 2 min followed by 36 cycles of denaturation at 95 °C for 30 s, annealing at 55-60 °C for 30 s, extension at 72 °C for 30 s and a final extension at 72 °C for 7 min.
NOTE: The annealing temperature should be optimized according to the primers.
- PCR product purification and verification
- Load the 50 µL of PCR mixture directly on a 1% agarose gel. Run the agarose gel at 150-180 V for 10 min in 0.5x TBE. Isolate the specific DNA fragments from the 1% agarose gel.
NOTE: DNA should appear as a single band and not as a smear. - Purify the DNA fragments using a gel extraction kit according to the manufacturer's protocol. Quantify the purified products by spectrophotometry at a wavelength of 260 nm.
- Verify the authenticity of the PCR products by sequencing.
NOTE: (Pause point) The purified PCR products can be stored at -20 °C for several months.
- Load the 50 µL of PCR mixture directly on a 1% agarose gel. Run the agarose gel at 150-180 V for 10 min in 0.5x TBE. Isolate the specific DNA fragments from the 1% agarose gel.
- Riboprobe synthesis
- Place the RNase-free microfuge tubes on ice, and add the following to the microfuge tube (for a 10 µL reaction): 1x Digoxygenin RNA Labeling Mix, 1x transcription buffer, 0.5 µL of RNase inhibitors, 1 µL of T7 RNA polymerases, 1 µg of PCR product and RNase-free water. Mix the reaction by pipetting and centrifuge briefly. Incubate for 2 h at 37 °C.
- Add 2 µL of RNase-free DNase I. Mix the reaction by pipetting and centrifuge briefly. Incubate for 15 min at 37 °C.
- Add 2 µL 0.2 M EDTA (pH 8.0). Mix the reaction by pipetting and centrifuge briefly.
- Add 2.5 µL of 4 M LiCl and 75 µL of prechilled ethanol to the above reaction. Mix well. Leave for 30 min at -70 °C.
- Centrifuge at 12,000 x g for 10 min at 4 °C. Decant the ethanol. Add 1 mL of prechilled 70% ethanol (v/v) and wash the precipitation by mixing gently.
- Centrifuge at 12,000 x g for 5 min at 4 °C. Decant the 70% ethanol and dry the precipitation briefly near an alcohol lamp. Dissolve the precipitation by adding 30 µL of RNase-free water and mix gently.
- Load 2 µL of synthesized RNA on a 1% agarose gel. Run the agarose gel at 180 V for 5-10 min in 0.5x TBE. Measure the concentration of the labeled RNA using a spectrophotometer at a wavelength of 260 nm.
- Use RNase-free microfuge tubes and filter tips to avoid RNase contamination.
NOTE: (Pause point) The digoxygenin-labeled probes can be stored at -70 °C for several months.
- Use RNase-free microfuge tubes and filter tips to avoid RNase contamination.
2. Coelomic fluid collection
- Fix the S. nudus on the dissection table with pins. Open the body of the S. nudus with small autoclaved scissors. Isolate the coelomic fluid with a pipette.
- Collect and transfer 1 mL coelomic fluid with a pipette to poly-D-lysine treated microscope slides. Apply the coelomic fluid evenly with a pipette tip. Air-dry the slides for 1 h at 37 °C.
3. In situ hybridization
- Day 1
- Rehydrate the slides in a slide staining jar containing 100 mL of 1x diethyl pyrocarbonate treated phosphate buffered saline (DEPC-PBS). Rehydrate 3 times with 1x DEPC-PBS, 5 min per wash with gentle agitation.
- Permeabilize the smear of coelomic fluid by digestion with 10 µg/mL proteinase K at room temperature for 5 min. Incubate the slides in 4% paraformaldehyde (PFA) for 20 min to stop the digestion. Wash the slides in 1x DEPC-PBS with gentle agitation for 5 min 3 times.
- Add 50 µL of hybridization mix (HM) containing the sense/antisense riboprobe on the slides and add a cover slip.
- Add wet box buffer into the wet box. Put the slides into the wet box and seal well with paraffin film. Hybridize overnight (at least 16 h) at 60 °C.
- Day 2
- Preheat the wash buffer at 65 °C. Immerse the slide in the slide staining jar containing the wash buffer and let it stand until the coverslip slides off automatically. It takes about 5 min.
- Wash 2 times with wash buffer at 65 °C, 30 min per wash with gentle agitation. Wash 2 times with 0.2x saline-sodium citrate (SSC) at 65 °C, 30 min per wash with gentle agitation. Wash 2 times with maleic acid buffer containing Tween 20 (MABT) at room temperature, 30 min per wash with gentle agitation.
