Method Article

Directly Measuring Forces Within Reconstituted Active Microtubule Bundles

DOI:

10.3791/63819

May 10th, 2022

* These authors contributed equally

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Here, we present a protocol for reconstituting microtubule bundles in vitro and directly quantifying the forces exerted within them using simultaneous optical trapping and total internal reflection fluorescence microscopy. This assay allows for nanoscale-level measurement of the forces and displacements generated by protein ensembles within active microtubule networks.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Microtubule networks are employed in cells to accomplish a wide range of tasks, ranging from acting as tracks for vesicle transport to working as specialized arrays during mitosis to regulate chromosome segregation. Proteins that interact with microtubules include motors such as kinesins and dynein, which can generate active forces and directional motion, as well as non-motor proteins that crosslink filaments into higher-order networks or regulate filament dynamics. To date, biophysical studies of microtubule-associated proteins have overwhelmingly focused on the role of single motor proteins needed for vesicle transport, and significant progress has been made in elucidating the force-generating properties and mechanochemical regulation of kinesins and dyneins. However, for processes in which microtubules act both as cargo and track, such as during filament sliding within the mitotic spindle, much less is understood about the biophysical regulation of ensembles of the crosslinking proteins involved. Here, we detail our methodology for directly probing force generation and response within crosslinked microtubule minimal networks reconstituted from purified microtubules and mitotic proteins. Microtubule pairs are crosslinked by proteins of interest, one microtubule is immobilized to a microscope coverslip, and the second microtubule is manipulated by an optical trap. Simultaneous total internal reflection fluorescence microscopy allows for multichannel visualization of all the components of this microtubule network as the filaments slide apart to generate force. We also demonstrate how these techniques can be used to probe pushing forces exerted by kinesin-5 ensembles and how viscous braking forces arise between sliding microtubule pairs crosslinked by the mitotic MAP PRC1. These assays provide insights into the mechanisms of spindle assembly and function and can be more broadly adapted to study dense microtubule network mechanics in diverse contexts, such as the axon and dendrites of neurons and polar epithelial cells.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Cells employ microtubule networks to perform a wide variety of mechanical tasks, ranging from vesicle transport1,2,3 to chromosome segregation during mitosis4,5,6. Many of the proteins that interact with microtubules, such as the molecular motor proteins kinesin and dynein, generate forces and are regulated by mechanical loads. To better understand how these critical molecules function, researchers have employed single-molecule biophysical methods, such as optical trapping and TIRF microscopy, to directly monitor critical parameters such as unloaded stepping rates, processivity, and force-velocity relationships for individual proteins. The most commonly used experimental geometry has been to attach motor proteins directly to trapping beads whose spherical geometry and size mimic vesicles undergoing motor-driven transport. Numerous kinesins, including kinesin-17,8,9, kinesin-210,11,12, kinesin-313,14,15,16 kinesin-517,18, kinesin-819,20, as well as dynein and dynein complexes21,22,23,24,25, have been studied with these methods.

In many cellular processes, however, motor and non-motor proteins use microtubules both as track and cargo26,27. Moreover, in these scenarios where microtubule filaments are crosslinked into higher-order bundles, these proteins function as ensembles rather than single units. For example, within dividing somatic cells, dense filament networks self-organize to build the mitotic spindle apparatus28,29,30. The interpolar spindle microtubule network is highly dynamic and is largely arranged with minus-ends pointing toward the spindle poles and plus-ends overlapping near the spindle equator. Filaments within the spindle are crosslinked by motor proteins such as kinesin-531,32,33, kinesin-1234,35,36, and kinesin-1437,38,39, or by non-motor proteins such as PRC140,41,42,43 or NuMA44,45,46. They frequently move or experience mechanical stress during processes such as poleward flux or while coordinating chromosome centering during metaphase or chromosome segregation during anaphase47,48,49,50,51,52. The integrity of the micron-scale spindle apparatus through mitosis, therefore, relies on a carefully regulated balance of pushing and pulling forces generated and sustained by this network of interacting filaments. However, the tools needed to probe this mechanical regulation and explain how protein ensembles work in concert to coordinate microtubule motions and produce the forces needed to properly assemble the spindle have only recently been developed, and we are just beginning to understand the biophysical rules that define dynamic microtubule networks.

The goal of this manuscript is to demonstrate the steps required to reconstitute crosslinked microtubule pairs in vitro, immobilize these bundles in a microscopy chamber that allows for simultaneous fluorescence visualization of both the microtubules and crosslinking proteins and nanoscale force measurement, and process these data robustly. We detail the steps needed to stably polymerize fluorescence-labeled microtubules, prepare microscope coverslips for attachment, prepare polystyrene beads for optical trapping experiments, and assemble crosslinked filament networks that preserve their in vivo functionality while allowing for direct biophysical manipulation.

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. Preparation of microtubules

NOTE: When employing GFP-labeled crosslinking proteins, red (e.g., rhodamine) and far-red (e.g., biotinylated HiLyte647, referred to as biotinylated far red in the rest of the text) organic fluorophore labeling of the microtubules works well. Minimal crosstalk between all three channels can be achieved during imaging by using a high-quality quad band total internal reflection fluorescence (TIRF) filter.