- Incubate the slides at room temperature for 3–4 h in the blocking buffer. Incubate the slides in 1 mL anti-digoxigenin-AP Fab fragments solution diluted at 1/5000 with the blocking buffer at 4 °C overnight.
- Day 3
- Remove the antibody solution and wash the slides briefly in MABT. Wash 4 times with MABT at room temperature, 25 min per wash with gentle agitation.
- Incubate the slides with alkaline phosphatase buffer at room temperature 3 times, 5 min per wash. Remove the alkaline phosphatase buffer, and add 1 mL of 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) staining solution. Keep the slides in the dark.
- Observe the color reaction periodically under an optical microscope. When the color is fully developed (reaction time in the range of 1-4 h), wash the slides 2 times with MABT at room temperature, 5 min per wash with gentle agitation.
- Wash 2 times with stop solution at room temperature, 15 min per wash with gentle agitation. Incubate the slides in methanol to remove excess stain, at room temperature for 30 min. According to the background color, the methanol wash can be done 2 or 3 times and the decolorization time can be extended.
- Wash 2 times with MABT at room temperature, 5 min per wash with gentle agitation. Transfer the slides to a fresh filter paper. Add 50 µL of glycerol. Add the coverslips and observe microscopically.
NOTE: The solution composition is showed in Table 2.
Subscription Required. Please recommend JoVE to your librarian.
Representative Results
A summary of the steps involved in ISH is illustrated in Figure 1. Antisense and corresponding sense riboprobes for dmrt1 were synthesized from PCR products amplified from the coelomic fluid cDNAs. The authenticity of the PCR products was verified by direct sequencing. Riboprobes were synthesized using T7 RNA polymerases according to the manufacturer's protocols and a previous report4 with some minor modifications. The representative signals of ISH are shown in Figure 2. ISH of Sipunculus nudus coelomic fluid with antisense riboprobe that targets dmrt1 reveals purple staining concentrated in trophoblast cells of the spermatozeugmata (Figure 2A, B, red arrows). A sense riboprobe was used as a negative control, and the sense riboprobe for dmrt1 did not detect any hybridization signal (Figure 2C).
Figure 1. Flow diagram of ISH. Blue boxes are the steps for synthesizing riboprobe. Light green boxes are steps for in situ procedures. Please click here to view a larger version of this figure.
Figure 2. The expression of dmrt1 in Sipunculus nudus coelomic fluid detected by ISH. (A, B) Hybridization with dmrt1 antisense riboprobe. (C) Hybridization with dmrt1 sense riboprobe. The red arrows represent hybridization signals in trophoblast cells. sz, spermatozeugmata. Scale bar: 50 µm. This figure has been modified from Li et al.15. Please click here to view a larger version of this figure.
| Name | Sequence (5′-3′) |
| Anti-Probe F | ACAATGTAGCAGGGTTTAATCTTGG |
| Anti-Probe R | TAATACGACTCACTATAGGGAGACTGTTTTCTCTATGCATCCAGTAA |
| Sense-Probe F | TAATACGACTCACTATAGGGAGAACAATGTAGCAGGGTTTAATCTTGG |
| Sense-Probe R | CTGTTTTCTCTATGCATCCAGTAA |
Table 1. The dmrt1 primer sequences.
| Reagent | Composition |
| 5 × TBE (1 L) | 54 g of Tris, 27.5 g of boric acid and 20 mL 0.5 M EDTA (pH 8.0). |
| 10 × PBS (5 L) | 400 g of NaCl, 10 g of KCl, 72 g of Na2HPO4 and 12 g of KH2PO4. |
| DEPC-PBS (1 L) | 1 L of 1 × PBS and 1 mL DEPC. |
| 4% PFA in 1 × PBS (100 mL, pH 7.4) | 4 g of PFA and 100 mL PBS. |
| 10 mg/mL proteinase K (1 mL) | 10 mg of proteinase K. |
| 20 × SSC (1 L) | 175.3 g of NaCl and 88.2 g of citric acid trisodium salt. |
| Wet box buffer (50 mL) | 2.5 mL of 20 × SSC, 22.5 mL of RNase free water and 25 mL of deionized formamide. |
| Hybridization mix (HM, 200 mL) | 100 mL of deionized formamide, 50 mL of 20 × SSC, 10 mg of heparin, 100 mg of tRNA, 0.39 g of citric acid, 200 µL of Tween-20 and RNase free water to 200 mL. |
| Wash buffer (1 L) | 50 mL of 20 × SSC, 500 mL of deionized formamide, 450 mL of sterile water and 1 mL Tween-20. |
| MABT (1 L) | 11.6 g of maleic acid, 8.77 g of NaCl, 8.25 g of NaOH and 1 mL Tween-20. |
| Blocking buffer | 1 × MABT, 2% sheep serum (vol/vol) and 2 mg/mL BSA. |
| Alkaline phosphatase buffer | 100 mM NaCl, 100 mM Tris HCl (pH 9.5), 50 mM MgCl2, and 0.1% Tween 20 (vol/vol). |
| Stop solution | 0.1 M glycine, pH 2.2. |
Table 2. The composition of solutions used in the ISH protocol.
Subscription Required. Please recommend JoVE to your librarian.
Discussion
Previous studies showed that ISH is suitable for detecting multiple target RNAs16,17,18. In this protocol, we described a high-resolution ISH method to detect the mRNA in coelomic fluid and emphasize the optimized hybridization conditions in Sipunculus nudus. The obvious signals of dmrt1 we observed demonstrated the successful application of this protocol in the detection of gene expression (Figure 2).
During the experiment, a series of steps need to be given particular attention. Firstly, sense riboprobes for the target genes must be synthesized as the control. After the synthesis, the quality of the riboprobe should be checked on a gel. Poor RNA synthesis will result in no staining in the sections. Secondly, the sample collection process should be gentle to prevent cell deformation and the experiment must be performed immediately after coelomic fluid collection to prevent RNA degradation. Thirdly, incubation time and times should be exactly followed in all steps without shortening or lengthening. In particular, pay attention to the timing of proteinase K treatment. Too long treatment time of proteinase K will lead to the destruction of the cell structure of the sample, while too short treatment time will not allow the riboprobe to enter the cell properly. Finally, slides should not dry out during the experiment. This method involves a hybridization step at 60 °C, which will increase the risks of reagent evaporation. As stated in the protocol section, slides must be put into a wet box and covered with paraffin film to avoid evaporation.
One limitation of this protocol is the acquisition of riboprobe sequences in non-model organism Sipunculus nudus, because poorly sequenced mRNA may confer low specificity of the riboprobe. With the development of sequencing technology, more and more high-quality sequences of Sipunculus nudus will be released, which will greatly improve this situation.
Subscription Required. Please recommend JoVE to your librarian.
Disclosures
The authors have nothing to disclose.
Acknowledgments
This work was supported by the Young Scientists Fund of the National Natural Science Foundation of China (Grant No. 31801034), the Natural Science Foundation of Fujian Province, China (2016J01161), the Scientific Research Funds of Huaqiao University (15BS306) and Postgraduates’ Innovative Fund in Scientific Research of Huaqiao University.
Materials
| Name | Company | Catalog Number | Comments |
| Agarose | Biowest | 111860 | |
| Anti-digoxigenin-AP Fab fragments | Roche | 11093274910 | |
| BCIP/NBT alkaline phosphatase color development kit | Beyotime | C3206 | |
| Bovine Serum Albumin | Sigma | B2064 | |
| Centrifuge | Eppendorf | 5415R | |
| Citric acid | Sinopharm Chemical Reagent Co. | 5949-29-1 | |
| Citric acid trisodium | Sinopharm Chemical Reagent Co. | 4/3/6132 | |
| Coverslips | Beyotime | FCGF60 | |
| Deionized formamide | Amresco | 12/7/1975 | |
| Diethyl pyrocarbonate, DEPC | Sigma | D5758 | Noxious substance |
| Digoxigenin (DIG) RNA Labeling Mix | Roche | 11277073910 | |
| DNase I, RNase-free | Invitrogen | 18047019 | |
| EDTA | Sigma | 431788 | |
| Electrophoresis gel imaging | Bio-Rad | Universal Hood III | |
| Ethanol | Sinopharm Chemical Reagent Co. | 64-17-5 | |
| Gel extraction kits | Omega | D2500 | |
| Gel-electrophoresis apparatus | Beijing Liuyi Instrument Factory | DYY-6C | |
| Glycerol | Sinopharm Chemical Reagent Co. | 56-81-5 | |
| Glycine | Sigma | G5417 | |
| Heparin | Sigma | 8/1/9041 | |
| KCl | Sinopharm Chemical Reagent Co. | 7447-40-7 | |
| KH2PO4 | Sinopharm Chemical Reagent Co. | 7778-77-0 | |
| LiCl | Sigma | 203637 | |
| Maleic acid | Sinopharm Chemical Reagent Co. | 110-16-7 | |
| Methanol | Sinopharm Chemical Reagent Co. | 67-56-1 | Noxious substance |
| MgCl2 | Sinopharm Chemical Reagent Co. | 7786-30-3 | |
| Na2HPO4 | Sinopharm Chemical Reagent Co. | 7558-79-4 | |
| NaCl | Biofount | JT0001 | |
| NaOH | Sinopharm Chemical Reagent Co. | 1310-73-2 | Corrosive |
| Paraffin film | Bemis Company, Inc. | PM-996 | |
| Paraformaldehyde, PFA | Sigma | 158127 | Noxious substance |
| PCR Instrument | Life Technology | Proflex | |
| Pins | Deli | 16 | |
| Pipette | Eppendorf | plus G | |
| Poly-D-lysine treated microscope slides | Liusheng | VER_A01 | |
| Proteinase K | Sigma | SRE0005 | |
| RNase free water | HyClone | SH30538. 02 | |
| RNase inhibitor | Roche | 3335399001 | |
| S. nudus | |||
| Sheep serum | Beyotime | C0265 | |
| Slide staining jar | Beyotime | FG010 | |
| Slide storage box | Beyotime | FBX011 | |
| Small autoclaved scissors | Shuanglu | sku_8330 | |
| Spectrophotometers | Thermo Fisher | NanoDrop 2000/2000c | |
| T7 RNA polymerases | Roche | 10881767001 | |
| Taq DNA polymerase mix (2X) | Thermo Scientific | K1081 | |
| Tris HCl | Sigma | RES3098T | |
| tRNA | Roche | 10109517001 | |
| Tween-20 | Sigma | P1379 | |
| Water bath | Zhengzhou Great Wall Scientific Industrial | HH-S2 |
References
- Tsai, C. J., Harding, S. A.