  1. Prepare GMPCPP microtubule seed stocks
    1. Suspend 1 mg of unlabeled lyophilized tubulin in 84 µL of ice-cold 1x BRB80 (80 mM PIPES, 1 mM MgCl2, 1 mM EGTA; pH 6.8), with DTT added to a final concentration of 1 mM just prior to use. Suspend 60 µg of fluorophore-labeled lyophilized tubulin in 6 µL of cold 1x BRB80 with 1 mM DTT. Suspend 60 µg of biotin-labeled lyophilized tubulin in 6 µL of cold 1x BRB80 with 1 mM DTT.
    2. To prepare non-biotinylated rhodamine-labeled tubulin seed stock with a labeling ratio of 1:10, add 84 µL of unlabeled tubulin, 6 µL of fluorophore-labeled tubulin, and 10 µL of 10 mM GMPCPP stock solution to a 0.5 mL tube. Mix well by gently pipetting and keep on ice.
      NOTE: GMPCPP polymerization is preferred for these assays as the microtubules are more stable and amenable to direct manipulation with the optical trap than if polymerized with GTP or if taxol is omitted.
    3. To prepare biotinylated far red-labeled tubulin seed stock with a fluorescent labeling ratio of 1:10, add 80 µL of unlabeled tubulin, 6 µL of fluorophore-labeled tubulin, 4 µL of biotin-labeled tubulin, and 10 µL of 10 mM GMPCPP stock solution in a 0.5 mL tube. Mix well by gently pipetting and keep on ice. Incubate the seed stock on ice for 5 min.
    4. Transfer the tubulin solution to a polycarbonate tube appropriate for high-speed centrifugation. Centrifuge the seed stock at ~350,000 x g for 5 min at 2 °C to prevent microtubule polymerization and recover the supernatant for aliquoting. The final estimated concentration of tubulin at this stage is ~50 µM.
    5. Using 0.2 mL PCR tubes, prepare 2 µL aliquots of the seed stock and flash freeze with liquid nitrogen. Aliquots can be stored at -80 °C for up to 6 months.
  2. Polymerization of microtubules
    1. Prepare 500 µL of 1x BRB80 and place on ice. Place one each of the biotinylated far red and non-biotinylated rhodamine seed stock aliquots on ice to thaw.
    2. Incubate the seed stocks on ice for 5 min. At the end of the incubation period, immediately add 26 µL of 1x BRB80 to each tube. If longer microtubules are desired, increase the volume of BRB80 by 5-10 µL, whereas, for shorter microtubules, reduce the volume for polymerization by 5 µL.
    3. Incubate the microtubule seed stocks for 1 h at 37 °C in a water bath. Combine 298.5 µL of room temperature 1x BRB80 and 1.5 µL of 4 mM taxol stock solution to produce a 20 µM taxol solution. Prepare 300 µL of 1x BRB80 and keep both tubes at room temperature.
    4. Warm an appropriate high-speed rotor to 30 °C. This can be done in a tabletop ultracentrifuge set to 30 °C. Remove the microtubules from the water bath and keep at room temperature on a benchtop for 10-15 min.
  3. Clarification of microtubules
    1. Add 100 µL of room temperature 1x BRB80 to the microtubule growth solution and mix by flicking the tube ~10 times or gently pipetting. Transfer the microtubule growth solution into a polycarbonate centrifuge tube.
    2. Mark one side of the polycarbonate tube, which will face outward relative to the rotation of the centrifuge. This will assist in locating the microtubule pellet, which will be barely visible due to the small volume of material.
    3. Centrifuge the microtubule solution at ~350,000 x g for 10 min at 30 °C. After centrifugation, inspect the tube containing the microtubules for a pellet if possible. Remove all but the final few microliters of liquid carefully, without disturbing the pellet. If the pellet is not clearly visible, use the marking made as a guide to avoid disturbing the area where the pellet is located.
    4. Immediately add 100 µL of 1x BRB80 + 20 µM taxol to the microtubule tube. This can be added directly onto the pellet; disruption of the pellet at this stage does not significantly impact the clarification process.
    5. Centrifuge the microtubules again at ~350,000 x g for 10 min, being careful to ensure the marked section of the tube is again oriented outward relative to the rotation of the centrifuge.
    6. Remove all but a few microliters of solution as before, again being careful to avoid disrupting the microtubule pellet. Repeat Steps 1.3.4.-1.3.5. and then resuspend the microtubule pellet in 20-50 µL of 1x BRB80 + 20 µM taxol.
    7. Resuspend by pipetting up most of the resuspension volume and gently ejecting it directly onto the pellet, repeating 20-30x or until the pellet is fully resuspended. This should be done with care so as not to shear the microtubules by overly vigorous pipetting. Cutting the pipette tip to increase the size of the opening can also be helpful to reduce microtubule shearing.
    8. Store the microtubules at room temperature by wrapping the tube in foil to shield the fluorophores from light and keeping on the benchtop. Microtubules are generally usable for 2-3 days after clarification.
  4. Assessment of microtubules through microscopy
    1. Prepare a 1:10 dilution of the clarified microtubule solution by mixing 1 µL of microtubules and 9 µL of room temperature 1x BRB80. Immediately image this solution by pipetting 10 µL onto a microscope slide and then placing a coverslip over the droplet to form a squash.
    2. Ensure that microtubules ranging in lengths from 8-25 µm at a high density (several hundred per full field of view layered in a dense meshwork) are visible when visualized using fluorescence microscopy and a 100x objective focused on the coverslip surface in contact with the microtubule dilution.

2. Preparation of passivated coverslips

  1. Washing coverslips
    1. Place 18 mm x 18 mm coverslips in non-reactive plastic racks, then place each rack into a 100 mL beaker. Place one coverslip per slot in the racks, as cleaning both sides of the coverslips is necessary.
    2. Sonicate using a bath sonicator for 5 min, using 50 mL of the following solutions in the order given for each sonication cycle: (1) deionized water (with 18.3 MΩ-cm resistivity), (2) 2% Micro-90 solution, (3) deionized water, (4) freshly prepared 0.1 M KOH, (5) deionized water (Figure 1A). Make sure that the coverslips are fully covered in liquid. Between sonication cycles, rinse each rack of coverslips in deionized water by using tweezers to dip the rack up and down 10-20x in deionized water, replace the water, and repeat the rinse process 2x.
    3. Rinse the coverslips 3x in water, then refill the beakers with 100% ethanol and return the racks to the beakers. Move the beakers into a fume hood and lay out enough tissue wipes to make room for all the coverslip racks. Then, remove the racks with tweezers and place on the tissue wipes.
    4. Using a dry nitrogen gas stream, blow off the ethanol from the coverslips and their racks until dry. Dispose of the remaining ethanol from the beakers and similarly dry them using the dry nitrogen gas stream (Figure 1A).
  2. Aminosilane surface functionalization on coverslips
    1. Prepare (3-Aminopropyl)tiethoxysilane (APTES) reagent solution by adding 40 mL of acetone and 400 µL of APTES reagent to a 50 mL conical tube, capping tightly, and mixing by inverting 10x.
    2. Move one rack of coverslips into its corresponding dry beaker, and then fully submerge in APTES solution. Incubate for 5 min (Figure 1A). Move the APTES-treated rack to a new dry beaker, and move a new rack into the APTES to incubate for 5 m.
    3. Rinse the treated rack with deionized water by dipping the rack 10-20x as described in Step 2.1.2., replacing the water 5x. Repeat until all the coverslips have been treated and washed.
  3. PEGylation of aminosilane surface
    1. Prepare two PEG solutions, one of ~100 µL with 25% w/v PEG and another of ~10 µL with 10% w/v biotin-PEG, both suspended in freshly prepared 0.1 M NaHCO3, sufficient to coat 24 coverslips. Centrifuge the 25% PEG solution at 3,000 x g for 20 s once 0.1 M NaHCO3 is added to fully dissolve the PEG; the solution may remain cloudy. Mix the biotin-PEG by gentle pipetting (Figure 1B).
    2. Prepare a mixture of the PEG and biotin-PEG solutions, with 33.3 times volume of PEG to 1 volume of biotin-PEG (e.g., 100 µL of PEG solution and 3 µL of biotin-PEG solution).
    3. In a fume hood, lay out several sterile and lint-free wipes. Move the coverslip racks onto the wipes and blow dry with a dry nitrogen gas stream as before. On several new and dry wipes, lay out the now fully dried coverslips arranged in pairs and label each at the bottom right corner with an asymmetric symbol such as "b". This marking will be opposite the sample surface of the coverslip and will not interfere with the experiment (Figure 1B).
    4. Flip one coverslip in each pair with tweezers. Onto each flipped coverslip, place 6 µL of PEG/biotin-PEG mixture and place the second coverslip on top so that both "b" labels face outward.
    5. Align the coverslip edges, and place into a humidified and airtight chamber to prevent drying. Incubate the coverslips in the humidity chamber at room temperature for 3 h.
    6. After incubation, remove the coverslips from the humidity chamber, carefully separate the coverslip pairs, and place them back into their racks. Wash each rack in deionized water as before, dipping the racks using tweezers 10-20x and replacing the water a total of 5x.
    7. Place all PEGylated sides of the coverslips facing the same direction so that no two PEGylated coverslip surfaces face each other. The PEGylated surface will be very sticky until it fully dries, so take extra care to prevent the coverslips from touching. Dry each rack and coverslips as before using a dry nitrogen gas stream (Figure 1B).
    8. Once the coverslips and their racks are fully dried, store in a vacuum desiccator to prevent degradation of the surface coating. Properly stored under vacuum and with desiccant to prevent moisture from disrupting the PEG coating; coverslips can be used for approximately 1 week.

3. Preparation of kinesin-coated beads

  1. Selection and preparation of rigor kinesin construct
    1. Express and purify rigor kinesin constructs according to published protocols53,54. Flash freeze 5 µL aliquots of 0.02 mg/mL kinesin solutions and store at -80 °C for up to 1 year.
      NOTE: Rigor kinesin proteins have a G234A point mutation that prevents ATP hydrolysis. When conjugated to microbeads, high affinity interactions with the microtubule allow beads to sustain loads of 10-20 pN for several minutes. Rigor mutated versions of both the commonly employed kinesin-1 homodimer K56053 and a further optimized K439 construct55 have also been employed with success in these assays54. This improved K439 construct contains an EB1 dimerization domain to enhance stability and a C-terminal 6-His tag for specific binding to a 6-His antibody, as described below.
  2. Binding 6-His antibody to streptavidin-coated beads
    1. Add 50 µL of 1 µm diameter streptavidin-coated polystyrene beads into a 0.5 mL centrifuge tube. Sonicate for 30 s.
    2. Add 10 µL of 200 mM DTT to 790 µL of 1x BRB80. Add 10 µL of sonicated beads to 40 µL of this 1x BRB80 + 2.5 mM DTT buffer.
    3. Combine 1 µL of biotinylated 6-His antibody and 49 µL of 1x BRB80 + 2.5 mM DTT; vortex briefly to mix.
    4. Combine the 50 µL of diluted bead mixture and 50 µL of antibody dilution in a new tube. Place the tube in a tube rotator at 4 °C and rotate for 1 h. Spin down the bead mixture for 10 min at 3,000 x g at 4 °C.
    5. Pipette off the supernatant and resuspend the pellet in 100 µL of 2 mg/mL casein solution in 1x BRB80. Repeat this centrifugation and resuspension 2x.
  3. Addition of rigor kinesin
    1. Resuspend the final pellet in 100 µL of 2 mg/mL casein solution. In a 0.5 mL centrifuge tube, combine 5 µL of 0.02 mg/mL rigor kinesin and 5 µL of beads, mixing gently by lightly flicking the tube ~10x.
    2. Keep both the K439 G234A bead suspension and the remaining 6-His beads on the rotor at 4 °C when not in use. Beads must be prepared fresh and used the same day for the experiments as they tend to clump and lose activity beyond this time.