- Koshiba-Takeuchi, K. Whole-mount and section in situ hybridization in mouse embryos for detecting mRNA expression and localization. Methods in Cell Biology. 1752, 123-131 (2018).
- Wu, J., Feng, J. Q., Wang, X. In situ hybridization on mouse paraffin sections using DIG-labeled RNA probes. Methods in Molecular Biology. 1922, 163-171 (2019).
- Thisse, C., Thisse, B. High resolution in situ hybridization on whole-mount zebrafish embryo. Nature Protocols. 3, 59-69 (2008).
- Luc, H., Sears, C., Raczka, A., Gross, J. B. Wholemount in situ hybridization for Astyanax embryos. Journal of Visualized Experiments. (145), (2019).
- Abler, L. L., et al. A high throughput in situ hybridization method to characterize mRNA expression patterns in the fetal mouse lower urogenital tract. Journal of Visualized Experiments. (54), (2011).
- Du, X., Chen, Z., Deng, Y., Wang, Q. Comparative analysis of genetic diversity and population structure of Sipunculus nudus as revealed by mitochondrial COI sequences. Biochemical Genetics. 47, 884 (2009).
- Lemer, S., et al. Re-evaluating the phylogeny of Sipuncula through transcriptomics. Molecular Phylogenetics and Evolution. 83, 174-183 (2015).
- Jiang, S., et al. Radioprotective effects of Sipunculus nudus L. polysaccharide combined with WR-2721, rhIL-11 and rhG-CSF on radiation-injured mice. Journal of Radiation Research. 56, 515-522 (2015).
- Zhang, C. X., Dai, Z. R., Cai, Q. X. Anti-inflammatory and anti-nociceptive activities of Sipunculus nudus L. extract. Journal of Ethnopharmacology. 137, 1177-1182 (2011).
- Ying, X. P., et al. The fine structure of coelomocytes in the sipunculid Phascolosoma esculenta. Micron. 41, 71-78 (2010).
- Raymond, C. S., Murphy, M. W., O'Sullivan, M. G., Bardwell, V. J., Zarkower, D. Dmrt1, a gene related to worm and fly sexual regulators, is required for mammalian testis differentiation. Genes & Development. 14, 2587-2595 (2000).
- Kopp, A. Dmrt genes in the development and evolution of sexual dimorphism. Trends in Genetics. 28, 175-184 (2012).
- Wu, G. C., et al. Testicular dmrt1 is involved in the sexual fate of the ovotestis in the protandrous black porgy. Biology of Reproduction. 86, 41 (2012).
- Li, W. H., Wu, Y. Q., Ma, G. X., Yuan, M. R., Xu, R. A. Cloning and expression analysis of peanut worms transcription factor dmrt1. Acta Hydrobiologica Sinica. 43, 1210-1215 (2019).
- Wang, F., et al. RNAscope: a novel in situ RNA analysis platform for formalin-fixed, paraffin-embedded tissues. Journal of Molecular Diagnostics. 14, 22-29 (2012).
- Baleriola, J., Jean, Y., Troy, C., Hengst, U. Detection of axonally localized mRNAs in brain sections using high-resolution in situ hybridization. Journal of Visualized Experiments. (100), e52799 (2015).
- Wilkinson, D. G., Nieto, M. A. Detection of messenger RNA by in situ hybridization to tissue sections and whole mounts. Methods in Enzymology. 225, 361 (1993).