4. Assembly of the microscopy chamber

  1. Preparation of glass slides and chamber construction
    1. Rinse 75 mm x 25 mm microscope glass slides first with ultrapure water, followed by non-streak ammonia-d glass cleaner, and then once more with ultrapure water. Shake to remove excess water droplets. Dry the slides using a nitrogen stream so that no streaks remain and lay the slides down on a paper towel (Figure 2A).
    2. With scissors, cut double-sided tape into strips of ~2-3 mm x 2.5 cm (2 strips per single chamber and 3 per double chamber).
    3. Using forceps, lay two strips of tape onto one glass slide so that there is ~0.5 cm of space in between them to construct a single chamber. For double chambers, use the same spacing, but with three strips of tape (Figure 2B). The volume of the sample channel using this method is approximately 10 µL.
      NOTE: The wider the chamber(s), the more likely it is that bubbles will form when solutions are flowed in; however, chambers that are less than 0.5 cm wide can be challenging to use due to the reduced area for imaging.
    4. Scrape across the length of each strip of tape using forceps so that the tape is firmly adhered to the glass slide.
    5. Release the pressure from the desiccator and use forceps to remove one biotinylated coverslip from a storage rack. Place one biotinylated coverslip on top of the glass slide using forceps. Make sure that the biotinylated side is facing inwards, toward the glass slide.
    6. Using the flat back end of the forceps, gently press on the glass where the coverslip touches the tape to securely seal the chambers. Light pressure must be used to ensure that the coverslip does not crack (Figure 2C).
    7. Store the finished microscopy chambers in an airtight container, away from direct light, until use (Figure 2D).
      NOTE: It is recommended to use chambers on the same day that they are made, as the biotinylated coverslips degrade when exposed to air.
  2. Flow-in of microscopy reagents
    1. Construct a humidity chamber by placing a folded-up lint-free tissue dampened with ultrapure water at the bottom of an empty pipette tip box. The sample chambers should be kept in this box between flow-in steps to reduce evaporation of solutions from the channel.
    2. Introduce all the reagents by pipetting the liquid at one end of the channel and wicking liquid out at the opposite end. To wick, twist one end of the tissue and gently place it on the exit side of the chamber, allowing for capillary action to homogeneously distribute the reagent (Figure 3A). Bring all reagents to room temperature just before flowing in to prevent microtubule depolymerization.
    3. Using a 20 µL angled pipette tip so that it is touching the entry side of one chamber, slowly flow in 10 µL of 0.5 mg/mL streptavidin or Neutravidin. Use smaller pipette tips and a slow, constant flow-in of reagents to decrease the likelihood of obtaining bubbles in the chamber (Figure 3B).
    4. Incubate the slide in the humidity chamber for 4 min with the coverslip side of the chamber facing down. This orientation will allow for larger objects, such as microtubules or beads, to sink near the PEGylated surface.
    5. Flush out the chamber using 20 µL of 1x BRB80, using a lint-free tissue to draw out liquids. If there is a leak present in the chamber, discard the slide and start with another one; small bubbles that occur in the chamber will not detrimentally impact imaging.
    6. Repeat the flow-in, incubation, and flush steps with 10 µL of 0.5 mg/mL casein blocking solution (Figure 3C). Dilute biotinylated far-red microtubules ~1:20 and flow 10 µL into the chamber. Incubate for 5 min and flush the chamber with 20 µL of 1x BRB80 (Figure 3D). The optimal density of these microtubules within a 100 µm x 100 µm imaging field of view should be 10-20; and the dilution at this stage should be adjusted to achieve this surface-binding ratio.
    7. Repeat the flow-in, incubation, and flush steps with 10 µL of an appropriate concentration (typically 1-10 nM) crosslinking motor or non-motor protein to be studied (Figure 3E).
    8. Flow in 10 µL of rhodamine microtubules diluted to a similar concentration as the previous biotinylated far-red microtubules. Repeat the incubation and flush steps (Figure 3F).
    9. Combine 1 µL of rigor kinesin-coated beads and 19 µL of reaction buffer optimized for crosslinking protein activity. For example, for analysis of kinesin-5 activity, use reaction buffer with 1 mM TCEP bond breaker, 0.2 mg/mL alpha casein, 70 mM KCl, oxygen scavenging system (4.5 mg/mL glucose, 350 units/mL glucose oxidase, 34 units/mL catalase), 1 mM DTT, and ATP at the desired concentration (e.g., 1 mM for maximum kinesin velocity conditions) in 1x BRB80 (Figure 3G). For analysis of non-motor proteins, omit ATP and vary the concentration of KCl to modulate protein-microtubule interaction strength in these assays.
    10. Seal both edges of the chamber with clear nail polish and wait until the polish dries prior to imaging (Figure 3H). A successfully constructed chamber will have no leakage present and minimal bubbles.

5. Imaging microtubule bundles with 3-color TIRF

  1. Employ an inverted microscope instrument that has TIRF imaging capabilities, and into which a single-beam optical trap has been constructed (Figure 4).
    NOTE: For the studies described here, an inverted microscope was used with a 100x/NA1.49 oil objective lens, TIRF module, and three lasers at 488 nm, 561 nm, and 640 nm for the GFP-tagged protein, rhodamine-labeled microtubules, and biotinylated far red-labeled microtubules, respectively.
    1. Add one drop of immersion oil onto the coverslip of the sample chamber. Excessive oil may damage the microscope objective. With the coverslip side of the sample chamber facing downward, place the sample to be imaged on the microscope platform.
    2. Slowly bring the objective up so that there is contact between both the coverslip and the objective through the oil.Adjust the objective height so that the coverslip surface of the sample chamber is in focus.
    3. Record single frame images of the sample in all three channels. For the experiments here,use 100-200 ms of exposure as an optimal imaging duration across all three channels; longer exposure times may result in increased photobleaching.
    4. Adjust the laser power to achieve a good signal-to-noise ratio from the samples while minimizing photobleaching over the 2-5 min when the individual bundle is assayed. For the laser used here (Figure 4 and Figure 5), use a laser power of 5 mW for the GFP channel and 3 mW for both microtubule channels as optimal.
      NOTE: Successfully assembled bundles should consist of one surface-immobilized microtubule in the far-red channel, a coextensive region of several microns with significant GFP-protein signal, and a rhodamine microtubule overlapping these regions and then extending several microns away from the bundle (Figure 5B,C and Figure 6). Live imaging of the rhodamine microtubule should reveal subtle fluctuations at the non-crosslinked microtubule end, indicating this filament is unattached to the surface or other proteins in the chamber.
    5. Observe the frequency of microtubule bundles per field of view. For a successfully prepared sample, there should be approximately 3-4 microtubule bundles present per 100 µL x 100 µL field of view per chamber.

6. Performing optical trap experiments on microtubule bundles

  1. Pre-experimental calibration of conditions
    1. To perform these experiments, use a single-beam optical trap with a stiffness of 0.05-0.1 pN/nm. Incorporate the trapping optics and position-sensitive photodetector into a TIRF-capable inverted microscope by introducing short pass filters just below the objective and above the condenser, respectively (Figure 4).
    2. In addition, add a nanopositioning stage on which the sample sits to allow the user to move the microtubules with nanometer-scale precision in a controlled manner during these assays. The system used here to acquire representative data has been described in published work27,53,54,56,57.
      NOTE: Though beyond the scope of this protocol, multiple resources are available that detail the construction and calibration of a single-beam optical trap58,59,60.
    3. Observe the density of beads in the sample using a brightfield or DIC channel and the 100x objective on the microscope. Use brightfield microscopy only to identify and manipulate beads and not to simultaneously record with fluorescence image acquisition. Space the beads to be a minimum of 10 µm from one another on average, and ensure that they are free from any kind of surface confinement or attachment and are not attached to one another or otherwise clustering.
    4. Ensure that the biotinylated far-red microtubules are firmly attached to the surface of the coverslip, with no visible Brownian motion, such as motions along the microtubule axis or free ends of microtubules fluctuating in solution.
    5. Ensure that the rhodamine microtubules are attached to biotinylated microtubules via the crosslinking MAP and are visibly fluctuating at their free ends. Surface attachment of non-biotinylated microtubules often indicates that PEGylation may have been unsuccessful or that the PEG coating has degraded.
  2. Motor-drive microtubule sliding measurements
    1. Express and purify the motor protein of interest following published protocols. For example, full-length GFP-tagged kinesin-5 proteins have been successfully purified and employed in these assays53,61, as well as unlabeled kinesin-1262 and kinesin-1463. Assemble and visualize motor-protein crosslinked bundles as described above in steps 4 and 5.
    2. Capture with the optical trap a free single bead in solution that is exhibiting Brownian motion. Adjust the trap optics as necessary to move the bead to the middle of the field of view. Ensure the reflected interference pattern from the trap beam is symmetric and adjust the trap optics to resolve any beam asymmetries.
    3. Move the sample stage so that the free end of a rhodamine microtubule within a bundle is directly below the bead and the bead is several microns away from the overlap region containing crosslinking proteins to minimize trap beam-induced photobleaching. Lower the bead in the Z-axis until it collides with the microtubule. Take care to lower the bead gently, and do not push the bead against the coverslip surface, as this can cause sticking to the coverslip surface.
    4. Briefly turn off the trap to observe with the brightfield channel the motility of the bead attached to the sliding microtubule. When performing motor protein assays, the attached bead will move directionally as the microtubules slide apart. Reactivate the trap and capture the bead again.
    5. Begin recording fluorescence data in the three (488 nm, 561 nm, 640 nm) channels at a rate of 1-2 frames per s using the laser power and exposure times that were optimized in step 5 above.
    6. Using the trapping computer software, record voltage data from the position-sensitive photodetector (X,Y, and SUM intensity signals), the nanopositioning stage (X,Y, and Z coordinates), and the TIRF camera shutter state. Start digitizing these trap voltage values using a dedicated voltage input data acquisition board controlled by appropriate software (such as custom-written LabView code) at a rate of 1-10 kHz, depending on the experimental requirements.
    7. Monitor the force signal as data is acquired and pay close attention to any anomalies that could interfere with successful data collection.
      NOTE: The anomalies include but are not limited to (1) other beads moving into the trap, (2) the bead escaping the trap prematurely, and (3) sudden plummets of force and subsequent failure to reinitiate force against the trap, indicating issues with the rigor kinesin molecules on the surface of the bead.
    8. After measurement, deactivate the trap to release the bead and repeat with a new bead and new microtubule until the required number of experimental repeats is achieved.
  3. Passive crosslinking resistance measurements
    1. Express and purify the non-motor crosslinking proteins of interest following published protocols. For example, full-length GFP-labelled PRC143,54,57 and a dimeric NuMA truncated construct56 have been successfully employed in these assays. Assemble and visualize the crosslinked bundles as described above in steps 4 and 5.
    2. Identify a suitable microtubule bundle that contains only two microtubules, one biotinylated with full surface attachment and one non-biotinylated microtubule that is partly free in solution; this gives a free end to attach a bead and guarantees that the bead is not attached to the surface-bound microtubule and is aligned on either the X- or Y-axis, such that the stage motion will be along only one axis.
    3. Use the optical trap to capture a free bead undergoing Brownian motion. Once the bead has been trapped, carefully move the bead over to the selected microtubule bundle, ensuring no other beads are pulled into the trap in the process. Ensure that the bead is several microns away from the overlap region containing crosslinking proteins to minimize photobleaching of the GFP tag.
    4. Carefully lower the bead in the Z-axis until it makes contact with the edge of the free segment of the rhodamine microtubule. Pull up gently and move perpendicular to the microtubule axis to check for attachment by observing the rhodamine microtubule bending and following the bead position. If not attached, repeat the gentle bumping of the bead onto the microtubule until attached.
    5. Carefully realign the rhodamine microtubule along the microtubule axis of the surface-attached microtubule by moving the nanopositioning stage and set up the parameters for automated pulling of the microtubule bundle. Set the direction along the parallel axis of the microtubules, set the desired pull speed (25-200 nm/s is a useful range of speeds), and desired pull time (approximately 30 s to 2 min) depending on overlap length.
    6. Begin recording fluorescence data in the three (488 nm, 561 nm, 640 nm) channels at a rate of 1-2 frames per second. Use laser powers and exposure times optimized in step 5 above.
    7. Initiate automated stage motion and record trapping data from the position-sensitive detector, stage, and TIRF camera state. Monitor for any factors that could interfere with data collection, which include but are not limited to (1) another bead entering the trap, (2) premature loss of microtubule crosslinking, or (3) bead detachment from the rhodamine microtubule.
    8. Deactivate the trap to release the bead and repeat the experiment as desired. A typical sample chamber can be used for approximately 30 min before degradation of the bundles and loss of protein activity occurs.
      ​NOTE: Degradation effects will vary by crosslinker used but can manifest as the formation of static puncta on either the microtubules or surface, the loss of microtubule fluctuations indicating non-specific binding, or the inability to stably attach beads to microtubules.

7. Analysis of data and correlation of fluorescence images with optical trap records

NOTE: To optimize data collection, it is beneficial to employ two separate computer control systems: one for the optical trapping software and another for the fluorescence imaging. This setup allows for high-speed data acquisition in both experimental modalities and eliminates nano- and microsecond delays in operation execution being introduced to the data, which can arise when using a single CPU.

  1. Digitize the optical trapping data at a rate optimized for the employed motor or non-motor crosslinking proteins and their expected rates of stepping (e.g., typically between 1-10 kHz).
  2. Record X,Y, and SUM voltage signals from the position-sensitive photodetector, as well as the X,Y, and Z positional data of the nano-positioning stage using dedicated software for controlling the optical trap and sampling the digital voltage signals from these components.
  3. Record the shutter-open state digital signal from the camera with an additional voltage input channel on the optical trapping data acquisition board. This allows for correlation of the fluorescence imaging data with the optical trapping time traces. Begin data collection with the optical trap prior to the initiation of imaging so that the camera signal from the first frame is properly recorded.
  4. Average the raw time series data acquired at high sampling rates using an appropriate filtering method, such as sliding window, median filter, or Gaussian filter, depending on needs.
  5. Quantify the fluorescence image time series data using methods such as linescan analysis, wherein the pixel intensity value along the length of the microtubule region is calculated. From these linescan trajectories, identify the microtubule edges, and, therefore, the overlap regions. In addition, use the fluorescence intensity from the crosslinker protein channel to calculate protein localization, concentration, and density.
  6. Correlation of force and image data is an essential output of this experimental system. For example, select and average all force data points within a given camera exposure region (indicated by the corresponding digital signal spike in the camera channel) to directly compare with the corresponding fluorescence image frame. Subsequently, extract the relationships between force magnitude and the number of crosslinking proteins, overlap length, or crosslinker distribution.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The preparation of microtubule bundles suitable for biophysical analysis is considered successful if several of the key criteria are met. First, imaging in three colors should reveal two aligned microtubules with a concentration of crosslinking protein preferentially decorating the overlap region (Figure 5B,C and Figure 6B). Ideally, the distance between the overlap edge and the free end of the rhodamine microtubule should be at...

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Microtubule networks are employed by myriad cell types to accomplish a wide range of tasks that are fundamentally mechanical in nature. In order to describe how cells function in both healthy and disease states, it is critical to understand how these micron-scale networks are organized and regulated by the nanometer-sized proteins that collectively build them. Biophysical tools such as optical tweezers are well suited to probing the mechanochemistry of key proteins at this scale. Reflecting the diversity of microtubule n...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have nothing to disclose.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors wish to acknowledge support from R21 AG067436 (to JP and SF), T32 AG057464 (to ET), and Rensselaer Polytechnic Institute School of Science Startup Funds (to SF).

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
10W Ytterbium Fiber Laser, 1064nmIPG PhotonicsYLR-10-1064-LP
405/488/561/640nm Laser Quad Band Set for TIRF applicationsChromaTRF89901v2
6x His Tag Antibody, Biotin ConjugateInvitrogen#MA1-21315-BTIN
Acetone, HPLC gradeFisher Scientific18-608-395
Alpha casein from bovine milkSigma1002484390
ATPFisher ScientificBP413-25
BenzonaseNovagen70746-3
Biotin-PEG-SVA-5000Laysan Bio, Inc.NC0479433
BL21 (DE3) Rosetta CellsMillipore Sigma71-400-3
CatalaseMP Biomedicals LLC190311
CFI Apo 100X/1.49NA oil immersion TIRF objectiveNikonN/A
ChloramphenicolACROS Organics227920250
Coverslip Mini-Rack, for 8 coverslipsFisher ScientificC14784
Delicate Task WipersKimberly-Clark34120
Dextrose AnhydrousFisher ScientificBP3501
D-SucroseFisher ScientificBP220-1
DTTFisher ScientificBP172-25
Ecoline Immersion Thermostat E100 with 003 BathLAUDA-Brinkmann27709
EDTAFisher ScientificBP118-500
EGTAMillipore Corporation32462-25GM
FIJI / Image Jhttps://fiji.sc/N/A
Frosted Microscope SlidesCorning12-553-1075mmx25mm, with thickness of 0.9-1.1mm
Glucose OxidaseMP Biomedicals LLC195196Type VII, without added oxygen
GMPCPPJena BiosciencesJBS-NU-405SCan be stored for several months at -20 °C and up to a year at -80 °C
Gold Seal-Cover GlassThermo Scientific3405
HEPESFisher ScientificBP310-500
ImidazoleFisher Scientific03196-500
IPTGFisher ScientificBP1755-10
Laboratory dessicatorBel-Art999320237190mm plate size
Kanamycin SulfateFischer ScientificBP906-5
KIF5A K439 (aa:1-439)-6HisGilbert Lab, RPIN/Adoi.org/10.1074/jbc.RA118.002182
KimwipeKimberley ClarkZ188956lint-free tissue
Immersion Oil, Type BCargille16484
Lens TissueThorLabsMC-5
LuNA Laser launch (4 channel: 405, 488, 561, 640nm)NikonN/A
LysozymeMP Biomedicals LLC100834
Magnesium Acetate TetrahydrateFisher ScientificBP215-500
Microfuge 18Beckman Coulter367160
MPEG-SVA MW-5000Laysan Bio, Inc.NC0107576
NeutravadinInvitrogenPI31000
Nikon Ti-E inverted microscopeNikonN/ANikon LuN4 Laser
Ni-NTA ResinThermo Scientific88221
Oligonucleotide - CACCTATTCTGAGTTTGCGCGA
GAACTTTCAAAGGC
IDTN/A
Oligonucleotide - GCCTTTGAAAGTTCTCGCGCAA
ACTCAGAATAGGTG
IDTN/A
Open-top thickwall polycarbonate tube, 0.2 mL, 7 mm x 22 mmBeckman Coulter343755
Optima-TLX UltracentrifugeBeckman Coulter361544
Paclitaxel (Taxol equivalent)Thermo Fisher ScientificP3456
PIPESACROS Organics172615000
PMSFMillipore7110-5GM
Porcine Tubulin, biotin labelCytoskeleton, Inc.T333P
Porcine Tubulin, HiLyte 647 FluorCytoskeleton, Inc.TL670Mfar red labelled
Porcine Tubulin, RhodamineCytoskeleton, Inc.TL590M
Porcine Tubulin, Tubulin ProteinCytoskeleton, Inc.T240
Potassium AcetateFisher ScientificBP364-500
Prime 95B sCMOS cameraPhotometricN/A
Quadrant Detector Sensor HeadThorLabsPDQ80A
Quikchange Lightning KitAgilent Technologies210518
Sodium BicarbonateFisher ScientificS233-500
Sodium Phosphate Dibasic AnhydrousFisher ScientificBP332-500
Square Cover GlassesCorning12-553-45018 mm x 18 mm, with thickness of 0.13-0.17 mm
Streptavidin MicrospheresPolysciences Inc.24162-1
Superose-6 ColumnGE Healthcare29-0915--96
TCEPThermo Scientific77720
TLA-100 Fixed-Angle RotorBeckman Coulter343840
Ultrasonic Cleaner (Sonicator)VevorJPS-08A(DD)304 stainless steel, 40 kHz frequency, 60 W power
Vectabond APTES solutionVector LaboratoriesSP-1800-7
Windex Powerized Glass Cleaner with Ammonia-DS.C. JohnsonSJN695237

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Bentley, M., Banker, G. The cellular mechanisms that maintain neuronal polarity. Nature Reviews Neuroscience. 17 (10), 611-622 (2016).
  2. Yang, R., et al. A novel strategy to visualize vesicle-bound kinesins reveals the diversity of kinesin-mediated transport. Traffic. 20 (11), 851-866 (2019).
  3. Hirokawa, N., Niwa, S., Tanaka, Y. Molecular motors in neurons: Transport mechanisms and roles in brain function, development, and disease. Neuron. 68 (4), 610-638 (2010).
  4. Helmke, K. J., Heald, R., Wilbur, J. D. Interplay between spindle architecture and function. International Review of Cell and Molecular Biology. 306, (2013).
  5. Elting, M. W., Suresh, P., Dumont, S. The spindle: integrating architecture and mechanics across scales. Trends in Cell Biology. 28 (11), 896-910 (2018).
  6. Kapoor, T. Metaphase spindle assembly. Biology. 6 (1), 8(2017).
  7. Svoboda, K., Block, S. M. Force and velocity measured for single kinesin molecules. Cell. 77 (5), 773-784 (1994).
  8. Svoboda, K., Schmidt, C. F., Schnapp, B. J., Block, S. M. Direct observation of kinesin stepping by optical trapping interferometry. Nature. 365 (6448), 721-727 (1993).
  9. Schnitzer, M. J., Visscher, K., Block, S. M. Force production by single kinesin motors. Nature Cell Biology. 2 (10), 718-723 (2000).
  10. Andreasson, J. O. L., Shastry, S., Hancock, W. O., Block, S. M. The mechanochemical cycle of mammalian kinesin-2 KIF3A/B under load. Current Biology. 25 (9), 1166-1175 (2015).
  11. Bensel, B. M. The mechanochemistry of the kinesin-2 kif3ac heterodimer is related to strain-dependent kinetic properties of kif3a and kif3c. Proceedings of the National Academy of Sciences of the United States of America. 117 (27), 15632-15641 (2020).
  12. Gilbert, S. P., Guzik-Lendrun, S., Rayment, I. Kinesin-2 motors: kinetics and biophysics. Journal of Biological Chemistry. 293 (12), 4510-4518 (2018).
  13. Okada, Y., Higuchi, H., Hirokawa, N. Processivity of the single-headed kinesin KIF1A through binding to tubulin. Nature. 424 (6948), 574-577 (2003).
  14. Budaitis, B. G., et al. Pathogenic mutations in the kinesin-3 motor KIF1A diminish force generation and movement through allosteric mechanisms. Journal of Cell Biology. 220 (4), 202004227(2021).
  15. Tomishige, M., Klopfenstein, D. R., Vale, R. D. Conversion of Unc104/KIF1A kinesin into a processive motor after dimerization. Science. 297 (5590), 2263-2267 (2002).
  16. Siddiqui, N., et al. Force generation of KIF1C is impaired by pathogenic mutations. bioRxiv. , (2021).
  17. Valentine, M. T., Fordyce, P. M., Krzysiak, T. C., Gilbert, S. P., Block, S. M. Individual dimers of the mitotic kinesin motor Eg5 step processively and support substantial loads in vitro. Nature Cell Biology. 8 (5), 470-476 (2006).
  18. Valentine, M. T., Gilbert, S. P. To step or not to step? How biochemistry and mechanics influence processivity in Kinesin and Eg5. Current Opinion in Cell Biology. 19 (1), 75-81 (2007).
  19. Jannasch, A., Bormuth, V., Storch, M., Howard, J., Schäffer, E. Kinesin-8 is a low-force motor protein with a weakly bound slip state. Biophysical Journal. 104 (11), 2456-2464 (2013).
  20. Bormuth, V., Varga, V., Howard, J., Schäffer, E. Protein friction limits diffusive and directed movements of kinesin motors on microtubules. Science. 325 (5942), 870-873 (2009).
  21. Gennerich, A., Carter, A. P., Reck-Peterson, S. L., Vale, R. D. Force-induced bidirectional stepping of cytoplasmic dynein. Cell. 131 (5), 952-965 (2007).
  22. Mallik, R., Carter, B. C., Lex, S. A., King, S. J., Gross, S. P. Cytoplasmic dynein functions as a gear in response to load. Nature. 427 (6975), 649-652 (2004).
  23. Redwine, W. B., et al. The human cytoplasmic dynein interactome reveals novel activators of motility. eLife. 6, 28257(2017).
  24. Belyy, V., Hendel, N. L., Chien, A., Yildiz, A. Cytoplasmic dynein transports cargos via load-sharing between the heads. Nature Communications. 5 (1), 5544(2014).
  25. Belyy, V., et al. The mammalian dynein-dynactin complex is a strong opponent to kinesin in a tug-of-war competition. Nature Cell Biology. 18 (9), 1018-1024 (2016).
  26. Subramanian, R., Kapoor, T. M. Building complexity: insights into self-organized assembly of microtubule-based architectures. Developmental Cell. 23 (5), 874-885 (2012).
  27. Forth, S., Kapoor, T. M. The mechanics of microtubule networks in cell division. Journal of Cell Biology. 216 (6), 1525-1531 (2017).
  28. Dumont, S., Mitchison, T. J. Force and length in the mitotic spindle. Current Biology. 19 (17), 749-761 (2009).
  29. McIntosh, J. R., Molodtsov, M. I., Ataullakhanov, F. I. Biophysics of mitosis. Quarterly Reviews of Biophysics. 45 (2), 147-207 (2012).
  30. McIntosh, J., Hays, T. A brief history of research on mitotic mechanisms. Biology. 5 (4), 55(2016).
  31. Ferenz, N. P., Gable, A., Wadsworth, P. Mitotic functions of kinesin-5. Seminars in Cell and Developmental Biology. 21 (3), 255-259 (2010).
  32. Kapitein, L. C., et al. The bipolar mitotic kinesin Eg5 moves on both microtubules that it crosslinks. Nature. 435 (7038), 114-118 (2005).
  33. Vukušić, K., Ponjavić, I., Buđa, R., Risteski, P., Tolić, I. M. Microtubule-sliding modules based on kinesins EG5 and PRC1-dependent KIF4A drive human spindle elongation. Developmental Cell. 56 (9), 1253-1267 (2021).
  34. Sturgill, E. G., Ohi, R. Kinesin-12 differentially affects spindle assembly depending on its microtubule substrate. Current Biology. 23 (14), 1280-1290 (2013).
  35. Drechsler, H., McHugh, T., Singleton, M. R., Carter, N. J., McAinsh, A. D. The Kinesin-12 Kif15 is a processive track-switching tetramer. eLife. 3, 01724(2014).
  36. Tanenbaum, M. E., et al. Kif15 Cooperates with Eg5 to promote bipolar spindle assembly. Current Biology. 19 (20), 1703-1711 (2009).
  37. Mountain, V., et al. Cross-links microtubules in the mammalian mitotic spindle. Journal of Cell Biology. 147 (2), 351-365 (1999).
  38. Norris, S. R., et al. Microtubule minus-end aster organization is driven by processive HSET-tubulin clusters. Nature Communications. 9 (1), 2659(2018).
  39. Cai, S., Weaver, L. N., Ems-McClung, S. C., Walczak, C. E. Proper organization of microtubule minus ends is needed for midzone stability and cytokinesis. Current Biology. 20 (9), 880-885 (2010).
  40. Pamula, M. C., et al. High-resolution imaging reveals how the spindle midzone impacts chromosome movement. Journal of Cell Biology. 218 (8), 2529-2544 (2019).
  41. Bieling, P., Telley, I. A., Surrey, T. A minimal midzone protein module controls formation and length of antiparallel microtubule overlaps. Cell. 142 (3), 420-432 (2010).
  42. Zhu, C., Lau, E., Schwarzenbacher, R., Bossy-Wetzel, E., Jiang, W. Spatiotemporal control of spindle midzone formation by PRC1 in human cells. Proceedings of the National Academy of Sciences of the United States of America. 103 (16), 6196-6201 (2006).
  43. Subramanian, R., et al. Insights into antiparallel microtubule crosslinking by PRC1, a conserved nonmotor microtubule binding protein. Cell. 142 (3), 433-443 (2010).
  44. Elting, M. W., Prakash, M., Udy, D. B., Dumont, S. Mapping load-bearing in the mammalian spindle reveals local kinetochore fiber anchorage that provides mechanical isolation and redundancy. Current Biology. 27 (14), 2112-2122 (2017).
  45. Fant, X., Merdes, A., Haren, L. Cell and molecular biology of spindle poles and NuMA. International Review of Cytology. 238, 1-57 (2004).
  46. Merdes, A., Heald, R., Samejima, K., Earnshaw, W. C., Cleveland, D. W. Formation of spindle poles by dynein/dynactin-dependent transport of NuMA). Journal of Cell Biology. 149 (4), 851-861 (2000).
  47. Maddox, P., Straight, A., Coughlin, P., Mitchison, T. J., Salmon, E. D. Direct observation of microtubule dynamics at kinetochores in Xenopus extract spindles: Implications for spindle mechanics. Journal of Cell Biology. 162 (3), 377-382 (2003).
  48. Maddox, P., Desai, A., Oegema, K., Mitchison, T. J., Salmon, E. D. Poleward microtubule flux is a major component of spindle dynamics and anaphase A in mitotic Drosophila embryos. Current Biology. 12 (19), 1670-1674 (2002).
  49. LaFountain, J. R., Cohan, C. S., Siegel, A. J., LaFountain, D. J. Direct visualization of microtubule flux during metaphase and anaphase in crane-fly spermatocytes. Molecular Biology of the Cell. 15 (12), 5724-5732 (2004).
  50. Pavin, N., Tolić, I. M. Mechanobiology of the mitotic spindle. Developmental Cell. 56 (2), 192-201 (2021).
  51. Vukušić, K., Tolić, I. M. Anaphase B: Long-standing models meet new concepts. Seminars in Cell and Developmental Biology. 117, 127-139 (2021).
  52. Vukušić, K., et al. Microtubule sliding within the bridging fiber pushes kinetochore fibers apart to segregate chromosomes. Developmental Cell. 43 (1), 11-23 (2017).
  53. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  54. Gaska, I., Armstrong, M. E., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts like a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 367-378 (2020).
  55. Woll, K. A., et al. An allosteric propofol-binding site in kinesin disrupts kinesin-mediated processive movement on microtubules. Journal of Biological Chemistry. 293 (29), 11283-11295 (2018).
  56. Forth, S., Hsia, K. C., Shimamoto, Y., Kapoor, T. M. Asymmetric friction of nonmotor MAPs can lead to their directional motion in active microtubule networks. Cell. 157 (2), 420-432 (2014).
  57. Alfieri, A., Gaska, I., Forth, S. Two modes of PRC1-mediated mechanical resistance to kinesin-driven microtubule network disruption. Current Biology. 31 (12), 2495-2506 (2021).
  58. Koch, M. D., Shaevitz, J. W. Introduction to optical tweezers. Methods in Molecular Biology. 1486, 3-24 (2017).
  59. Sarshar, M., Wong, W. T., Anvari, B. Comparative study of methods to calibrate the stiffness of a single-beam gradient-force optical tweezers over various laser trapping powers. Journal of Biomedical Optics. 19 (11), 115001(2014).
  60. Van Mameren, J., Wuite, G. J. L., Heller, I. Introduction to optical tweezers: Background, system designs, and commercial solutions. Methods in Molecular Biology. 783, 1-20 (2011).
  61. Bodrug, T., et al. The kinesin-5 tail domain directly modulates the mechanochemical cycle of the motor domain for anti-parallel microtubule sliding. eLife. 9, 51131(2020).
  62. Reinemann, D. N., et al. Collective force regulation in anti-parallel microtubule gliding by dimeric Kif15 kinesin motors. Current Biology. 27 (18), 2810-2820 (2017).
  63. Reinemann, D. N., Norris, S. R., Ohi, R., Lang, M. J. Processive kinesin-14 HSET exhibits directional flexibility depending on motor traffic. Current Biology:CB. 28 (14), 2356-2362 (2018).
  64. Shimamoto, Y., Forth, S., Kapoor, T. M. Measuring pushing and braking forces generated by ensembles of kinesin-5 crosslinking two microtubules. Developmental Cell. 34 (6), 669-681 (2015).
  65. SMART - Servier Medical ART. , Available from: https://smart.servier.com/ (2022).
  66. Gaska, I., Armstrong, M., Alfieri, A., Forth, S. The mitotic crosslinking protein PRC1 acts as a mechanical dashpot to resist microtubule sliding. Developmental Cell. 54 (3), 1-14 (2020).
  67. Janson, M. E., De Dood, M. E., Dogterom, M. Dynamic instability of microtubules is regulated by force. Journal of Cell Biology. 161 (6), 1029-1034 (2003).
  68. Kerssemakers, J. W. J., et al. Assembly dynamics of microtubules at molecular resolution. Nature. 442 (7103), 709-712 (2006).
  69. Powers, A. F., et al. The Ndc80 kinetochore complex forms load-bearing attachments to dynamic microtubule tips via biased diffusion. Cell. 136 (5), 865-875 (2009).
  70. Akiyoshi, B., et al. Tension directly stabilizes reconstituted kinetochore-microtubule attachments. Nature. 468 (7323), 576-579 (2010).
  71. Fong, K. K., et al. Direct measurement of the strength of microtubule attachment to yeast centrosomes. Molecular Biology of the Cell. 28 (14), 1853-1861 (2017).
  72. Kikumoto, M., Kurachi, M., Tosa, V., Tashiro, H. Flexural rigidity of individual microtubules measured by a buckling force with optical traps. Biophysical Journal. 90 (5), 1687-1696 (2006).
  73. Memet, E., et al. Microtubules soften due to cross-sectional flattening. eLife. 7, 34695(2018).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Force MeasurementOptical TrapTIRF MicroscopyKinesin 5 MotorsMicrotubule SlidingCrosslinking ProteinsSpindle MechanicsCytoskeletal NetworksPRC1 Protein

Related Articles